Mercurial > repos > iuc > mothur_classify_seqs

view test-data/sample2.fa @ 9:8ca80de3f4ef draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4c950508328589b5215b6c96868659a03f9dead8"
author iuc
date Tue, 08 Dec 2020 12:40:24 +0000
parents 2a0d8b8c3ade
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC