Mercurial > repos > iuc > mothur_get_oturep

view test-data/sample2.fa @ 8:1e1a6eaae624 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4c950508328589b5215b6c96868659a03f9dead8"
author iuc
date Tue, 08 Dec 2020 12:54:40 +0000
parents e6758f2f744b
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC