Mercurial > repos > iuc > presto_partition

changeset 1:c3bf9c466305 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/presto commit a42c43c1528ae7b7efe2c5ef848681d574df0405"
author iuc
date Tue, 22 Jun 2021 16:33:38 +0000
parents 0b103d43a2c7
children 824d24bfe8dd
files presto_macros.xml presto_partition.xml test-data/presto_maskprimers_with_barcode_test_score_out.fastq test-data/presto_maskprimers_without_barcode_test_score_out.fastq
diffstat 4 files changed, 6 insertions(+), 6 deletions(-) [+]
line wrap: on
line diff
--- a/presto_macros.xml	Wed May 30 15:35:32 2018 -0400
+++ b/presto_macros.xml	Tue Jun 22 16:33:38 2021 +0000
@@ -8,7 +8,7 @@
     
     <xml name="requirements">
         <requirements>
-              <requirement type="package" version="0.5.4">presto</requirement>
+              <requirement type="package" version="0.6.2">presto</requirement>
         </requirements>
     </xml>
     
@@ -36,7 +36,7 @@
         <validator type="regex" message="Value may include alphanumeric characters, underscores and spaces.">[A-Za-z0-9_ ]+</validator>
     </xml>
 
-    <token name="@PRESTO_URL_BASE@">https://presto.readthedocs.io/en/latest/tools</token>
+    <token name="@PRESTO_URL_BASE@">https://presto.readthedocs.io</token>
     
     <!-- When modifying this file ensure that the version here matches the version above in requirements. -->
     <token name="@PRESTO_VERSION@">0.5.4</token>
@@ -55,4 +55,4 @@
     - Steps that take a single set of fastq inputs can only take a single file
 * The ``--outdir`` and ``--outname`` options are not supported; output files are named directly
     ]]></token>
-</macros>
\ No newline at end of file
+</macros>
--- a/presto_partition.xml	Wed May 30 15:35:32 2018 -0400
+++ b/presto_partition.xml	Tue Jun 22 16:33:38 2021 +0000
@@ -45,7 +45,7 @@
 annotation field to yield one file which contains all sequences with the field value less than the provided threshold and
 a second file with all sequences with the field value greater than or equal to the threshold.
 
-See the `pRESTO online help <@PRESTO_URL_BASE@/SplitSeq.html>`_ for more information.
+See the `pRESTO online help <@PRESTO_BASE_URL@/en/stable>`_ for more information.
 
 @HELP_NOTE@
     ]]></help>
--- a/test-data/presto_maskprimers_with_barcode_test_score_out.fastq	Wed May 30 15:35:32 2018 -0400
+++ b/test-data/presto_maskprimers_with_barcode_test_score_out.fastq	Tue Jun 22 16:33:38 2021 +0000
@@ -1,4 +1,4 @@
-@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|SEQORIENT=F|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 2:N:0:CTATAC|PRIMER=TS-shift3|BARCODE=ATCTTTGCGGCTGGTTA
 GTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCCACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGCCCCTGACCGATTCAGTGGCCGCGGGTCTGGGACAGAGTTCACTCTCAACATCAGCAGCATGCAGTCGGAAGA
 +
 GGGGGGGGGG7CFGGGGGGGEFGFFFGFGGGGGGFFGF8FFEGGGGGGGGFGFGCGFGGGGGGGGGCCFFGGGGGFGGGG9<AFGFGFEFDG?EFGGCFFFGFF9CFE,E+ABE@EGFEGEFGGCFGGGGEGCGGGGGGDDFGGCFGDF,>D+44,@3DCFGC8CGGGFGC9@CGGGGGD8CGG?C79,1556C*00BC5D*/=EC5C4C<EDEC+:0<*:*19)8>*);7ECF*;>*0:9+<AC#############################
--- a/test-data/presto_maskprimers_without_barcode_test_score_out.fastq	Wed May 30 15:35:32 2018 -0400
+++ b/test-data/presto_maskprimers_without_barcode_test_score_out.fastq	Tue Jun 22 16:33:38 2021 +0000
@@ -1,4 +1,4 @@
-@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|SEQORIENT=F|PRIMER=Human-IGK
+@M01873:M01873:000000000-B9G3J:1:2116:20980:12498 1:N:0:CTATAC|PRIMER=Human-IGK
 TTCGTTTGATCTCCAGCTTGGTCCCCTGGCCAAAAGTGGGAGGAGTACTATAATATTGCTGACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGGTCAGGGACCCCGGATTCCCGGGTAGATGCCCAGTAACTGAGCAGCTTAGGAGGCTGTCCTGGTTTCTGCTGGTACCAAGCTAAGTAGTTCTTATTGTTGGAGCTGTATAAAACACTCTGGTTGGACTTGCAGTT
 +
 FFGGDGGGDGGGGGGGGGGGGGFGFGACF8FCFCGGGGGG87BFGGGGGGGGGFFGGGGGGGGCDGCFGGGGGGGGG?@FGGGGDGFGGGCGGGFGCAFFE9?E9FD,4,EFGFGGAEFGGFCFCF8F?EBFEGE8,,AFFCFFF@FECFGGGGCFECFCEEFGGEDEGE>FGGGGCCFGGF,@EDFFF6DFEDFGF8>CCFGGGGFFF9:@C79=6@<=;EFF,=,5C6,+,>CGD7:DF?CFF*0;CG4@+;>C7CDGGFFG7>+*2))**04C4?CC