Mercurial > repos > iuc > mothur_cluster_split
annotate test-data/sample3.fa @ 2:3c24b99497db draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 3418f23b9768f5aafb86488f5ec1cb97530d4fb3
| author | iuc |
|---|---|
| date | Tue, 20 Mar 2018 22:16:50 -0400 |
| parents | e70a33ec8f3b |
| children |
| rev | line source |
|---|---|
|
0
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
1 > seq1 This is the description of my first sequence in sample 3. |
|
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
2 AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC |
|
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
3 > seq2 This is a description of my second sequence in sample 3. |
|
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
4 CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG |
|
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
5 > seq3 This is a description of my third sequence in sample 3. |
|
e70a33ec8f3b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff
changeset
|
6 CGATCGATCGTACGTCGACTAGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGCGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG |
