# HG changeset patch # User iuc # Date 1565848453 14400 # Node ID d82339e37e8e73dcb846fc1088fb67498a6a63f4 # Parent 0a563fd2f22e2bea8b96a79c80ea43afd815b8c5 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit 686574b0392e554b75035a9b79bc919dfda9ab97" diff -r 0a563fd2f22e -r d82339e37e8e README.rst --- a/README.rst Thu Mar 14 16:12:38 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,9 +0,0 @@ - -System Requirements -=================== - -- **Memory**: To run efficiently, RNA-STAR requires enough free memory to - hold the SA-indexed reference genome in RAM. For Human Genome hg19 this - index is about 27GB and running RNA-STAR requires approximately ~30GB of RAM. - For custom genomes, the rule of thumb is to multiply the size of the - reference FASTA file by 9 to estimate the required amount of RAM. diff -r 0a563fd2f22e -r d82339e37e8e macros.xml --- a/macros.xml Thu Mar 14 16:12:38 2019 -0400 +++ b/macros.xml Thu Aug 15 01:54:13 2019 -0400 @@ -1,10 +1,39 @@ + + + 2.7.2a + + 2.7.1a + - star - samtools + star + samtools + + + + + + + + + + + + --readFilesCommand zcat @@ -13,8 +42,8 @@ 10.1093/bioinformatics/bts635 - - + + @@ -22,7 +51,7 @@ - @@ -36,4 +65,99 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + diff -r 0a563fd2f22e -r d82339e37e8e rg_rnaStar.xml --- a/rg_rnaStar.xml Thu Mar 14 16:12:38 2019 -0400 +++ b/rg_rnaStar.xml Thu Aug 15 01:54:13 2019 -0400 @@ -1,16 +1,10 @@ - + Gapped-read mapper for RNA-seq data macros.xml - - - - - - - + 0: + --outBAMsortingThreadN \${GALAXY_SLOTS:-4} + --outBAMsortingBinsN $perf.outBAMsortingBinsN + --limitBAMsortRAM \$((\${GALAXY_MEMORY_MB:-0}*1000000)) + + ## Handle chimeric options and output + #if str($chimOutType): + --chimOutType $chimOutType + #if 'Junctions' in str($chimOutType): + --chimOutJunctionFormat 1 + #end if + #end if && - samtools sort -@ \${GALAXY_SLOTS:-4} -o ChimericSorted.bam -O BAM Chimeric.out.sam - #end if + ## recompress BAM output for smaller file size + samtools view -b -o '$mapped_reads' Aligned.sortedByCoord.out.bam + #if 'TranscriptomeSAM' in str($quantmode_output.quantMode): + ## same recompression for optional transcriptome BM + && + samtools view -b -o '$transcriptome_mapped_reads' Aligned.toTranscriptome.out.bam + #end if ]]> @@ -216,187 +246,229 @@ - - - - + + + + + + + + - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + - - - + + + + + + + + + + + + + + + - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +
+ + + + + + + + + + + + + + + + + + - - - - - + Thus, this parameter has been removed from the tool interface: + --> + + +
+
+ + + + + - - + + + + + + + + + + + + + + + + + + + + + + + + + +
- -
- - - - - - - -
- -
- - - - - - - - - - - -
+ +
+ + + + + + + + + -
- - -
- -
- - - - -
+ +
+ + + + + + + +
- - - - - - - - - - - - - - - - - - - - - - +
+ + + + + + + + + + + + + +
+
+ + + + + + + + + + + +
+
+ + + +
+ + +
+
+ +
+ - params['settingsType'] == "star_fusion" or ( params['settingsType'] == "full" and params['chim']['chim_select'] == "yes" and params['chim']['chimSegmentMin'] > 0 ) - - - - - params['settingsType'] == "full" and params['chim']['chim_select'] == "yes" and params['chim']['chimSegmentMin'] > 0 + ('Junctions' in chimOutType) @@ -404,188 +476,420 @@ - + + + + + + 'TranscriptomeSAM' in quantmode_output['quantMode'] - quantMode is True + 'GeneCounts' in quantmode_output['quantMode'] - - - - - - - - - - - - + + + + + + + + + + +
+ + +
+
+ + + +
+ - - - - + + + + + + + + + + + + + +
+ + +
+
+ + + +
+ + + + + + + + + + + + + + + + + + + + + + + +
+ + +
+
+ + + +
- - - - - - - - - - - + - - - - - + + + + + + + + + + + + + + + + + + + +
+ + +
+
+ + + +
- - - - + + + + + + + + + + + + + + + +
+ + +
+
+ + + + + +
+
+ + +
+ + +
+ +
- - - - - - - + - - - - - - - - - - - - - - - - - - + + + + + + + + + + + +
+ + +
+
+ + + +
- - - - + + + + + + + + + + + + + +
+ + +
+
+ + + +
- + - - - - - + + + + + + + + + + +
+ + +
+
+ + + + +
+
+ + + +
- - - - - - - - - - + - - - - - + + + + + + + + + + + + + + + +
+ + +
+
+ + + + +
+
+ + + +
- - - - + + + + + + + + + + + + + + + + + + + + +
+ + +
+
+ + + + +
+
+ + + +
- - - - - + + + + + + + + + + + + + + + + + + + +
+ + +
+
+ + + + +
+
+ + + +
- + - + - + Exclude the following records from the BAM output* + +----- -.. _licensed: http://creativecommons.org/licenses/by-nc-nd/3.0/ +Attribution + +Minor tweaks to output names to suit downstream purposes, toolshed automated +dependencies and odds and ends of other code and documentation comprising +this tool were originally written by Ross Lazarus and have been licensed under +the creative commons +`BY-NC_ND 3.0 license `__. + +.. _STAR: https://github.com/alexdobin/STAR .. _STAR-Fusion: https://github.com/STAR-Fusion/STAR-Fusion -.. _recommended: https://github.com/STAR-Fusion/STAR-Fusion/wiki#alternatively-running-star-yourself-and-then-running-star-fusion-using-the-existing-outputs -.. _rna_star: https://github.com/alexdobin/STAR -.. _rna_starMS: http://bioinformatics.oxfordjournals.org/content/29/1/15.full -.. _Galaxy: http://getgalaxy.org - +.. _recommended: https://github.com/STAR-Fusion/STAR-Fusion/wiki#alternatively-kickstart-mode-running-star-yourself-and-then-running-star-fusion-using-the-existing-outputs + ]]> diff -r 0a563fd2f22e -r d82339e37e8e test-data/41737_R1.fastq.sub240k.gz Binary file test-data/41737_R1.fastq.sub240k.gz has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/41737_R2.fastq.sub240k.gz Binary file test-data/41737_R2.fastq.sub240k.gz has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/737K-august-2016.small.txt.gz Binary file test-data/737K-august-2016.small.txt.gz has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/SNORD83B.22.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/SNORD83B.22.fa Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,17 @@ +>22 dna:chromosome chromosome:GRCh38:22:39313740:50818468:1 REF +CACACTCAAAGCAGCAAACAGCCCAGCAAGGCCAGACTGGGAATTTCCTCATCTCAGGAC +TTCAAAGCCAGTGTGAAAGGACTGCCAACACCCTCTCCTTCCTTTCCTCTCCCACCACAG +GGCCACCAGCGTCTGTGGCCTTGGATCCTCCCTCTACAAGAGCCCCCCCATGACAAGTCA +GGACCTGCCTCACCTTGCGGAGGGTGAGCACCCGCTTCTTGGTTCCCACCACACAGCCTT +TCAGCATGACAAAGTCATTGGTCACTTCACCATAGTGGACAAAGCCACCCTGGAAAACGA +GCATCGGATCAGCACAGGCCCAGGAGGGGATTGTCGTGCAGATGACCCCTCCAGGTTCAG +GCCCTCCCTGACCACAGGGCTGTTCTCAGAAGGAAGGCAACAAGGAACGGTTCCGCAGTC +TGTCTCGGGCGCTGTGCCCAGCGCACATTCCAGGCCTCATCACTGAACAGCTGAGCCTGA +GACCCCACTTCTCACCAGCCAACCCCGACGAGTGGACTCAGATGACAACATGCCACTTAC +AAGGGACACAGCTAGGTGTTGTGTTGGCTTCAGTTAACGATCCTGCTAGCAGCCCCTAGG +AAGCAGCCTATCCCCAAAAGCACGAGGCCTGGGATGGCCTCACAGAGCAGAACACCCATT +ACTTACCAGAGGGTTGATGCTCTTGTCAGATAGGTCATAGTCAGTGGAGGCATTGTTCTT +GATCAGCTTGCCGTCCTTGATAAGGTAGCCCTGGCCAATCTTATAAATCTGAATGAACAA +GAAGGGTGTAAGGCTGGGGCATTAGGGACAAATAACCCAGACATGCCAGTGTGCTGACCT +GCAAAGCACGCTAGAAGGCAGCTGAGGCCTCAGTCCCAGTCACAGCGTATCCCAAGGTCA +GAGCAAAAAGCTGGCTGGCCCTCCAGGTTCCTTTCTGTAAGGCGGCTGGGCTAAAACTAA \ No newline at end of file diff -r 0a563fd2f22e -r d82339e37e8e test-data/SNORD83B.22.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/SNORD83B.22.gtf Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,8 @@ +#!genome-build GRCh38.p12 +#!genome-version GRCh38 +#!genome-date 2013-12 +#!genome-build-accession NCBI:GCA_000001405.27 +#!genebuild-last-updated 2018-11 +22 ensembl gene 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; +22 ensembl transcript 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; tag "basic"; transcript_support_level "NA"; +22 ensembl exon 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; exon_number "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; exon_id "ENSE00001501751"; exon_version "1"; tag "basic"; transcript_support_level "NA"; diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_index2_versioned.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnastar_index2_versioned.loc Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,4 @@ +##STAR versioned indexes +#build_id dbkey display_name path with_gene_model version +000 ? test_index ${__HERE__}/test-cache/tophat-test 0 2.7.1a +001 ? test_index2 ${__HERE__}/test-cache/tophat-test 1 2.7.1a diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test.log --- a/test-data/rnastar_test.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test.log Thu Aug 15 01:54:13 2019 -0400 @@ -1,7 +1,7 @@ - Started job on | Mar 01 15:54:22 - Started mapping on | Mar 01 15:54:25 - Finished on | Mar 01 15:54:25 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test2.log --- a/test-data/rnastar_test2.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test2.log Thu Aug 15 01:54:13 2019 -0400 @@ -1,7 +1,7 @@ - Started job on | Mar 01 15:53:05 - Started mapping on | Mar 01 15:53:08 - Finished on | Mar 01 15:53:08 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test2_mapped_reads.bam Binary file test-data/rnastar_test2_mapped_reads.bam has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_mapped_reads.bam Binary file test-data/rnastar_test_mapped_reads.bam has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_mapped_reads_twopass.bam Binary file test-data/rnastar_test_mapped_reads_twopass.bam has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_transcriptome_mapped_reads.bam Binary file test-data/rnastar_test_transcriptome_mapped_reads.bam has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_twopass.log --- a/test-data/rnastar_test_twopass.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test_twopass.log Thu Aug 15 01:54:13 2019 -0400 @@ -1,7 +1,7 @@ - Started job on | Feb 12 11:19:46 - Started mapping on | Feb 12 11:20:03 - Finished on | Feb 12 11:20:03 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/Genome Binary file test-data/test-cache/tophat-test/Genome has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/SA Binary file test-data/test-cache/tophat-test/SA has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/SAindex Binary file test-data/test-cache/tophat-test/SAindex has changed diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrLength.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrLength.txt Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,1 @@ +650 diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrName.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrName.txt Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,1 @@ +test_chromosome diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrNameLength.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrNameLength.txt Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,1 @@ +test_chromosome 650 diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrStart.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrStart.txt Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,2 @@ +0 +262144 diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/genomeParameters.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/genomeParameters.txt Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,16 @@ +### STAR --runMode genomeGenerate --genomeDir test-cache/tophat_test/ --genomeFastaFiles tophat_test.fa --genomeSAindexNbases 5 +### GstrandBit 32 +versionGenome 2.7.1a +genomeFastaFiles tophat_test.fa +genomeSAindexNbases 5 +genomeChrBinNbits 18 +genomeSAsparseD 1 +sjdbOverhang 0 +sjdbFileChrStartEnd - +sjdbGTFfile - +sjdbGTFchrPrefix - +sjdbGTFfeatureExon exon +sjdbGTFtagExonParentTranscript transcript_id +sjdbGTFtagExonParentGene gene_id +sjdbInsertSave Basic +genomeFileSizes 262144 5366 diff -r 0a563fd2f22e -r d82339e37e8e test-data/test3.chimjunc.tabular --- a/test-data/test3.chimjunc.tabular Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/test3.chimjunc.tabular Thu Aug 15 01:54:13 2019 -0400 @@ -1,24 +1,27 @@ -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_60 181 60M15S 241 60S15M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_62 183 58M17S 241 58S17M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_64 185 56M19S 241 56S19M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_66 187 54M21S 241 54S21M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_68 189 52M23S 241 52S23M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_70 191 50M25S 241 50S25M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_72 193 48M27S 241 48S27M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_74 195 46M29S 241 46S29M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_76 197 44M31S 241 44S31M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_78 199 42M33S 241 42S33M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_80 201 40M35S 241 40S35M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_82 203 38M37S 241 38S37M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_84 205 36M39S 241 36S39M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_86 207 34M41S 241 34S41M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_88 209 32M43S 241 32S43M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_90 211 30M45S 241 30S45M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_92 213 28M47S 241 28S47M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_94 215 26M49S 241 26S49M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_96 217 24M51S 241 24S51M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_98 219 22M53S 241 22S53M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_100 221 20M55S 241 20S55M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_102 223 18M57S 241 18S57M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_104 225 16M59S 241 16S59M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_106 227 14M61S 241 14S61M +chr_donorA brkpt_donorA strand_donorA chr_acceptorB brkpt_acceptorB strand_acceptorB junction_type repeat_left_lenA repeat_right_lenB read_name start_alnA cigar_alnA start_alnB cigar_alnB num_chim_aln max_poss_aln_score non_chim_aln_score this_chim_aln_score bestall_chim_aln_score PEmerged_bool readgrp +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_60 181 60M15S 241 60S15M 1 75 59 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_62 183 58M17S 241 58S17M 1 75 57 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_64 185 56M19S 241 56S19M 1 75 55 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_66 187 54M21S 241 54S21M 1 75 53 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_68 189 52M23S 241 52S23M 1 75 51 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_70 191 50M25S 241 50S25M 1 75 49 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_72 193 48M27S 241 48S27M 1 75 47 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_74 195 46M29S 241 46S29M 1 75 45 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_76 197 44M31S 241 44S31M 1 75 43 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_78 199 42M33S 241 42S33M 1 75 41 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_80 201 40M35S 241 40S35M 1 75 39 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_82 203 38M37S 241 38S37M 1 75 37 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_84 205 36M39S 241 36S39M 1 75 38 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_86 207 34M41S 241 34S41M 1 75 40 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_88 209 32M43S 241 32S43M 1 75 42 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_90 211 30M45S 241 30S45M 1 75 44 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_92 213 28M47S 241 28S47M 1 75 46 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_94 215 26M49S 241 26S49M 1 75 48 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_96 217 24M51S 241 24S51M 1 75 50 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_98 219 22M53S 241 22S53M 1 75 52 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_100 221 20M55S 241 20S55M 1 75 54 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_102 223 18M57S 241 18S57M 1 75 56 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_104 225 16M59S 241 16S59M 1 75 58 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_106 227 14M61S 241 14S61M 1 75 60 72 72 0 +# 2.7.2a STAR --runThreadN 1 --genomeLoad NoSharedMemory --genomeDir tempstargenomedir @ --readFilesIn /tmp/tmpTNNe38/files/2/7/0/dataset_2700161e-e03d-4a50-9bc8-1508ff059881.dat --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --twopassMode None --quantMode - --outSAMstrandField intronMotif --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM NM MD jM jI MC ch --outSAMprimaryFlag OneBestScore --outSAMmapqUnique 255 --outSAMunmapped Within --chimSegmentMin 12 --chimJunctionOverhangMin 12 --alignSJDBoverhangMin 10 --alignMatesGapMax 100000 --alignIntronMax 100000 --chimSegmentReadGapMax 3 --alignSJstitchMismatchNmax 5 -1 5 5 --peOverlapNbasesMin 12 --peOverlapMMp 0.1 --chimMultimapScoreRange 10 --chimMultimapNmax 10 --chimNonchimScoreDropMin 10 --outBAMsortingThreadN 1 --outBAMsortingBinsN 50 --limitBAMsortRAM 0 --chimOutType Junctions --chimOutJunctionFormat 1 +# Nreads 83 NreadsUnique 72 NreadsMulti 0 diff -r 0a563fd2f22e -r d82339e37e8e tool-data/rnastar_index2.loc.sample --- a/tool-data/rnastar_index2.loc.sample Thu Mar 14 16:12:38 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,23 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of rna-star indexed sequences data files. You will -#need to create these data files and then create a rnastar_index2.loc -#file similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The rnastar_index2.loc -#file has this format (longer white space characters are TAB characters): -# -# -# -#The column should be 1 or 0, indicating whether the index was made -#with an annotation (i.e., --sjdbGTFfile and --sjdbOverhang were used) or not, -#respecively. -# -#Note that STAR indices can become quite large. Consequently, it is only -#advisable to create indices with annotations if it's known ahead of time that -#(A) the annotations won't be frequently updated and (B) the read lengths used -#will also rarely vary. If either of these is not the case, it's advisable to -#create indices without annotations and then specify an annotation file and -#maximum read length (minus 1) when running STAR. -# -#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 -#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 - diff -r 0a563fd2f22e -r d82339e37e8e tool-data/rnastar_index2_versioned.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/rnastar_index2_versioned.loc.sample Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of rna-star indexed sequences data files. You will +#need to create these data files and then create a rnastar_index2.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The rnastar_index2.loc +#file has this format (longer white space characters are TAB characters): +# +# +# +#The column should be 1 or 0, indicating whether the index +#was built with annotations (i.e., --sjdbGTFfile and --sjdbOverhang were used) +#or not. +# +#The column indicates the STAR version that introduced the format of +#the index, i.e., the oldest STAR version that could make use of the index. +# +#Note that STAR indices can become quite large. Consequently, it is only +#advisable to create indices with annotations if it's known ahead of time that +#(A) the annotations won't be frequently updated and (B) the read lengths used +#will also rarely vary. If either of these is not the case, it's advisable to +#create indices without annotations and then specify an annotation file and +#maximum read length (minus 1) when running STAR. +# +#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 2.7.1a +#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 2.7.1a + diff -r 0a563fd2f22e -r d82339e37e8e tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Thu Mar 14 16:12:38 2019 -0400 +++ b/tool_data_table_conf.xml.sample Thu Aug 15 01:54:13 2019 -0400 @@ -1,7 +1,6 @@ - - - value, dbkey, name, path, with-gtf - +
+ value, dbkey, name, path, with-gtf, version +
diff -r 0a563fd2f22e -r d82339e37e8e tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Thu Aug 15 01:54:13 2019 -0400 @@ -0,0 +1,7 @@ + + + + value, dbkey, name, path, with-gtf, version + +
+