Mercurial > repos > iuc > qfilt
view qfilt.xml @ 0:5ec69b780e4f draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qfilt commit a91f1a9caaff225bea14afd9f7ede25769b02121
| author | iuc |
|---|---|
| date | Mon, 18 Jun 2018 16:55:27 -0400 |
| parents | |
| children | c5e1ff9191a5 |
line wrap: on
line source
<?xml version="1.0"?> <tool id="qfilt" version="1.0.0" name="qfilt"> <description>filter sequencing data using simple heuristics</description> <requirements> <requirement type="package" version="0.0.1">qfilt</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ qfilt -o '$filtered_output' #if str($options.advanced) == 'advanced': -q $options.qscore -l $options.length $options.split #if $options.replace and $options.remove: -P '$options.replace' -R '$options.remove' #elif $options.mode: -m $options.mode #end if #if $options.prefix: -t $options.mismatch -T '$options.prefix' #end if -f $options.output_format $options.tolerate_homopolymeric $options.tolerate_ambiguous #end if #if $input_data.format == 'fastq': -Q '$input_data.fastq' #else: -F '$input_data.fasta' '$input_data.qual' #end if ]]></command> <inputs> <conditional name="input_data"> <param name="format" type="select" label="Additional options"> <option value="fastq">FASTQ</option> <option value="fastaq">FASTA+QUAL</option> </param> <when value="fastq"> <param name="fastq" argument="-Q" type="data" format="fastq" label="Input FASTA" help="FASTQ File" /> </when> <when value="fastaq"> <param name="fasta" argument="-F" type="data" format="fasta" label="Input FASTA" help="FASTA File" /> <param name="qual" argument="-F" type="data" format="qual" label="Input QUAL" help="FASTQ File" /> </when> </conditional> <conditional name="options"> <param name="advanced" type="select" label="Additional options"> <option value="defaults">Use defaults</option> <option value="advanced">Specify additional parameters</option> </param> <when value="defaults"/> <when value="advanced"> <param name="qscore" argument="-q" type="integer" value="20" label="QScore" help="minimum per-base quality score below which a read will be split or truncated" /> <param name="length" argument="-l" type="integer" value="50" label="Length" help="minimum retained fragment LENGTH" /> <param name="mode" argument="-m" type="integer" value="0" label="Mode" help="MODE is a 3-bitmask (an integer in [0-7], default=0)" /> <param name="split" argument="-s" type="boolean" truevalue="-s" falsevalue="" label="Split" help="when encountering a low q-score, split instead of truncate" /> <param name="tolerate_homopolymeric" argument="-p" type="boolean" truevalue="-p" falsevalue="" label="Tolerate Homopolymeric" help="tolerate low q-score homopolymeric regions" /> <param name="tolerate_ambiguous" argument="-a" type="boolean" truevalue="-a" falsevalue="" label="Tolerate Ambiguous" help="tolerate low q-score ambiguous nucleotides" /> <param name="replace" argument="-P" type="text" label="Replace" help="rather than splitting or truncating, replace low quality bases with CHAR this option OVERRIDES all -m mode options" /> <param name="remove" argument="-R" type="text" label="Remove" help="rather than splitting or truncating, remove reads which contain more than COUNT low quality bases this option only works in COMBINATION with the -P (punch) option" /> <param name="prefix" argument="-T" type="text" label="Prefix" help="if supplied, only reads with this PREFIX are retained, and the PREFIX is stripped from each contributing read" /> <param name="mismatch" argument="-t" type="integer" value="0" label="Mismatch" help="if PREFIX is supplied, prefix matching tolerates at most MISMATCH mismatches" /> <param name="output_format" argument="-f" type="select" label="Format" help="output in FASTA or FASTQ format (default=FASTA)" > <option value="FASTA">FASTA</option> <option value="FASTQ">FASTQ</option> </param> </when> </conditional> </inputs> <outputs> <data format="fasta" name="filtered_output"> <change_format> <when input="output_format" value="FASTQ" format="fastq" /> </change_format> </data> </outputs> <tests> <test> <param name="fastq" value="qfilt-in1.fastq" /> <output file="qfilt-out1.fa" ftype="fasta" name="filtered_output" /> </test> <test> <param name="format" value="fastq" /> <param name="fastq" value="qfilt-in1.fastq" /> <param name="advanced" value="advanced" /> <param name="tolerate_homopolymeric" value="False" /> <output file="qfilt-out2.fa" ftype="fasta" name="filtered_output" /> </test> <test> <param name="fasta" value="qfilt-in2.fa" /> <param name="qual" value="qfilt-in2.qual" /> <param name="format" value="fastaq" /> <output file="qfilt-out3.fa" ftype="fasta" name="filtered_output" /> </test> </tests> <help><![CDATA[ qfilt ===== This simple program is meant to filter sequencing data with the option to: - Remove or split reads with poor quality scores - Retain only fragments from reads that are tagged with a given 5' sequence. ^^^^^^^^ Example Output >GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58 CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG >GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87 CTGATGCTGCACCAACTGTACTCCCTCGCGATA >GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66 TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA >GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84 ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA >GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91 CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA ]]></help> <citations> <citation type="bibtex"> @UNPUBLISHED{spond, author = "Sergei Kosakovsky Pond", title = "HyPhy: Hypothesis Testing using Phylogenies", year = "2000", note = "http://hyphy.org/", url = "http://hyphy.org/"} </citation> </citations> </tool>
