Mercurial > repos > iuc > mothur_unifrac_weighted

view test-data/sample2.fa @ 1:c7e0bc7e19e9 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit e2075caee2ecdc6aed15a356e5328c5ca09cfb13
author iuc
date Fri, 09 Jun 2017 07:13:58 -0400
parents 955f1163d44e
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC