Mercurial > repos > iuc > mothur_otu_hierarchy

diff test-data/sample2.fa @ 0:7a4200446cbf draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
author iuc
date Fri, 19 May 2017 06:00:15 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample2.fa	Fri May 19 06:00:15 2017 -0400
@@ -0,0 +1,2 @@
+> seq1 This is the description of my first and only sequence in sample 2.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC