Mercurial > repos > iuc > mothur_make_shared

view test-data/sample2.fa @ 8:fdebbe239529 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit ff56a4c9218ddea84ff5cd72fd98c62db212465d"
author iuc
date Fri, 06 Nov 2020 00:14:11 +0000
parents b8947620846f
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC