Mercurial > repos > iuc > mothur_nmds

view test-data/sample2.fa @ 5:98f1cc2bc428 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 7f7605c2c8d8e92f3369dfdc290e5d8d06fa409a
author iuc
date Fri, 03 Aug 2018 14:36:17 -0400
parents a522f1b60172
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC