annotate test-data/sample2.fa @ 1:ecbc8745f135 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 721531d2e9fd1e208a3fba8cfbe5dcd572599ca2
author iuc
date Tue, 05 Sep 2017 16:53:28 -0400
parents c49147967884
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
c49147967884 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff changeset
1 > seq1 This is the description of my first and only sequence in sample 2.
c49147967884 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
iuc
parents:
diff changeset
2 AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC