diff test-data/sample1.fa @ 0:14062c54b6f6 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
author iuc
date Fri, 19 May 2017 05:46:37 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample1.fa	Fri May 19 05:46:37 2017 -0400
@@ -0,0 +1,4 @@
+> seq1 This is the description of my first sequence in sample 1.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
+> seq2 This is a description of my second sequence in sample 1.
+CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG