Mercurial > repos > iuc > rgrnastar
changeset 23:a2b0feda6933 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit ae6b59a8e52fd34e2347d1fd8d34129c36779266
author | iuc |
---|---|
date | Fri, 17 Feb 2023 20:03:27 +0000 (2023-02-17) |
parents | 980d2a2e1180 |
children | 4df95e2d7f61 |
files | macros.xml rg_rnaStar.xml test-data/Signal.Unique.str1.out.bg test-data/Signal.Unique.str2.out.bg test-data/Signal.UniqueMultiple.str1.out.bg test-data/Signal.UniqueMultiple.str2.out.bg test-data/filtered3.bam test-data/rnastar_test_mapped_reads_PE.bam test-data/rnastar_test_splicejunctions_PE.bed test-data/tophat_Signal.Unique.both.read2.out.wig test-data/tophat_rev_Signal.Unique.str1.out.bg test-data/tophat_rev_Signal.Unique.str2.out.bg test-data/tophat_revlib_R1.fastqsanger test-data/tophat_revlib_R2.fastqsanger test-data/tophat_test.fa.gz test-data/tophat_test_reads_per_gene_PE.txt test-data/tophat_test_reads_per_gene_PE_rev.txt |
diffstat | 16 files changed, 6652 insertions(+), 99 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Tue Nov 01 16:56:55 2022 +0000 +++ b/macros.xml Fri Feb 17 20:03:27 2023 +0000 @@ -1,11 +1,12 @@ <macros> - <!-- REMEMBER to bump the version of rna_star_index_builder_data_manager - whenever you make changes to the following two version tokens! + <!-- REMEMBER to bump the version of @IDX_VERSION_SUFFIX@ + whenever you make changes to the @TOOL_VERSION@ token! The data manager uses a symlink to this macro file to keep the STAR and - the index versions in sync, but you should manually adjust the +galaxy - version number. --> + the index versions in sync, but you should manually update @IDX_VERSION_SUFFIX@ --> <!-- STAR version to be used --> - <token name="@VERSION@">2.7.8a</token> + <token name="@TOOL_VERSION@">2.7.10b</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">21.01</token> <!-- STAR index version compatible with this version of STAR This is the STAR version that introduced the index structure expected by the current version. @@ -14,12 +15,14 @@ or by looking for the versionGenome parameter in source/parametersDefault of STAR's source code --> <token name="@IDX_VERSION@">2.7.4a</token> + <token name="@IDX_VERSION_SUFFIX@">1</token> <token name="@IDX_DATA_TABLE@">rnastar_index2x_versioned</token> <xml name="requirements"> <requirements> - <requirement type="package" version="@VERSION@">star</requirement> - <requirement type="package" version="1.9">samtools</requirement> + <requirement type="package" version="@TOOL_VERSION@">star</requirement> + <requirement type="package" version="1.16.1">samtools</requirement> + <requirement type="package" version="1.12">gzip</requirement> <yield /> </requirements> </xml> @@ -35,7 +38,7 @@ </xml> <xml name="index_selection" token_with_gene_model="0"> - <param argument="--genomeDir" name="genomeDir" type="select" + <param argument="--genomeDir" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> <options from_data_table="@IDX_DATA_TABLE@"> @@ -55,8 +58,8 @@ <citation type="doi">10.1093/bioinformatics/bts635</citation> </citations> </xml> - <xml name="@SJDBOPTIONS@" token_optional="true"> - <param argument="--sjdbGTFfile" type="data" format="gff3,gtf" label="Gene model (gff3,gtf) file for splice junctions" optional="@OPTIONAL@" help="Exon junction information for mapping splices"/> + <xml name="SJDBOPTIONS"> + <param argument="--sjdbGTFfile" type="data" format="gff3,gtf" label="Gene model (gff3,gtf) file for splice junctions" optional="false" help="Exon junction information for mapping splices"/> <param argument="--sjdbOverhang" type="integer" min="1" value="100" label="Length of the genomic sequence around annotated junctions" help="Used in constructing the splice junctions database. Ideal value is ReadLength-1"/> </xml> <xml name="dbKeyActions"> @@ -81,11 +84,16 @@ <token name="@TEMPINDEX@"><![CDATA[ ## Create temporary index for custom reference #if str($refGenomeSource.geneSource) == 'history': + #if $refGenomeSource.genomeFastaFiles.ext == "fasta" + ln -s '$refGenomeSource.genomeFastaFiles' refgenome.fa && + #else + gunzip -c '$refGenomeSource.genomeFastaFiles' > refgenome.fa && + #end if mkdir -p tempstargenomedir && STAR --runMode genomeGenerate --genomeDir 'tempstargenomedir' - --genomeFastaFiles '${refGenomeSource.genomeFastaFiles}' + --genomeFastaFiles refgenome.fa ## Handle difference between indices with/without annotations #if 'GTFconditional' in $refGenomeSource: ## GTFconditional exists only in STAR, but not STARsolo @@ -109,6 +117,8 @@ --genomeSAindexNbases ${refGenomeSource.genomeSAindexNbases} #end if --runThreadN \${GALAXY_SLOTS:-4} + ## in bytes + --limitGenomeGenerateRAM \$((\${GALAXY_MEMORY_MB:-31000} * 1000000)) && #end if ]]></token> @@ -121,17 +131,15 @@ #else: '${refGenomeSource.GTFconditional.genomeDir.fields.path}' ## Handle difference between indices with/without annotations - #if str($refGenomeSource.GTFconditional.GTFselect) == 'without-gtf': - #if $refGenomeSource.GTFconditional.sjdbGTFfile: - --sjdbOverhang $refGenomeSource.GTFconditional.sjdbOverhang - --sjdbGTFfile '${refGenomeSource.GTFconditional.sjdbGTFfile}' - #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == 'gff3': - --sjdbGTFtagExonParentTranscript Parent - #end if + #if str($refGenomeSource.GTFconditional.GTFselect) == 'without-gtf-with-gtf': + --sjdbOverhang $refGenomeSource.GTFconditional.sjdbOverhang + --sjdbGTFfile '${refGenomeSource.GTFconditional.sjdbGTFfile}' + #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == 'gff3': + --sjdbGTFtagExonParentTranscript Parent #end if #end if - #end if - ]]></token> + #end if + ]]></token> <token name="@READSHANDLING@" ><![CDATA[ ## Check that the input pairs are of the same type ## otherwise STARsolo will run for a long time and then error out. @@ -161,8 +169,13 @@ @FASTQ_GZ_OPTION@ #end if ]]></token> + <token name="@LIMITS@" ><![CDATA[ + --limitOutSJoneRead $getVar('algo.params.junction_limits.limitOutSJoneRead', $getVar('solo.junction_limits.limitOutSJoneRead', 1000)) + --limitOutSJcollapsed $getVar('algo.params.junction_limits.limitOutSJcollapsed', $getVar('solo.junction_limits.limitOutSJcollapsed', 1000000)) + --limitSjdbInsertNsj $getVar('algo.params.junction_limits.limitSjdbInsertNsj', $getVar('solo.junction_limits.limitSjdbInsertNsj', 1000000)) + ]]></token> <xml name="ref_selection"> - <param argument="--genomeFastaFiles" type="data" format="fasta" label="Select a reference genome" /> + <param argument="--genomeFastaFiles" type="data" format="fasta,fasta.gz" label="Select a reference genome" /> <param argument="--genomeSAindexNbases" type="integer" min="2" max="16" value="14" label="Length of the SA pre-indexing string" help="Typically between 10 and 15. Longer strings will use much more memory, but allow faster searches. For small genomes, the parameter --genomeSAindexNbases must be scaled down to min(14, log2(GenomeLength)/2 - 1)"/> </xml> <xml name="stdio" > @@ -245,4 +258,143 @@ <option value="None" >No adapter clipping</option> </param> </xml> + <xml name="common_SAM_attributes"> + <option value="NH" selected="true">NH (number of reported alignments/hits for the read)</option> + <option value="HI" selected="true">HI (query hit index)</option> + <option value="AS" selected="true">AS (local alignment score)</option> + <option value="nM" selected="true">nM (number of mismatches per (paired) alignment)</option> + <option value="NM">NM (edit distance of the aligned read to the reference)</option> + <option value="MD">MD (string for mismatching positions)</option> + <option value="jM">jM (intron motifs for all junctions)</option> + <option value="jI">jI (1-based start and end of introns for all junctions)</option> + </xml> + <xml name="limits"> + <section name="junction_limits" title="Junction Limits" expanded="false"> + <param argument="--limitOutSJoneRead" type="integer" min="1" value="1000" label="Maximum number of junctions for one read (including all multimappers)" /> + <param argument="--limitOutSJcollapsed" type="integer" min="1" value="1000000" label="Maximum number of collapsed junctions" /> + <param argument="--limitSjdbInsertNsj" type="integer" min="0" value="1000000" label="Maximum number of inserts to be inserted into the genome on the fly." /> + </section> + </xml> + <xml name="outCountActions"> + <actions> + <action name="column_names" type="metadata" default="GeneID,Counts_unstrand,Counts_firstStrand,Counts_secondStrand" /> + </actions> + </xml> + <xml name="outWig"> + <conditional name="outWig"> + <param name="outWigType" type="select" label="Compute coverage"> + <option value="None">No coverage</option> + <option value="bedGraph">Yes in bedgraph format</option> + <option value="wiggle">Yes in wiggle format</option> + </param> + <when value="None"> + <!-- This is necessary for the filtering of output --> + <param name="outWigStrand" type="hidden" value="false" /> + </when> + <when value="bedGraph"> + <expand macro="outWigParams"/> + </when> + <when value="wiggle"> + <expand macro="outWigParams"/> + </when> + </conditional> + </xml> + <xml name="outWigParams"> + <param name="outWigTypeSecondWord" type="select" label="Input for coverage"> + <option value="">Default (everything that mapped)</option> + <option value="read_5p">signal from only 5’ of the 1st read</option> + <option value="read2">signal from only 2nd read</option> + </param> + <param argument="--outWigStrand" type="boolean" truevalue="Stranded" falsevalue="Unstranded" checked="true" label="collapse strands (unstranded coverage)" help="By default, the strands are separated."/> + <param argument="--outWigReferencesPrefix" type="text" value="-" label="prefix matching reference name" help="For example, set 'chr' if you mapped on an ensembl genome but you want to display on UCSC"/> + <param argument="--outWigNorm" type="boolean" truevalue="RPM" falsevalue="None" checked="true" label="Normalize coverage to million of mapped reads (RPM)"/> + </xml> + <token name="@OUTWIG@"><![CDATA[ + #if str($outWig.outWigType) != 'None': + --outWigType '$outWig.outWigType' '$outWig.outWigTypeSecondWord' + --outWigStrand '$outWig.outWigStrand' + --outWigReferencesPrefix '$outWig.outWigReferencesPrefix' + --outWigNorm '$outWig.outWigNorm' + #end if + ]]></token> + <token name="@OUTWIGOUTPUTS@"><![CDATA[ + #if str($outWig.outWigType) == "bedGraph": + && mv Signal.Unique.str1.out.bg Signal.Unique.str1.out + && mv Signal.UniqueMultiple.str1.out.bg Signal.UniqueMultiple.str1.out + #if str($outWig.outWigStrand) == "Stranded": + && mv Signal.Unique.str2.out.bg Signal.Unique.str2.out + && mv Signal.UniqueMultiple.str2.out.bg Signal.UniqueMultiple.str2.out + #end if + #elif str($outWig.outWigType) == "wiggle": + && mv Signal.Unique.str1.out.wig Signal.Unique.str1.out + && mv Signal.UniqueMultiple.str1.out.wig Signal.UniqueMultiple.str1.out + #if str($outWig.outWigStrand) == "Stranded": + && mv Signal.Unique.str2.out.wig Signal.Unique.str2.out + && mv Signal.UniqueMultiple.str2.out.wig Signal.UniqueMultiple.str2.out + #end if + #end if + ]]></token> + <xml name="outWigOutputs"> + <data format="bedgraph" name="signal_unique_str1" label="${tool.name} on ${on_string}: Coverage Uniquely mapped strand 1" from_work_dir="Signal.Unique.str1.out"> + <filter>outWig['outWigType'] != "None"</filter> + <expand macro="dbKeyActions" /> + <change_format> + <when input="outWig.outWigType" value="wiggle" format="wig" /> + </change_format> + </data> + <data format="bedgraph" name="signal_uniquemultiple_str1" label="${tool.name} on ${on_string}: Coverage Uniquely + Multiple mapped strand 1" from_work_dir="Signal.UniqueMultiple.str1.out"> + <filter>outWig['outWigType'] != "None"</filter> + <expand macro="dbKeyActions" /> + <change_format> + <when input="outWig.outWigType" value="wiggle" format="wig" /> + </change_format> + </data> + <data format="bedgraph" name="signal_unique_str2" label="${tool.name} on ${on_string}: Coverage Uniquely mapped strand 2" from_work_dir="Signal.Unique.str2.out"> + <filter>outWig['outWigType'] != "None" and outWig['outWigStrand']</filter> + <expand macro="dbKeyActions" /> + <change_format> + <when input="outWig.outWigType" value="wiggle" format="wig" /> + </change_format> + </data> + <data format="bedgraph" name="signal_uniquemultiple_str2" label="${tool.name} on ${on_string}: Coverage Uniquely + Multiple mapped strand 2" from_work_dir="Signal.UniqueMultiple.str2.out"> + <filter>outWig['outWigType'] != "None" and outWig['outWigStrand']</filter> + <expand macro="dbKeyActions" /> + <change_format> + <when input="outWig.outWigType" value="wiggle" format="wig" /> + </change_format> + </data> + </xml> + <xml name="quantMode"> + <conditional name="quantmode_output"> + <param argument="--quantMode" type="select" + label="Per gene/transcript output" + help="STAR can provide analysis results not only with respect to the reference genome, but also with respect to genes and transcripts described by a gene model. Note: This functionality requires either the selection above of a cached index with a gene model, or a gene model provided alongside the index/reference genome in GTF or GFF3 format!"> + <option value="-">No per gene or transcript output</option> + <option value="GeneCounts">Per gene read counts (GeneCounts)</option> + <option value="TranscriptomeSAM">Transcript-based BAM output (TranscriptomeSAM)</option> + <option value="TranscriptomeSAM GeneCounts">Both per gene read counts and transcript-based BAM output (TranscriptomeSAM GeneCounts)</option> + </param> + <when value="-" /> + <when value="GeneCounts" /> + <when value="TranscriptomeSAM"> + <param argument="--quantTranscriptomeBan" type="boolean" truevalue="IndelSoftclipSingleend" falsevalue="Singleend" + label="Exclude alignments with indels or soft clipping from the transcriptome BAM output?" + help="You will need to exclude alignments with indels and soft-clipped bases from the transcriptome BAM output for compatibility with certain transcript quantification tools, most notably RSEM. If you are using a tool, like eXpress, that can deal with indels and soft-clipped bases, you can achieve better results by leaving this option disabled." /> + </when> + <when value="TranscriptomeSAM GeneCounts"> + <param argument="--quantTranscriptomeBan" type="boolean" truevalue="IndelSoftclipSingleend" falsevalue="Singleend" + label="Exclude alignments with indels or soft clipping from the transcriptome BAM output?" + help="You will need to exclude alignments with indels and soft-clipped bases from the transcriptome BAM output for compatibility with certain transcript quantification tools, most notably RSEM. If you are using a tool, like eXpress, that can deal with indels and soft-clipped bases, you can achieve better results by leaving this option disabled." /> + </when> + </conditional> + </xml> + <xml name="quantModeNoGTF"> + <conditional name="quantmode_output"> + <param argument="--quantMode" type="select" + label="Per gene/transcript output"> + <option value="-">No per gene or transcript output as no GTF was provided</option> + </param> + <when value="-" /> + </conditional> + </xml> </macros>
--- a/rg_rnaStar.xml Tue Nov 01 16:56:55 2022 +0000 +++ b/rg_rnaStar.xml Fri Feb 17 20:03:27 2023 +0000 @@ -1,4 +1,4 @@ -<tool id="rna_star" name="RNA STAR" version="@VERSION@+galaxy1" profile="20.01" license="MIT"> +<tool id="rna_star" name="RNA STAR" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@" license="MIT"> <description>Gapped-read mapper for RNA-seq data</description> <macros> <import>macros.xml</import> @@ -65,9 +65,9 @@ #end if #end if - --quantMode ${quantmode_output.quantMode} - #if 'TranscriptomeSAM' in str($quantmode_output.quantMode): - --quantTranscriptomeBan ${quantmode_output.quantTranscriptomeBan} + --quantMode ${refGenomeSource.GTFconditional.quantmode_output.quantMode} + #if 'TranscriptomeSAM' in str($refGenomeSource.GTFconditional.quantmode_output.quantMode): + --quantTranscriptomeBan ${refGenomeSource.GTFconditional.quantmode_output.quantTranscriptomeBan} #end if ## Output format parameters @@ -206,9 +206,7 @@ #end if ## Limits - --limitOutSJoneRead $algo.params.limits.limitOutSJoneRead - --limitOutSJcollapsed $algo.params.limits.limitOutSJcollapsed - --limitSjdbInsertNsj $algo.params.limits.limitSjdbInsertNsj + @LIMITS@ #else: ## Go with STAR's default algorithmic settings, ## but we need to provide a reasonable default @@ -238,14 +236,19 @@ --chimOutJunctionFormat 1 #end if #end if + + ##outWig: + @OUTWIG@ && ## recompress BAM output for smaller file size samtools view -b -o '$mapped_reads' Aligned.sortedByCoord.out.bam - #if 'TranscriptomeSAM' in str($quantmode_output.quantMode): + #if 'TranscriptomeSAM' in str($refGenomeSource.GTFconditional.quantmode_output.quantMode): ## same recompression for optional transcriptome BM && samtools view -b -o '$transcriptome_mapped_reads' Aligned.toTranscriptome.out.bam #end if + ##outWig: + @OUTWIGOUTPUTS@ ]]></command> <inputs> @@ -279,15 +282,22 @@ <param name="GTFselect" type="select" label="Reference genome with or without an annotation" help="Select the '... with builtin gene-model' option to select from the list of available indexes that were built with splice junction information. Select the '... without builtin gene-model' option to select from the list of available indexes without annotated splice junctions, and, optionally, provide your own splice-junction annonations."> - <option value="without-gtf" selected='true'>use genome reference without builtin gene-model</option> + <option value="without-gtf-with-gtf" selected='true'>use genome reference without builtin gene-model but provide a gtf</option> + <option value="without-gtf">use genome reference without builtin gene-model and do not provide a gtf</option> <option value="with-gtf">use genome reference with builtin gene-model</option> </param> <when value="with-gtf"> <expand macro="index_selection" with_gene_model="1" /> + <expand macro="quantMode" /> + </when> + <when value="without-gtf-with-gtf"> + <expand macro="index_selection" with_gene_model="0" /> + <expand macro="SJDBOPTIONS"/> + <expand macro="quantMode" /> </when> <when value="without-gtf"> <expand macro="index_selection" with_gene_model="0" /> - <expand macro="@SJDBOPTIONS@" /> + <expand macro="quantModeNoGTF" /> </when> </conditional> </when> @@ -301,9 +311,12 @@ <option value="with-gtf">build index with gene-model</option> </param> <when value="with-gtf"> - <expand macro="@SJDBOPTIONS@" optional="false"/> + <expand macro="SJDBOPTIONS"/> + <expand macro="quantMode" /> </when> - <when value="without-gtf" /> + <when value="without-gtf"> + <expand macro="quantModeNoGTF" /> + </when> </conditional> </when> </conditional> @@ -335,28 +348,6 @@ label="Pregenerated splice junctions datasets of your samples" /> </when> </conditional> - <conditional name="quantmode_output"> - <param argument="--quantMode" type="select" - label="Per gene/transcript output" - help="STAR can provide analysis results not only with respect to the reference genome, but also with respect to genes and transcripts described by a gene model. Note: This functionality requires either the selection above of a cached index with a gene model, or a gene model provided alongside the index/reference genome in GTF or GFF3 format!"> - <option value="-">No per gene or transcript output</option> - <option value="GeneCounts">Per gene read counts (GeneCounts)</option> - <option value="TranscriptomeSAM">Transcript-based BAM output (TranscriptomeSAM)</option> - <option value="TranscriptomeSAM GeneCounts">Both per gene read counts and transcript-based BAM output (TranscriptomeSAM GeneCounts)</option> - </param> - <when value="-" /> - <when value="GeneCounts" /> - <when value="TranscriptomeSAM"> - <param argument="--quantTranscriptomeBan" type="boolean" truevalue="IndelSoftclipSingleend" falsevalue="Singleend" - label="Exclude alignments with indels or soft clipping from the transcriptome BAM output?" - help="You will need to exclude alignments with indels and soft-clipped bases from the transcriptome BAM output for compatibility with certain transcript quantification tools, most notably RSEM. If you are using a tool, like eXpress, that can deal with indels and soft-clipped bases, you can achieve better results by leaving this option disabled." /> - </when> - <when value="TranscriptomeSAM GeneCounts"> - <param argument="--quantTranscriptomeBan" type="boolean" truevalue="IndelSoftclipSingleend" falsevalue="Singleend" - label="Exclude alignments with indels or soft clipping from the transcriptome BAM output?" - help="You will need to exclude alignments with indels and soft-clipped bases from the transcriptome BAM output for compatibility with certain transcript quantification tools, most notably RSEM. If you are using a tool, like eXpress, that can deal with indels and soft-clipped bases, you can achieve better results by leaving this option disabled." /> - </when> - </conditional> <param argument="--chimOutType" type="select" label="Report chimeric alignments?" help="Choose if and how chimeric alignments should be reported. STAR-Fusion users should select the 'Junctions' option and use the resulting tabular dataset as input to STAR-Fusion. Everyone else: note that selecting 'WithinBAM' or 'WithinBAM Junctions' disables the --chimMultimapNmax setting in the algorithmic parameters section below (the tool will only consider uniquely mapped reads in the search for chimeric alignments). If you disable the reporting of chimeric alignments here, then all chimeric alignment settings in the algorithmic parameters section below will be ignored."> @@ -365,7 +356,6 @@ <option value="WithinBAM">Within the BAM output (together with regular alignments; WithinBAM)</option> <option value="WithinBAM HardClip">Within the BAM output (together with regular alignments; WithinBAM HardClip) hard-clipping in the CIGAR for supplemental chimeric alignments</option> <option value="WithinBAM SoftClip">Within the BAM output (together with regular alignments; WithinBAM SoftClip) soft-clipping in the CIGAR for supplemental chimeric alignments</option> - <option value="WithinBAM Junctions">Deprecated: In both forms (WithinBAM Junctions)</option> </param> <section name="oformat" title="BAM output format specification" expanded="true"> @@ -373,17 +363,10 @@ label="Read alignment tags to include in the BAM output" help="Note on using the XS tag: If the XS tag is used, STAR will filter out alignments with undefined strand (i.e., those containing only non-canonical unannotated junctions). Using this tag is recommended if you plan to use the STAR results with STAR-Fusion. In addition, it is required for compatibility with Cufflinks if your sequences come from an unstranded library preparation."> - <option value="NH" selected="true">NH (number of reported alignments/hits for the read)</option> - <option value="HI" selected="true">HI (query hit index)</option> - <option value="AS" selected="true">AS (local alignment score)</option> - <option value="nM" selected="true">nM (number of mismatches per (paired) alignment)</option> + <expand macro="common_SAM_attributes"/> + <option value="MC">MC (CIGAR string for mate/next segment)</option> <option value="XS">XS (strand flag, see parameter help below) </option> - <option value="NM">NM (edit distance of the aligned read to the reference)</option> - <option value="MD">MD (string for mismatching positions)</option> - <option value="MC">MC (CIGAR string for mate/next segment)</option> - <option value="jM">jM (intron motifs for all junctions)</option> - <option value="jI">jI (1-based start and end of introns for all junctions)</option> - <option value="ch" selected="true">ch (used to indicate chimeric alignments)</option> + <option value="ch" selected="true">ch (used to indicate chimeric alignments)</option> <!--This is not the default in STAR--> </param> <param argument="--outSAMattrIHstart" name="HI_offset" type="select" display="radio" label="HI tag values should be"> @@ -403,10 +386,13 @@ label="Would you like all alignments with the best score labeled primary?"/> --> <param name="outSAMprimaryFlag" type="hidden" value="OneBestScore" /> - <param argument="--outSAMmapqUnique" type="integer" value="60" min="30" max="255" + <!-- MAPQ 255 is the default in STAR (coming from tophat behaviour and compatibility for Cufflinks) but it is a problematic value + - according to SAM/BAM specs it means "undefined". + - Using 255 as the max mapq causes problem with modern downstream tools like mutect2: https://sites.duke.edu/workblog/2021/08/18/star-rnaseq-gatk-mutect2/ and 60 has become an inofficial replacement for 255. --> + <param argument="--outSAMmapqUnique" type="integer" value="60" min="0" max="255" label="MAPQ value for unique mappers" help="STAR bases the mapping quality scores of alignment records in its BAM output on the number of alternative mappings for the read. If a read maps to multiple locations on the reference genome, the following MAPQ scoring scheme is -used: >=5 mappings => MAPQ=0; 3-4 mappings => MAPQ=1; 2 mappings => MAPQ=3. This setting lets you control the MAPQ used for reads mapped to a single location. Set to 255 for compatibility with Cufflinks." /> +used: >=5 mappings => MAPQ=0; 3-4 mappings => MAPQ=1; 2 mappings => MAPQ=3. This setting lets you control the MAPQ used for reads mapped to a single location. Set to 255 for compatibility with Cufflink (default in STAR) but keep to 60 for modern downstream tools like mutect2." /> </section> <section name="filter" title="Output filter criteria" expanded="true"> <param name="basic_filters" type="select" display="checkboxes" multiple="true" optional="true" @@ -469,7 +455,7 @@ </section> <section name="align" title="Alignment parameters" expanded="false"> - <param argument="--alignIntronMin" name="alignIntronMin" type="integer" min="0" value="21" label="Minimum intron size"/> + <param argument="--alignIntronMin" type="integer" min="0" value="21" label="Minimum intron size"/> <param argument="--alignIntronMax" type="integer" min="0" value="0" label="Maximum intron size"/> <param argument="--alignMatesGapMax" type="integer" min="0" value="0" label="Maximum gap between two mates"/> <param argument="--alignSJoverhangMin" type="integer" min="1" value="5" label="Minimum overhang for spliced alignments"/> @@ -485,7 +471,12 @@ <param argument="--alignWindowsPerReadNmax" type="integer" min="1" value="10000" label="Maximum number of windows per read"/> <param argument="--alignTranscriptsPerWindowNmax" type="integer" min="1" value="100" label="Maximum number of transcripts per window"/> <param argument="--alignTranscriptsPerReadNmax" type="integer" min="1" value="10000" label="Maximum number of different alignments per read to consider"/> - <param argument="--alignEndsType" type="boolean" truevalue="EndToEnd" falsevalue="Local" checked="false" label="Use end-to-end read alignments, with no soft-clipping?"/> + <param argument="--alignEndsType" type="select" label="type of read ends alignment"> + <option value="Local">standard local alignment with soft-clipping allowed</option> + <option value="EndToEnd">force end-to-end read alignment, do not soft-clip</option> + <option value="Extend5pOfRead1">fully extend only the 5p of the read1, all other ends: local alignment</option> + <option value="Extend5pOfReads12">fully extend only the 5p of the both read1 and read2, all other ends: local alignment</option> + </param> <param argument="--peOverlapNbasesMin" type="integer" min="0" value="0" label="minimum number of overlap bases to trigger mates merging and realignment" /> <param argument="--peOverlapMMp" type="float" min="0" max="1" value="0.01" @@ -519,11 +510,7 @@ label="Score range for multi-mapping chimeras" help="The threshold below the best chimeric score that a multimapping chimera must have to be output. This is ignored unless --chimMultimapNmax is above 1" /> </section> - <section name="limits" title="Limits" expanded="false"> - <param argument="--limitOutSJoneRead" type="integer" min="1" value="1000" label="Maximum number of junctions for one read (including all multimappers)" /> - <param argument="--limitOutSJcollapsed" type="integer" min="1" value="1000000" label="Maximum number of collapsed junctions" /> - <param argument="--limitSjdbInsertNsj" type="integer" min="0" value="1000000" label="Maximum number of inserts to be inserted into the genome on the fly." /> - </section> + <expand macro="limits" /> </when> </conditional> </section> @@ -531,6 +518,7 @@ <param argument="--outBAMsortingBinsN" type="integer" value="50" min="1" label="Number of genome bins for coordinate-sorting" help="Higher values result in lower RAM requirements during the sorting step. The default value is 50. Tweak this if you are facing memory-related errors." /> <param argument="--winAnchorMultimapNmax" type="integer" value="50" min="50" label="Maximum number of loci anchors are allowed to map to" help="Higher value can increase the runtime singificantly. This value should be set greater or equal to --outFilterMultimapNmax" /> </section> + <expand macro="outWig"/> </inputs> <outputs> @@ -552,14 +540,16 @@ </data> <data name="transcriptome_mapped_reads" format="unsorted.bam" label="${tool.name} on ${on_string}: transcriptome-mapped.bam" > - <filter>'TranscriptomeSAM' in quantmode_output['quantMode']</filter> + <filter>'TranscriptomeSAM' in refGenomeSource['GTFconditional']['quantmode_output']['quantMode']</filter> <expand macro="dbKeyActions" /> </data> <data name="reads_per_gene" format="tabular" label="${tool.name} on ${on_string}: reads per gene" from_work_dir="ReadsPerGene.out.tab"> - <filter>'GeneCounts' in quantmode_output['quantMode']</filter> + <filter>'GeneCounts' in refGenomeSource['GTFconditional']['quantmode_output']['quantMode']</filter> <expand macro="dbKeyActions" /> + <expand macro="outCountActions" /> </data> + <expand macro="outWigOutputs"/> </outputs> <tests> @@ -570,12 +560,11 @@ </conditional> <conditional name="refGenomeSource"> <param name="geneSource" value="history" /> - <param name="genomeFastaFiles" value="tophat_test.fa" /> + <param name="genomeFastaFiles" value="tophat_test.fa.gz" /> <param name="genomeSAindexNbases" value="5" /> </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -601,7 +590,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -626,14 +614,13 @@ <param name="GTFselect" value="with-gtf" /> <param name="sjdbOverhang" value="75"/> <param name="sjdbGTFfile" value="test1.gtf" ftype="gtf"/> + <conditional name="quantmode_output"> + <param name="quantMode" value="GeneCounts"/> + </conditional> </conditional> </conditional> - <conditional name="quantmode_output"> - <param name="quantMode" value="GeneCounts"/> - </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -660,14 +647,13 @@ <param name="GTFselect" value="with-gtf" /> <param name="sjdbOverhang" value="75"/> <param name="sjdbGTFfile" value="test1.gtf" ftype="gtf"/> + <conditional name="quantmode_output"> + <param name="quantMode" value="TranscriptomeSAM"/> + </conditional> </conditional> </conditional> - <conditional name="quantmode_output"> - <param name="quantMode" value="TranscriptomeSAM"/> - </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -680,6 +666,39 @@ <output name="mapped_reads" file="rnastar_test_mapped_reads.bam" compare="sim_size" delta="634" /> <output name="transcriptome_mapped_reads" file="rnastar_test_transcriptome_mapped_reads.bam" compare="sim_size" delta="634" /> </test> + <!-- test cached no index but gtf file and GeneCounts TranscriptomeSAM mode --> + <test expect_num_outputs="5"> + <conditional name="singlePaired"> + <param name="sPaired" value="single" /> + <param name="input1" value="tophat_in2.fastqsanger" ftype="fastqsanger" /> + </conditional> + <conditional name="refGenomeSource"> + <param name="geneSource" value="indexed" /> + <conditional name="GTFconditional"> + <param name="GTFselect" value="without-gtf-with-gtf" /> + <param name="genomeDir" value="000" /> + <param name="sjdbOverhang" value="75"/> + <param name="sjdbGTFfile" value="test1.gtf" ftype="gtf"/> + <conditional name="quantmode_output"> + <param name="quantMode" value="TranscriptomeSAM GeneCounts"/> + </conditional> + </conditional> + </conditional> + <section name="oformat"> + <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> + </section> + <section name="algo"> + <conditional name="params"> + <param name="settingsType" value="default" /> + </conditional> + </section> + + <output name="output_log" file="rnastar_test.log" compare="re_match_multiline" /> + <output name="splice_junctions" file="rnastar_test_splicejunctions.bed"/> + <output name="mapped_reads" file="rnastar_test_mapped_reads.bam" compare="sim_size" delta="634" /> + <output name="reads_per_gene" file="tophat_test_reads_per_gene.txt" /> + <output name="transcriptome_mapped_reads" file="rnastar_test_transcriptome_mapped_reads.bam" compare="sim_size" delta="634" /> + </test> <test expect_num_outputs="3"> <conditional name="singlePaired"> <param name="sPaired" value="single" /> @@ -692,7 +711,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch,XS" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="exclude_unmapped,--outFilterIntronMotifs RemoveNoncanonical" /> @@ -728,7 +746,6 @@ <param name="chimOutType" value="Junctions" /> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch,XS" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -751,7 +768,6 @@ <param name="chimOutType" value="Junctions" /> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch,XS" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -773,7 +789,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="--outFilterIntronMotifs RemoveNoncanonical" /> @@ -808,7 +823,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="exclude_unmapped,--outFilterIntronMotifs RemoveNoncanonical" /> @@ -844,7 +858,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="exclude_unmapped,--outFilterIntronMotifs RemoveNoncanonical" /> @@ -880,7 +893,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="exclude_unmapped,--outFilterIntronMotifs RemoveNoncanonical" /> @@ -915,7 +927,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="filter"> <param name="basic_filters" value="exclude_unmapped,--outFilterIntronMotifs RemoveNoncanonicalUnannotated,--outFilterIntronMotifs RemoveNoncanonical" /> @@ -946,7 +957,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -969,7 +979,6 @@ </conditional> <section name="oformat"> <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> - <param name="outSAMmapqUnique" value="255" /> </section> <section name="algo"> <conditional name="params"> @@ -980,6 +989,101 @@ <output name="splice_junctions" file="rnastar_test_genomeSAindexNbases_02.bed"/> <output name="mapped_reads" file="rnastar_test_mapped_reads_genomeSAindexNbases_02.bam" compare="sim_size" delta="634" /> </test> + <!-- test paired-end input and outWig --> + <test expect_num_outputs="6"> + <conditional name="singlePaired"> + <param name="sPaired" value="paired" /> + <param name="input1" value="tophat_in2.fastqsanger" ftype="fastqsanger" /> + <param name="input2" value="tophat_in3.fastqsanger" ftype="fastqsanger" /> + </conditional> + <conditional name="refGenomeSource"> + <param name="geneSource" value="history" /> + <param name="genomeFastaFiles" value="tophat_test.fa" /> + <param name="genomeSAindexNbases" value="5" /> + <conditional name="GTFconditional"> + <param name="GTFselect" value="with-gtf" /> + <param name="sjdbOverhang" value="75"/> + <param name="sjdbGTFfile" value="test1.gtf" ftype="gtf"/> + <conditional name="quantmode_output"> + <param name="quantMode" value="GeneCounts"/> + </conditional> + </conditional> + </conditional> + <section name="oformat"> + <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> + </section> + <section name="algo"> + <conditional name="params"> + <param name="settingsType" value="default" /> + </conditional> + </section> + <conditional name="outWig"> + <param name="outWigType" value="wiggle" /> + <param name="outWigTypeSecondWord" value="read2"/> + <param name="outWigStrand" value="false" /> + </conditional> + <output name="output_log" file="rnastar_test.log" compare="re_match_multiline" /> + <output name="splice_junctions" file="rnastar_test_splicejunctions_PE.bed"/> + <output name="mapped_reads" file="rnastar_test_mapped_reads_PE.bam" compare="sim_size" delta="634" /> + <output name="reads_per_gene" file="tophat_test_reads_per_gene_PE.txt" /> + <output name="signal_unique_str1" file="tophat_Signal.Unique.both.read2.out.wig" ftype="wig"/> + <output name="signal_uniquemultiple_str1" file="tophat_Signal.Unique.both.read2.out.wig" ftype="wig" /> + </test> + <!-- test paired-end input as collection and outWig stranded --> + <test expect_num_outputs="8"> + <conditional name="singlePaired"> + <param name="sPaired" value="paired_collection" /> + <param name="input" > + <collection type="paired"> + <element name="forward" value="tophat_revlib_R1.fastqsanger" ftype="fastq"/> + <element name="reverse" value="tophat_revlib_R2.fastqsanger" ftype="fastq"/> + </collection> + </param> + </conditional> + <conditional name="refGenomeSource"> + <param name="geneSource" value="history" /> + <param name="genomeFastaFiles" value="tophat_test.fa" /> + <param name="genomeSAindexNbases" value="5" /> + <conditional name="GTFconditional"> + <param name="GTFselect" value="with-gtf" /> + <param name="sjdbOverhang" value="75"/> + <param name="sjdbGTFfile" value="test1.gtf" ftype="gtf"/> + <conditional name="quantmode_output"> + <param name="quantMode" value="GeneCounts"/> + </conditional> + </conditional> + </conditional> + <section name="oformat"> + <param name="outSAMattributes" value="NH,HI,AS,nM,NM,MD,jM,jI,MC,ch" /> + </section> + <section name="algo"> + <conditional name="params"> + <param name="settingsType" value="default" /> + </conditional> + </section> + <conditional name="outWig"> + <param name="outWigType" value="bedGraph" /> + </conditional> + + <output name="output_log" file="rnastar_test.log" compare="re_match_multiline" /> + <output name="splice_junctions"> + <assert_contents> + <has_n_lines n="2"/> + <has_line_matching expression="test_chromosome\s+251\s+350\s+1\s+1\s+0\s+24\s+0\s+33"/> + <has_line_matching expression="test_chromosome\s+401\s+500\s+1\s+1\s+0\s+25\s+0\s+36"/> + </assert_contents> + </output> + <output name="mapped_reads" > + <assert_contents> + <has_size value="4711" delta="800"/> + </assert_contents> + </output> + <output name="reads_per_gene" file="tophat_test_reads_per_gene_PE_rev.txt" /> + <output name="signal_unique_str1" file="tophat_rev_Signal.Unique.str1.out.bg" ftype="bedgraph"/> + <output name="signal_uniquemultiple_str1" file="tophat_rev_Signal.Unique.str1.out.bg" ftype="bedgraph"/> + <output name="signal_unique_str2" file="tophat_rev_Signal.Unique.str2.out.bg" ftype="bedgraph" /> + <output name="signal_uniquemultiple_str2" file="tophat_rev_Signal.Unique.str2.out.bg" ftype="bedgraph" /> + </test> </tests> <help><![CDATA[ **What it does** @@ -1024,7 +1128,7 @@ In addition, the following parameters_ related to chimeric alignment are recommended for improved sensitivity - under *Output filter criteria*, - **Would you like to set additional output filters?**: select `Yes' to set + **Would you like to set additional output filters?**: select `Yes` to set **Maximum number of alignments to output a read's alignment results, plus 1** to 50 - under *Algorithmic settings*, **Configure seed, alignment and limits options**:
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Signal.Unique.str1.out.bg Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,914 @@ +21 2314 2324 1396.64804 +21 4077 4087 1396.64804 +21 9248 9258 1396.64804 +21 11381 11401 1396.64804 +21 13182 13194 1396.64804 +21 13823 13853 1396.64804 +21 13853 13862 2793.29609 +21 13862 13864 6983.24022 +21 13864 13866 8379.88827 +21 13866 13871 9776.53631 +21 13871 13876 11173.18436 +21 13876 13881 12569.83240 +21 13881 13886 11173.18436 +21 13886 13889 8379.88827 +21 13889 13906 9776.53631 +21 13906 13918 8379.88827 +21 13918 13944 9776.53631 +21 13944 13945 8379.88827 +21 13945 13946 6983.24022 +21 13946 13950 8379.88827 +21 13950 13951 9776.53631 +21 13951 13962 11173.18436 +21 13962 13967 9776.53631 +21 13967 13975 8379.88827 +21 13975 13978 6983.24022 +21 13978 13980 5586.59218 +21 13980 13984 4189.94413 +21 13984 13990 2793.29609 +21 13990 13999 1396.64804 +21 15341 15345 1396.64804 +21 15345 15393 2793.29609 +21 15393 15416 1396.64804 +21 18907 18908 1396.64804 +21 18908 18916 2793.29609 +21 18916 18918 4189.94413 +21 18918 18919 2793.29609 +21 18919 18922 4189.94413 +21 18922 18948 5586.59218 +21 18948 18954 2793.29609 +21 18954 19007 1396.64804 +21 19258 19281 1396.64804 +21 19597 19657 1396.64804 +21 19784 19803 2793.29609 +21 19803 19804 4189.94413 +21 19804 19807 5586.59218 +21 19807 19815 6983.24022 +21 19815 19818 11173.18436 +21 19818 19819 12569.83240 +21 19819 19828 15363.12849 +21 19828 19829 16759.77654 +21 19829 19831 12569.83240 +21 19831 19841 13966.48045 +21 19841 19873 6983.24022 +21 19873 19875 5586.59218 +21 19875 19888 4189.94413 +21 19888 19906 2793.29609 +21 19907 19946 1396.64804 +21 19946 19958 2793.29609 +21 19958 19994 4189.94413 +21 19994 19996 5586.59218 +21 19996 19998 4189.94413 +21 19998 20035 2793.29609 +21 20035 20073 1396.64804 +21 20647 20654 1396.64804 +21 20654 20657 2793.29609 +21 20657 20659 4189.94413 +21 20659 20662 5586.59218 +21 20662 20663 8379.88827 +21 20663 20670 11173.18436 +21 20670 20693 9776.53631 +21 20693 20703 11173.18436 +21 20703 20704 8379.88827 +21 20704 20707 9776.53631 +21 20707 20716 11173.18436 +21 20716 20718 12569.83240 +21 20718 20723 13966.48045 +21 20723 20728 15363.12849 +21 20728 20739 16759.77654 +21 20739 20745 18156.42458 +21 20745 20747 16759.77654 +21 20747 20750 15363.12849 +21 20750 20753 13966.48045 +21 20753 20765 12569.83240 +21 20765 20778 11173.18436 +21 20778 20779 9776.53631 +21 20779 20780 8379.88827 +21 20780 20784 5586.59218 +21 20784 20788 4189.94413 +21 20788 20790 2793.29609 +21 20790 20793 1396.64804 +21 20829 20915 1396.64804 +21 21515 21524 1396.64804 +21 24070 24079 1396.64804 +21 25229 25245 1396.64804 +21 27657 27658 1396.64804 +21 27658 27660 2793.29609 +21 27660 27662 5586.59218 +21 27662 27672 8379.88827 +21 27672 27677 6983.24022 +21 27677 27683 5586.59218 +21 27683 27712 2793.29609 +21 27712 27724 1396.64804 +21 27738 27748 1396.64804 +21 27794 27808 2793.29609 +21 27808 27811 5586.59218 +21 27811 27826 6983.24022 +21 27826 27829 8379.88827 +21 27829 27833 9776.53631 +21 27833 27835 11173.18436 +21 27835 27837 12569.83240 +21 27837 27838 13966.48045 +21 27838 27839 15363.12849 +21 27839 27845 16759.77654 +21 27845 27849 13966.48045 +21 27849 27850 15363.12849 +21 27850 27852 16759.77654 +21 27852 27856 19553.07263 +21 27856 27858 18156.42458 +21 27858 27863 13966.48045 +21 27863 27870 6983.24022 +21 27870 27877 8379.88827 +21 27877 27883 9776.53631 +21 27883 27884 11173.18436 +21 27884 27886 12569.83240 +21 27886 27895 11173.18436 +21 27895 27897 12569.83240 +21 27897 27900 13966.48045 +21 27900 27901 15363.12849 +21 27901 27905 16759.77654 +21 27905 27909 18156.42458 +21 27909 27920 19553.07263 +21 27920 27926 20949.72067 +21 27926 27934 19553.07263 +21 27934 27937 16759.77654 +21 27937 27939 18156.42458 +21 27939 27940 19553.07263 +21 27940 27943 18156.42458 +21 27943 27950 16759.77654 +21 27950 27955 13966.48045 +21 27955 27958 11173.18436 +21 27958 27964 12569.83240 +21 27964 27968 11173.18436 +21 27968 27974 9776.53631 +21 27974 27982 8379.88827 +21 27982 27984 6983.24022 +21 27984 27989 5586.59218 +21 27989 27991 4189.94413 +21 27991 27999 5586.59218 +21 27999 28003 4189.94413 +21 28003 28021 2793.29609 +21 28021 28029 1396.64804 +21 28105 28115 1396.64804 +21 28115 28120 2793.29609 +21 28120 28142 4189.94413 +21 28142 28185 5586.59218 +21 28185 28229 1396.64804 +21 28229 28233 2793.29609 +21 28233 28266 1396.64804 +21 29543 29567 1396.64804 +21 29780 29784 1396.64804 +21 29784 29786 2793.29609 +21 29786 29794 4189.94413 +21 29794 29795 5586.59218 +21 29795 29796 6983.24022 +21 29796 29799 8379.88827 +21 29799 29803 9776.53631 +21 29803 29805 12569.83240 +21 29805 29807 13966.48045 +21 29807 29808 15363.12849 +21 29808 29809 16759.77654 +21 29809 29810 18156.42458 +21 29810 29811 20949.72067 +21 29811 29813 22346.36872 +21 29813 29816 23743.01676 +21 29816 29818 26536.31285 +21 29818 29820 27932.96089 +21 29820 29823 29329.60894 +21 29823 29825 30726.25698 +21 29825 29826 33519.55307 +21 29826 29833 34916.20112 +21 29833 29842 36312.84916 +21 29842 29845 37709.49721 +21 29845 29846 39106.14525 +21 29846 29848 40502.79330 +21 29848 29850 39106.14525 +21 29850 29851 40502.79330 +21 29851 29862 41899.44134 +21 29862 29863 40502.79330 +21 29863 29865 41899.44134 +21 29865 29869 40502.79330 +21 29869 29875 39106.14525 +21 29875 29877 36312.84916 +21 29877 29888 34916.20112 +21 29888 29890 33519.55307 +21 29890 29894 32122.90503 +21 29894 29896 30726.25698 +21 29896 29898 29329.60894 +21 29898 29900 25139.66480 +21 29900 29901 22346.36872 +21 29901 29902 20949.72067 +21 29902 29904 16759.77654 +21 29904 29905 15363.12849 +21 29905 29906 13966.48045 +21 29906 29907 12569.83240 +21 29907 29914 11173.18436 +21 29914 29915 9776.53631 +21 29915 29916 8379.88827 +21 29916 29917 6983.24022 +21 29917 29918 5586.59218 +21 29918 29922 4189.94413 +21 29922 29937 2793.29609 +21 29937 29940 1396.64804 +21 30023 30043 4189.94413 +21 30043 30044 1396.64804 +21 30102 30104 1396.64804 +21 30104 30107 2793.29609 +21 30107 30108 5586.59218 +21 30108 30110 6983.24022 +21 30110 30121 8379.88827 +21 30121 30123 6983.24022 +21 30123 30126 5586.59218 +21 30126 30158 1396.64804 +21 30198 30256 2793.29609 +21 30256 30259 1396.64804 +21 30285 30315 1396.64804 +21 30853 30878 1396.64804 +21 30878 30900 2793.29609 +21 30900 30905 1396.64804 +21 30924 30951 1396.64804 +21 35934 35938 1396.64804 +21 35938 35950 2793.29609 +21 35950 35958 4189.94413 +21 35958 35970 5586.59218 +21 35970 35982 6983.24022 +21 35982 35989 8379.88827 +21 35989 35993 9776.53631 +21 35993 35995 6983.24022 +21 35995 35997 8379.88827 +21 35997 35998 9776.53631 +21 35998 36002 11173.18436 +21 36002 36016 12569.83240 +21 36016 36023 15363.12849 +21 36023 36025 13966.48045 +21 36025 36029 12569.83240 +21 36029 36036 11173.18436 +21 36036 36045 9776.53631 +21 36045 36071 8379.88827 +21 36071 36088 6983.24022 +21 36088 36093 5586.59218 +21 36093 36105 4189.94413 +21 36105 36114 1396.64804 +21 36114 36136 2793.29609 +21 36136 36169 4189.94413 +21 36169 36171 2793.29609 +21 36171 36204 1396.64804 +21 37374 37451 1396.64804 +21 37568 37573 1396.64804 +21 37573 37579 2793.29609 +21 37579 37580 5586.59218 +21 37580 37606 6983.24022 +21 37606 37611 8379.88827 +21 37611 37613 9776.53631 +21 37613 37617 11173.18436 +21 37617 37620 13966.48045 +21 37620 37623 15363.12849 +21 37623 37629 19553.07263 +21 37629 37641 11173.18436 +21 37641 37652 12569.83240 +21 37652 37660 11173.18436 +21 37660 37664 12569.83240 +21 37664 37665 13966.48045 +21 37665 37680 15363.12849 +21 37680 37692 16759.77654 +21 37692 37693 15363.12849 +21 37693 37696 13966.48045 +21 37696 37704 11173.18436 +21 37704 37705 9776.53631 +21 37705 37711 8379.88827 +21 37711 37719 6983.24022 +21 37719 37725 11173.18436 +21 37725 37732 12569.83240 +21 37732 37750 11173.18436 +21 37750 37751 9776.53631 +21 37751 37752 8379.88827 +21 37752 37755 6983.24022 +21 37755 37756 5586.59218 +21 37756 37770 4189.94413 +21 37770 37785 2793.29609 +21 37785 37792 1396.64804 +21 41605 41638 1396.64804 +21 45215 45227 1396.64804 +21 45946 45954 1396.64804 +21 45954 45974 2793.29609 +21 45974 45982 1396.64804 +21 45982 45984 2793.29609 +21 45984 45987 5586.59218 +21 45987 45989 6983.24022 +21 45989 45996 8379.88827 +21 45996 46013 9776.53631 +21 46013 46016 11173.18436 +21 46016 46018 13966.48045 +21 46018 46023 15363.12849 +21 46023 46030 16759.77654 +21 46030 46034 19553.07263 +21 46034 46035 20949.72067 +21 46035 46040 22346.36872 +21 46040 46042 20949.72067 +21 46042 46046 22346.36872 +21 46046 46047 25139.66480 +21 46047 46052 26536.31285 +21 46052 46053 25139.66480 +21 46053 46056 26536.31285 +21 46056 46057 22346.36872 +21 46057 46064 20949.72067 +21 46064 46067 19553.07263 +21 46067 46068 20949.72067 +21 46068 46072 22346.36872 +21 46072 46074 20949.72067 +21 46074 46075 19553.07263 +21 46075 46078 18156.42458 +21 46078 46087 16759.77654 +21 46087 46104 15363.12849 +21 46104 46106 12569.83240 +21 46106 46107 11173.18436 +21 46107 46119 9776.53631 +21 46119 46127 8379.88827 +21 46127 46137 6983.24022 +21 46137 46138 5586.59218 +21 46138 46141 4189.94413 +21 46141 46158 2793.29609 +21 46158 46159 1396.64804 +21 46197 46217 1396.64804 +21 46773 46812 1396.64804 +21 50152 50153 1396.64804 +21 50153 50187 2793.29609 +21 50187 50191 4189.94413 +21 50191 50192 5586.59218 +21 50192 50193 4189.94413 +21 50193 50195 5586.59218 +21 50195 50200 6983.24022 +21 50200 50215 8379.88827 +21 50215 50222 9776.53631 +21 50222 50237 11173.18436 +21 50237 50243 9776.53631 +21 50243 50249 6983.24022 +21 50249 50278 5586.59218 +21 50278 50279 4189.94413 +21 50279 50284 2793.29609 +21 50284 50289 1396.64804 +21 50647 50650 1396.64804 +21 50650 50715 2793.29609 +21 51242 51333 1396.64804 +21 51814 51829 1396.64804 +21 51829 51837 2793.29609 +21 51837 51842 4189.94413 +21 51842 51846 5586.59218 +21 51846 51851 6983.24022 +21 51851 51855 8379.88827 +21 51855 51861 9776.53631 +21 51861 51862 11173.18436 +21 51862 51866 12569.83240 +21 51866 51869 18156.42458 +21 51869 51870 19553.07263 +21 51870 51874 23743.01676 +21 51874 51875 26536.31285 +21 51875 51877 25139.66480 +21 51877 51878 27932.96089 +21 51878 51889 29329.60894 +21 51889 51894 27932.96089 +21 51894 51896 26536.31285 +21 51896 51898 25139.66480 +21 51898 51902 19553.07263 +21 51902 51903 18156.42458 +21 51903 51922 16759.77654 +21 51922 51928 15363.12849 +21 51928 51935 13966.48045 +21 51935 51936 11173.18436 +21 51936 51941 9776.53631 +21 51941 51943 8379.88827 +21 51943 51946 6983.24022 +21 51946 51960 4189.94413 +21 51960 51964 2793.29609 +21 51964 51969 1396.64804 +21 52098 52099 1396.64804 +21 52099 52102 2793.29609 +21 52102 52108 4189.94413 +21 52108 52109 6983.24022 +21 52109 52116 8379.88827 +21 52116 52118 5586.59218 +21 52118 52124 6983.24022 +21 52124 52130 8379.88827 +21 52130 52132 11173.18436 +21 52132 52149 9776.53631 +21 52149 52152 12569.83240 +21 52152 52161 13966.48045 +21 52161 52183 9776.53631 +21 52183 52189 11173.18436 +21 52189 52192 9776.53631 +21 52192 52193 12569.83240 +21 52193 52199 9776.53631 +21 52199 52206 8379.88827 +21 52206 52214 6983.24022 +21 52214 52215 5586.59218 +21 52215 52219 6983.24022 +21 52219 52221 5586.59218 +21 52221 52230 6983.24022 +21 52230 52236 8379.88827 +21 52236 52251 6983.24022 +21 52251 52260 5586.59218 +21 52260 52267 6983.24022 +21 52267 52281 5586.59218 +21 52281 52294 4189.94413 +21 52294 52296 5586.59218 +21 52296 52306 6983.24022 +21 52306 52312 5586.59218 +21 52312 52328 4189.94413 +21 52328 52351 2793.29609 +21 52351 52387 1396.64804 +21 60345 60429 1396.64804 +21 62339 62340 1396.64804 +21 62340 62359 2793.29609 +21 62359 62360 4189.94413 +21 62360 62366 5586.59218 +21 62366 62403 6983.24022 +21 62403 62405 4189.94413 +21 62405 62408 5586.59218 +21 62408 62414 8379.88827 +21 62414 62418 9776.53631 +21 62418 62419 8379.88827 +21 62419 62424 9776.53631 +21 62424 62425 8379.88827 +21 62425 62440 9776.53631 +21 62440 62453 11173.18436 +21 62453 62459 9776.53631 +21 62459 62462 11173.18436 +21 62462 62471 12569.83240 +21 62471 62474 11173.18436 +21 62474 62479 9776.53631 +21 62479 62485 12569.83240 +21 62485 62493 13966.48045 +21 62493 62504 15363.12849 +21 62504 62514 13966.48045 +21 62514 62526 15363.12849 +21 62526 62532 13966.48045 +21 62532 62535 12569.83240 +21 62535 62543 11173.18436 +21 62543 62550 5586.59218 +21 62550 62551 4189.94413 +21 62551 62556 2793.29609 +21 62856 62867 8379.88827 +21 62867 62878 9776.53631 +21 62878 62879 12569.83240 +21 62879 62889 16759.77654 +21 62889 62891 18156.42458 +21 62891 62898 19553.07263 +21 62898 62900 18156.42458 +21 62900 62903 19553.07263 +21 62903 62906 20949.72067 +21 62906 62907 22346.36872 +21 62907 62908 23743.01676 +21 62908 62909 25139.66480 +21 62909 62910 26536.31285 +21 62910 62916 27932.96089 +21 62916 62918 29329.60894 +21 62918 62922 30726.25698 +21 62922 62925 29329.60894 +21 62925 62926 27932.96089 +21 62926 62933 26536.31285 +21 62933 62941 25139.66480 +21 62941 62952 23743.01676 +21 62952 62967 22346.36872 +21 62967 62968 16759.77654 +21 62968 62970 15363.12849 +21 62970 62971 12569.83240 +21 62971 62975 11173.18436 +21 62975 62976 5586.59218 +21 62976 62980 4189.94413 +21 62980 62997 2793.29609 +21 62997 62999 1396.64804 +21 63006 63032 1396.64804 +21 63032 63033 2793.29609 +21 63033 63039 4189.94413 +21 63039 63051 6983.24022 +21 63051 63071 8379.88827 +21 63071 63073 5586.59218 +21 63073 63079 4189.94413 +21 63079 63112 2793.29609 +21 63112 63136 1396.64804 +21 63519 63529 1396.64804 +21 74425 74432 1396.64804 +21 74432 74433 2793.29609 +21 74433 74451 4189.94413 +21 74451 74453 2793.29609 +21 74453 74459 4189.94413 +21 74459 74460 5586.59218 +21 74460 74487 6983.24022 +21 74487 74495 5586.59218 +21 74495 74500 4189.94413 +21 74500 74505 2793.29609 +21 74541 74561 1396.64804 +21 74574 74613 1396.64804 +21 76053 76062 1396.64804 +21 80498 80522 1396.64804 +21 81280 81283 1396.64804 +21 81283 81284 2793.29609 +21 81284 81286 4189.94413 +21 81286 81289 5586.59218 +21 81289 81294 8379.88827 +21 81294 81295 9776.53631 +21 81295 81301 11173.18436 +21 81301 81304 12569.83240 +21 81304 81340 13966.48045 +21 81340 81341 12569.83240 +21 81341 81348 13966.48045 +21 81348 81356 11173.18436 +21 81356 81360 9776.53631 +21 81360 81362 11173.18436 +21 81362 81366 9776.53631 +21 81366 81373 11173.18436 +21 81373 81378 6983.24022 +21 81378 81380 5586.59218 +21 81380 81384 4189.94413 +21 81384 81388 2793.29609 +21 81388 81390 4189.94413 +21 81390 81392 5586.59218 +21 81392 81401 4189.94413 +21 81401 81405 5586.59218 +21 81405 81437 6983.24022 +21 81437 81441 5586.59218 +21 81441 81465 4189.94413 +21 81465 81470 2793.29609 +21 81470 81471 1396.64804 +21 81471 81476 2793.29609 +21 81476 81482 1396.64804 +21 84749 84759 2793.29609 +21 85524 85538 1396.64804 +21 88016 88031 1396.64804 +21 88031 88035 12569.83240 +21 88035 88038 13966.48045 +21 88038 88044 18156.42458 +21 88044 88055 19553.07263 +21 88055 88060 20949.72067 +21 88060 88063 22346.36872 +21 88063 88067 19553.07263 +21 88067 88072 18156.42458 +21 88072 88073 16759.77654 +21 88073 88080 15363.12849 +21 88080 88100 13966.48045 +21 88100 88102 12569.83240 +21 88102 88103 11173.18436 +21 88103 88104 9776.53631 +21 88104 88109 8379.88827 +21 88109 88112 6983.24022 +21 88112 88115 8379.88827 +21 88115 88119 11173.18436 +21 88119 88121 12569.83240 +21 88121 88125 13966.48045 +21 88125 88129 12569.83240 +21 88129 88133 11173.18436 +21 88133 88154 9776.53631 +21 88154 88159 8379.88827 +21 88159 88167 6983.24022 +21 88167 88170 5586.59218 +21 88170 88176 2793.29609 +21 88176 88180 4189.94413 +21 88180 88200 6983.24022 +21 88200 88210 5586.59218 +21 88210 88215 4189.94413 +21 88215 88246 1396.64804 +21 88247 88264 1396.64804 +21 89111 89119 1396.64804 +21 91495 91517 2793.29609 +21 91535 91536 1396.64804 +21 91536 91564 2793.29609 +21 91564 91596 1396.64804 +21 91651 91656 1396.64804 +21 91656 91658 2793.29609 +21 91658 91659 4189.94413 +21 91659 91669 6983.24022 +21 91669 91676 4189.94413 +21 91676 91702 2793.29609 +21 91702 91708 1396.64804 +21 93544 93553 1396.64804 +21 97934 97948 1396.64804 +21 97948 97965 2793.29609 +21 97965 97974 4189.94413 +21 97974 97975 2793.29609 +21 97975 98036 1396.64804 +21 98680 98690 1396.64804 +21 98690 98700 2793.29609 +21 98700 98715 4189.94413 +21 98715 98743 5586.59218 +21 98743 98753 4189.94413 +21 99712 99720 1396.64804 +21 100151 100164 1396.64804 +21 100217 100220 1396.64804 +21 100220 100249 2793.29609 +21 100249 100259 1396.64804 +21 108178 108203 1396.64804 +21 108267 108292 4189.94413 +21 108292 108305 2793.29609 +21 108305 108322 1396.64804 +21 108933 108945 1396.64804 +21 110220 110239 1396.64804 +21 112390 112395 1396.64804 +21 112395 112411 2793.29609 +21 112411 112442 1396.64804 +21 115827 115831 1396.64804 +21 115831 115851 2793.29609 +21 115851 115855 4189.94413 +21 115855 115869 5586.59218 +21 115869 115880 6983.24022 +21 115880 115881 5586.59218 +21 115881 115886 6983.24022 +21 115886 115894 11173.18436 +21 115894 115895 9776.53631 +21 115895 115903 11173.18436 +21 115903 115918 9776.53631 +21 115918 115919 2793.29609 +21 115919 115924 1396.64804 +21 115945 115955 1396.64804 +21 115955 115971 2793.29609 +21 115971 115984 1396.64804 +21 117722 117732 1396.64804 +21 120455 120464 1396.64804 +21 120487 120492 1396.64804 +21 120492 120516 2793.29609 +21 120516 120538 1396.64804 +21 120538 120545 22346.36872 +21 120545 120559 23743.01676 +21 120559 120560 22346.36872 +21 120560 120561 20949.72067 +21 120561 120562 19553.07263 +21 120562 120563 18156.42458 +21 120563 120567 15363.12849 +21 120567 120568 13966.48045 +21 120568 120570 12569.83240 +21 120570 120574 9776.53631 +21 120574 120575 8379.88827 +21 120575 120578 6983.24022 +21 120578 120579 5586.59218 +21 120579 120598 2793.29609 +21 120598 120610 1396.64804 +21 120610 120629 2793.29609 +21 120629 120646 1396.64804 +21 120920 120932 1396.64804 +21 125923 125937 1396.64804 +21 126006 126035 2793.29609 +21 126035 126072 1396.64804 +21 130897 130902 1396.64804 +21 131772 131793 1396.64804 +21 136949 136952 2793.29609 +21 136952 136968 4189.94413 +21 136968 136978 5586.59218 +21 136978 136991 4189.94413 +21 136991 136996 5586.59218 +21 136996 137010 6983.24022 +21 137010 137019 8379.88827 +21 137019 137020 6983.24022 +21 137020 137028 5586.59218 +21 137028 137032 4189.94413 +21 137032 137035 2793.29609 +21 137035 137039 1396.64804 +21 137039 137072 2793.29609 +21 137072 137074 4189.94413 +21 137074 137078 2793.29609 +21 137078 137082 1396.64804 +21 137082 137141 2793.29609 +21 137141 137142 1396.64804 +21 137226 137249 1396.64804 +21 137255 137268 1396.64804 +21 137268 137291 2793.29609 +21 137291 137327 1396.64804 +21 137327 137332 2793.29609 +21 137332 137368 1396.64804 +21 137368 137407 2793.29609 +21 137407 137424 1396.64804 +21 138362 138373 1396.64804 +21 138373 138379 2793.29609 +21 138379 138384 4189.94413 +21 138384 138386 8379.88827 +21 138386 138387 9776.53631 +21 138387 138392 11173.18436 +21 138392 138403 12569.83240 +21 138403 138414 13966.48045 +21 138414 138417 12569.83240 +21 138417 138424 11173.18436 +21 138424 138426 12569.83240 +21 138426 138431 5586.59218 +21 138431 138441 4189.94413 +21 138441 138442 2793.29609 +21 138442 138460 1396.64804 +21 138517 138539 1396.64804 +21 138559 138573 1396.64804 +21 138573 138580 2793.29609 +21 138580 138585 1396.64804 +21 139652 139673 1396.64804 +21 143522 143546 4189.94413 +21 143546 143555 5586.59218 +21 143555 143567 4189.94413 +21 143567 143595 2793.29609 +21 143595 143635 1396.64804 +21 143656 143658 1396.64804 +21 143658 143682 2793.29609 +21 143682 143684 1396.64804 +21 152398 152401 1396.64804 +21 152401 152406 2793.29609 +21 152406 152410 5586.59218 +21 152410 152411 8379.88827 +21 152411 152412 9776.53631 +21 152412 152414 12569.83240 +21 152414 152418 13966.48045 +21 152418 152425 16759.77654 +21 152425 152429 18156.42458 +21 152429 152442 19553.07263 +21 152442 152446 20949.72067 +21 152446 152451 22346.36872 +21 152451 152454 23743.01676 +21 152454 152455 25139.66480 +21 152455 152459 30726.25698 +21 152459 152460 32122.90503 +21 152460 152465 33519.55307 +21 152465 152467 37709.49721 +21 152467 152470 40502.79330 +21 152470 152475 47486.03352 +21 152475 152486 48882.68156 +21 152486 152488 50279.32961 +21 152488 152489 47486.03352 +21 152489 152490 46089.38547 +21 152490 152491 47486.03352 +21 152491 152492 46089.38547 +21 152492 152497 43296.08939 +21 152497 152499 41899.44134 +21 152499 152501 43296.08939 +21 152501 152502 40502.79330 +21 152502 152506 39106.14525 +21 152506 152508 36312.84916 +21 152508 152510 33519.55307 +21 152510 152512 32122.90503 +21 152512 152516 30726.25698 +21 152516 152521 27932.96089 +21 152521 152531 26536.31285 +21 152531 152533 25139.66480 +21 152533 152534 22346.36872 +21 152534 152537 19553.07263 +21 152537 152538 16759.77654 +21 152538 152539 15363.12849 +21 152539 152540 12569.83240 +21 152540 152542 11173.18436 +21 152542 152543 8379.88827 +21 152543 152551 6983.24022 +21 152551 152554 5586.59218 +21 152554 152561 4189.94413 +21 152561 152568 2793.29609 +21 152568 152570 1396.64804 +21 152612 152618 1396.64804 +21 152618 152623 4189.94413 +21 152623 152627 2793.29609 +21 152627 152641 1396.64804 +21 152785 152795 1396.64804 +21 206493 206505 1396.64804 +21 206505 206513 2793.29609 +21 206513 206520 1396.64804 +21 206520 206521 2793.29609 +21 206521 206526 5586.59218 +21 206526 206529 6983.24022 +21 206529 206539 5586.59218 +21 206539 206550 4189.94413 +21 206550 206556 2793.29609 +21 206556 206558 1396.64804 +21 209464 209485 1396.64804 +21 211799 211810 1396.64804 +21 214550 214561 1396.64804 +21 219215 219228 1396.64804 +21 219228 219261 2793.29609 +21 219261 219266 1396.64804 +21 221748 221753 1396.64804 +21 221753 221773 2793.29609 +21 221773 221799 4189.94413 +21 221799 221801 5586.59218 +21 221801 221811 6983.24022 +21 221811 221818 5586.59218 +21 221818 221844 4189.94413 +21 221844 221862 2793.29609 +21 221862 221868 1396.64804 +21 221868 221890 2793.29609 +21 221890 221955 1396.64804 +21 234205 234220 1396.64804 +21 244704 244712 1396.64804 +21 246178 246193 1396.64804 +21 248926 249007 1396.64804 +21 251511 251531 4189.94413 +21 251531 251557 2793.29609 +21 251557 251568 1396.64804 +21 289413 289422 1396.64804 +21 289422 289424 2793.29609 +21 289424 289425 8379.88827 +21 289425 289426 13966.48045 +21 289426 289428 15363.12849 +21 289428 289438 16759.77654 +21 289438 289446 18156.42458 +21 289446 289448 20949.72067 +21 289448 289453 22346.36872 +21 289453 289464 23743.01676 +21 289464 289465 25139.66480 +21 289465 289469 27932.96089 +21 289469 289474 30726.25698 +21 289474 289475 32122.90503 +21 289475 289477 33519.55307 +21 289477 289478 34916.20112 +21 289478 289479 36312.84916 +21 289479 289483 34916.20112 +21 289483 289491 36312.84916 +21 289491 289492 41899.44134 +21 289492 289497 40502.79330 +21 289497 289499 39106.14525 +21 289499 289501 40502.79330 +21 289501 289503 39106.14525 +21 289503 289508 37709.49721 +21 289508 289509 36312.84916 +21 289509 289514 34916.20112 +21 289514 289516 33519.55307 +21 289516 289517 27932.96089 +21 289517 289524 26536.31285 +21 289524 289525 27932.96089 +21 289525 289526 29329.60894 +21 289526 289528 27932.96089 +21 289528 289533 26536.31285 +21 289533 289536 27932.96089 +21 289536 289537 25139.66480 +21 289537 289544 23743.01676 +21 289544 289550 20949.72067 +21 289550 289551 25139.66480 +21 289551 289554 23743.01676 +21 289554 289555 22346.36872 +21 289555 289556 20949.72067 +21 289556 289560 18156.42458 +21 289560 289562 15363.12849 +21 289562 289563 13966.48045 +21 289563 289564 15363.12849 +21 289564 289566 13966.48045 +21 289566 289567 12569.83240 +21 289567 289571 11173.18436 +21 289571 289572 9776.53631 +21 289572 289577 8379.88827 +21 289577 289587 6983.24022 +21 289587 289588 5586.59218 +21 289588 289614 6983.24022 +21 289614 289624 5586.59218 +21 289624 289625 4189.94413 +21 289625 289640 5586.59218 +21 289640 289641 4189.94413 +21 289641 289654 2793.29609 +21 289654 289685 1396.64804 +21 289685 289712 2793.29609 +21 289712 289716 12569.83240 +21 289716 289740 11173.18436 +21 289740 289758 9776.53631 +21 337612 337622 1396.64804 +21 338079 338170 1396.64804 +21 339843 339858 1396.64804 +21 339859 339867 1396.64804 +21 339867 339899 2793.29609 +21 339899 339905 1396.64804 +21 339905 339934 2793.29609 +21 339934 339964 1396.64804 +21 343012 343027 1396.64804 +21 355779 355870 1396.64804 +21 436933 437022 1396.64804 +21 498394 498404 1396.64804 +21 530553 530598 1396.64804 +21 530693 530694 1396.64804 +21 530694 530707 2793.29609 +21 530707 530715 1396.64804 +21 540665 540716 1396.64804 +21 540797 540868 1396.64804 +21 541758 541811 1396.64804 +21 545498 545501 1396.64804 +21 545501 545515 2793.29609 +21 545515 545579 1396.64804 +21 545718 545738 1396.64804 +21 548371 548460 1396.64804 +21 553486 553504 2793.29609 +21 553504 553505 1396.64804 +21 553505 553537 2793.29609 +21 553537 553575 1396.64804 +21 557602 557636 2793.29609 +21 557636 557667 1396.64804 +21 557695 557750 1396.64804 +21 566421 566451 4189.94413 +21 566451 566453 2793.29609 +21 566453 566459 1396.64804 +21 566563 566590 2793.29609 +21 571042 571059 1396.64804 +21 573571 573580 1396.64804 +21 573590 573615 1396.64804 +21 573615 573616 2793.29609 +21 573616 573661 1396.64804 +21 576301 576336 1396.64804 +21 577645 577675 1396.64804 +21 596644 596697 1396.64804 +21 682451 682471 1396.64804 +21 682479 682535 1396.64804 +21 683486 683495 1396.64804 +21 686930 687021 1396.64804 +21 687170 687188 1396.64804 +21 687423 687433 1396.64804 +21 693741 693756 1396.64804 +21 693888 693904 1396.64804 +21 694403 694423 1396.64804 +21 694423 694459 2793.29609 +21 694459 694484 4189.94413 +21 694484 694490 2793.29609 +21 694490 694514 1396.64804
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Signal.Unique.str2.out.bg Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,574 @@ +21 6892 6927 1396.64804 +21 6940 6988 1396.64804 +21 7026 7036 1396.64804 +21 7036 7039 2793.29609 +21 7039 7068 1396.64804 +21 7068 7070 2793.29609 +21 7070 7096 1396.64804 +21 8591 8599 1396.64804 +21 15317 15320 4189.94413 +21 15320 15328 5586.59218 +21 15328 15329 6983.24022 +21 15329 15331 8379.88827 +21 15331 15332 12569.83240 +21 15332 15333 15363.12849 +21 15333 15334 16759.77654 +21 15334 15338 19553.07263 +21 15338 15339 20949.72067 +21 15339 15340 23743.01676 +21 15340 15341 25139.66480 +21 15341 15342 26536.31285 +21 15342 15351 27932.96089 +21 15351 15352 30726.25698 +21 15352 15358 32122.90503 +21 15358 15359 30726.25698 +21 15359 15360 32122.90503 +21 15360 15363 33519.55307 +21 15363 15364 34916.20112 +21 15364 15366 36312.84916 +21 15366 15371 37709.49721 +21 15371 15378 39106.14525 +21 15378 15380 40502.79330 +21 15380 15382 41899.44134 +21 15382 15383 40502.79330 +21 15383 15385 41899.44134 +21 15385 15391 43296.08939 +21 15391 15392 41899.44134 +21 15392 15393 43296.08939 +21 15393 15401 40502.79330 +21 15401 15402 39106.14525 +21 15402 15406 37709.49721 +21 15406 15410 34916.20112 +21 15410 15411 36312.84916 +21 15411 15416 37709.49721 +21 15416 15419 30726.25698 +21 15419 15420 26536.31285 +21 15420 15421 22346.36872 +21 15421 15422 19553.07263 +21 15422 15424 18156.42458 +21 15424 15428 16759.77654 +21 15428 15429 15363.12849 +21 15429 15430 13966.48045 +21 15430 15432 12569.83240 +21 15432 15434 9776.53631 +21 15434 15435 8379.88827 +21 15435 15440 6983.24022 +21 15440 15450 8379.88827 +21 15450 15451 6983.24022 +21 15451 15462 5586.59218 +21 15462 15467 4189.94413 +21 15467 15499 2793.29609 +21 15499 15503 1396.64804 +21 15504 15531 1396.64804 +21 15616 15628 1396.64804 +21 15628 15644 2793.29609 +21 15657 15714 1396.64804 +21 19249 19266 1396.64804 +21 19507 19514 1396.64804 +21 19514 19521 2793.29609 +21 19521 19532 4189.94413 +21 19532 19538 2793.29609 +21 19538 19557 1396.64804 +21 19557 19572 2793.29609 +21 19572 19593 5586.59218 +21 19593 19599 6983.24022 +21 19599 19612 8379.88827 +21 19612 19627 6983.24022 +21 19627 19638 4189.94413 +21 19638 19644 2793.29609 +21 19644 19657 1396.64804 +21 19667 19685 1396.64804 +21 19685 19753 2793.29609 +21 19753 19767 1396.64804 +21 21409 21419 1396.64804 +21 27372 27373 1396.64804 +21 27373 27381 5586.59218 +21 27381 27386 6983.24022 +21 27386 27389 8379.88827 +21 27389 27392 9776.53631 +21 27392 27405 11173.18436 +21 27405 27408 6983.24022 +21 27408 27411 5586.59218 +21 27411 27424 6983.24022 +21 27424 27452 5586.59218 +21 27452 27453 6983.24022 +21 27453 27464 8379.88827 +21 27464 27479 6983.24022 +21 27479 27482 4189.94413 +21 27482 27493 2793.29609 +21 27493 27531 1396.64804 +21 27666 27697 1396.64804 +21 27847 27935 1396.64804 +21 29781 29788 1396.64804 +21 29788 29811 2793.29609 +21 29811 29840 4189.94413 +21 29840 29843 5586.59218 +21 29843 29868 4189.94413 +21 29868 29872 2793.29609 +21 29872 29913 1396.64804 +21 35083 35104 1396.64804 +21 35104 35118 2793.29609 +21 35118 35120 4189.94413 +21 35120 35124 6983.24022 +21 35124 35128 8379.88827 +21 35128 35129 9776.53631 +21 35129 35132 11173.18436 +21 35132 35135 12569.83240 +21 35135 35139 13966.48045 +21 35139 35140 15363.12849 +21 35140 35142 18156.42458 +21 35142 35151 19553.07263 +21 35151 35152 20949.72067 +21 35152 35160 22346.36872 +21 35160 35164 23743.01676 +21 35164 35168 25139.66480 +21 35168 35174 26536.31285 +21 35174 35177 25139.66480 +21 35177 35178 23743.01676 +21 35178 35180 25139.66480 +21 35180 35183 23743.01676 +21 35183 35185 22346.36872 +21 35185 35186 23743.01676 +21 35186 35188 25139.66480 +21 35188 35195 23743.01676 +21 35195 35198 25139.66480 +21 35198 35203 26536.31285 +21 35203 35205 25139.66480 +21 35205 35209 23743.01676 +21 35209 35210 22346.36872 +21 35210 35211 19553.07263 +21 35211 35212 15363.12849 +21 35212 35214 16759.77654 +21 35214 35220 15363.12849 +21 35220 35223 13966.48045 +21 35223 35225 12569.83240 +21 35225 35228 11173.18436 +21 35228 35229 9776.53631 +21 35229 35231 11173.18436 +21 35231 35232 9776.53631 +21 35232 35233 8379.88827 +21 35233 35237 11173.18436 +21 35237 35245 12569.83240 +21 35245 35269 9776.53631 +21 35269 35276 8379.88827 +21 35276 35287 6983.24022 +21 35287 35306 4189.94413 +21 35306 35310 2793.29609 +21 35310 35312 1396.64804 +21 37608 37629 1396.64804 +21 38862 38865 1396.64804 +21 38865 38876 2793.29609 +21 38876 38893 4189.94413 +21 38893 38914 2793.29609 +21 38914 38919 4189.94413 +21 38919 38930 5586.59218 +21 38930 38931 6983.24022 +21 38931 38941 9776.53631 +21 38941 38944 12569.83240 +21 38944 38948 13966.48045 +21 38948 38952 15363.12849 +21 38952 38953 13966.48045 +21 38953 38958 15363.12849 +21 38958 38959 13966.48045 +21 38959 38963 15363.12849 +21 38963 38978 13966.48045 +21 38978 38995 12569.83240 +21 38995 38997 9776.53631 +21 38997 39006 8379.88827 +21 39006 39017 5586.59218 +21 39017 39022 4189.94413 +21 39022 39023 2793.29609 +21 39023 39027 1396.64804 +21 46069 46082 1396.64804 +21 46082 46157 2793.29609 +21 46157 46163 1396.64804 +21 46724 46742 1396.64804 +21 46742 46748 2793.29609 +21 46748 46749 4189.94413 +21 46749 46760 5586.59218 +21 46760 46769 6983.24022 +21 46769 46780 8379.88827 +21 46780 46781 6983.24022 +21 46781 46782 5586.59218 +21 46782 46783 6983.24022 +21 46783 46784 9776.53631 +21 46784 46788 8379.88827 +21 46788 46789 9776.53631 +21 46789 46810 11173.18436 +21 46810 46813 12569.83240 +21 46813 46829 13966.48045 +21 46829 46831 12569.83240 +21 46831 46848 11173.18436 +21 46848 46851 12569.83240 +21 46851 46860 11173.18436 +21 46860 46863 9776.53631 +21 46863 46869 6983.24022 +21 46869 46870 2793.29609 +21 46870 46875 1396.64804 +21 51165 51166 1396.64804 +21 51166 51172 5586.59218 +21 51172 51173 8379.88827 +21 51173 51176 11173.18436 +21 51176 51178 12569.83240 +21 51178 51181 15363.12849 +21 51181 51183 16759.77654 +21 51183 51184 18156.42458 +21 51184 51185 19553.07263 +21 51185 51186 20949.72067 +21 51186 51187 23743.01676 +21 51187 51189 26536.31285 +21 51189 51190 37709.49721 +21 51190 51193 39106.14525 +21 51193 51194 40502.79330 +21 51194 51196 43296.08939 +21 51196 51197 46089.38547 +21 51197 51199 50279.32961 +21 51199 51202 54469.27374 +21 51202 51205 57262.56983 +21 51205 51207 58659.21788 +21 51207 51208 60055.86592 +21 51208 51210 61452.51397 +21 51210 51214 65642.45810 +21 51214 51215 67039.10615 +21 51215 51217 65642.45810 +21 51217 51222 68435.75419 +21 51222 51223 69832.40223 +21 51223 51226 76815.64246 +21 51226 51229 78212.29050 +21 51229 51231 76815.64246 +21 51231 51232 78212.29050 +21 51232 51237 79608.93855 +21 51237 51238 81005.58659 +21 51238 51246 83798.88268 +21 51246 51247 85195.53073 +21 51247 51248 86592.17877 +21 51248 51256 87988.82682 +21 51256 51258 82402.23464 +21 51258 51261 81005.58659 +21 51261 51263 79608.93855 +21 51263 51265 78212.29050 +21 51265 51267 76815.64246 +21 51267 51268 74022.34637 +21 51268 51269 72625.69832 +21 51269 51272 71229.05028 +21 51272 51273 69832.40223 +21 51273 51275 68435.75419 +21 51275 51276 67039.10615 +21 51276 51277 62849.16201 +21 51277 51278 61452.51397 +21 51278 51280 60055.86592 +21 51280 51282 46089.38547 +21 51282 51283 44692.73743 +21 51283 51284 41899.44134 +21 51284 51285 40502.79330 +21 51285 51286 37709.49721 +21 51286 51287 32122.90503 +21 51287 51289 29329.60894 +21 51289 51290 27932.96089 +21 51290 51292 23743.01676 +21 51292 51297 25139.66480 +21 51297 51298 22346.36872 +21 51298 51301 19553.07263 +21 51301 51302 15363.12849 +21 51302 51305 13966.48045 +21 51305 51306 12569.83240 +21 51306 51311 11173.18436 +21 51311 51314 8379.88827 +21 51314 51317 6983.24022 +21 51317 51324 5586.59218 +21 51324 51332 4189.94413 +21 51332 51336 2793.29609 +21 56756 56838 1396.64804 +21 57394 57415 1396.64804 +21 57560 57571 1396.64804 +21 57618 57629 1396.64804 +21 60236 60244 1396.64804 +21 60244 60245 2793.29609 +21 60245 60253 4189.94413 +21 60253 60266 2793.29609 +21 60266 60285 1396.64804 +21 60346 60347 1396.64804 +21 60347 60357 2793.29609 +21 60357 60360 5586.59218 +21 60360 60361 6983.24022 +21 60361 60365 8379.88827 +21 60365 60377 9776.53631 +21 60377 60379 11173.18436 +21 60379 60382 12569.83240 +21 60382 60389 11173.18436 +21 60389 60397 9776.53631 +21 60397 60444 8379.88827 +21 60444 60450 4189.94413 +21 60450 60465 1396.64804 +21 60500 60509 1396.64804 +21 60509 60534 2793.29609 +21 60534 60539 1396.64804 +21 60670 60673 1396.64804 +21 60673 60691 2793.29609 +21 60691 60711 4189.94413 +21 60711 60721 5586.59218 +21 60721 60725 6983.24022 +21 60725 60730 8379.88827 +21 60730 60744 9776.53631 +21 60744 60748 11173.18436 +21 60748 60749 12569.83240 +21 60749 60750 13966.48045 +21 60750 60751 15363.12849 +21 60751 60754 16759.77654 +21 60754 60756 18156.42458 +21 60756 60757 16759.77654 +21 60757 60759 18156.42458 +21 60759 60761 16759.77654 +21 60761 60763 18156.42458 +21 60763 60765 16759.77654 +21 60765 60767 18156.42458 +21 60767 60777 19553.07263 +21 60777 60778 20949.72067 +21 60778 60780 19553.07263 +21 60780 60795 20949.72067 +21 60795 60797 19553.07263 +21 60797 60804 18156.42458 +21 60804 60809 16759.77654 +21 60809 60829 15363.12849 +21 60829 60831 16759.77654 +21 60831 60833 13966.48045 +21 60833 60838 12569.83240 +21 60838 60840 11173.18436 +21 60840 60847 9776.53631 +21 60847 60852 2793.29609 +21 60852 60863 4189.94413 +21 60863 60906 2793.29609 +21 60906 60915 1396.64804 +21 63021 63109 1396.64804 +21 70098 70112 1396.64804 +21 70112 70139 2793.29609 +21 70147 70193 1396.64804 +21 70226 70234 2793.29609 +21 70234 70247 4189.94413 +21 70247 70266 5586.59218 +21 70266 70282 4189.94413 +21 70282 70286 1396.64804 +21 70288 70327 2793.29609 +21 70327 70329 1396.64804 +21 70329 70350 2793.29609 +21 70350 70360 1396.64804 +21 75608 75639 1396.64804 +21 75639 75640 2793.29609 +21 75640 75645 4189.94413 +21 75645 75651 9776.53631 +21 75651 75658 13966.48045 +21 75658 75660 15363.12849 +21 75660 75667 16759.77654 +21 75667 75685 18156.42458 +21 75685 75689 19553.07263 +21 75689 75691 20949.72067 +21 75691 75699 22346.36872 +21 75699 75706 20949.72067 +21 75706 75708 22346.36872 +21 75708 75713 19553.07263 +21 75713 75718 20949.72067 +21 75718 75719 19553.07263 +21 75719 75722 18156.42458 +21 75722 75726 19553.07263 +21 75726 75727 18156.42458 +21 75727 75728 13966.48045 +21 75728 75731 15363.12849 +21 75731 75734 13966.48045 +21 75734 75741 9776.53631 +21 75741 75742 8379.88827 +21 75742 75751 9776.53631 +21 75751 75753 8379.88827 +21 75753 75754 9776.53631 +21 75754 75757 8379.88827 +21 75757 75762 9776.53631 +21 75762 75766 11173.18436 +21 75766 75771 12569.83240 +21 75771 75775 15363.12849 +21 75775 75776 16759.77654 +21 75776 75778 15363.12849 +21 75778 75781 13966.48045 +21 75781 75790 15363.12849 +21 75790 75795 16759.77654 +21 75795 75798 15363.12849 +21 75798 75803 13966.48045 +21 75803 75805 12569.83240 +21 75805 75811 11173.18436 +21 75811 75818 9776.53631 +21 75818 75840 8379.88827 +21 75840 75854 9776.53631 +21 75854 75857 8379.88827 +21 75857 75861 6983.24022 +21 75861 75862 5586.59218 +21 75862 75866 1396.64804 +21 88028 88074 1396.64804 +21 88074 88103 2793.29609 +21 88103 88162 1396.64804 +21 97561 97562 1396.64804 +21 97562 97596 2793.29609 +21 97596 97614 1396.64804 +21 97674 97719 1396.64804 +21 97748 97771 1396.64804 +21 98625 98676 1396.64804 +21 98724 98746 1396.64804 +21 103066 103073 1396.64804 +21 104863 104954 1396.64804 +21 108267 108340 1396.64804 +21 117407 117409 2793.29609 +21 117409 117426 4189.94413 +21 117426 117447 2793.29609 +21 117447 117460 4189.94413 +21 117460 117466 6983.24022 +21 117466 117470 9776.53631 +21 117470 117478 11173.18436 +21 117478 117488 12569.83240 +21 117488 117492 13966.48045 +21 117492 117500 11173.18436 +21 117500 117505 9776.53631 +21 117505 117507 11173.18436 +21 117507 117514 12569.83240 +21 117514 117531 11173.18436 +21 117531 117535 9776.53631 +21 117535 117537 8379.88827 +21 117537 117538 6983.24022 +21 117538 117550 5586.59218 +21 117550 117566 2793.29609 +21 117566 117601 1396.64804 +21 117791 117882 1396.64804 +21 120538 120556 1396.64804 +21 127504 127530 2793.29609 +21 127618 127661 1396.64804 +21 138375 138419 1396.64804 +21 138420 138461 1396.64804 +21 139575 139596 2793.29609 +21 139596 139604 1396.64804 +21 139604 139607 2793.29609 +21 139607 139612 5586.59218 +21 139612 139618 6983.24022 +21 139618 139621 8379.88827 +21 139621 139629 6983.24022 +21 139629 139654 8379.88827 +21 139654 139661 9776.53631 +21 139661 139672 8379.88827 +21 139672 139676 9776.53631 +21 139676 139688 8379.88827 +21 139688 139690 4189.94413 +21 139690 139697 2793.29609 +21 139697 139707 1396.64804 +21 139710 139732 1396.64804 +21 139739 139761 1396.64804 +21 140471 140481 1396.64804 +21 142851 142859 1396.64804 +21 149223 149307 1396.64804 +21 149357 149375 1396.64804 +21 149429 149448 6983.24022 +21 149448 149453 5586.59218 +21 149453 149454 4189.94413 +21 149454 149465 2793.29609 +21 149465 149476 1396.64804 +21 149476 149485 4189.94413 +21 149485 149500 2793.29609 +21 149500 149501 1396.64804 +21 152403 152412 1396.64804 +21 152412 152452 2793.29609 +21 152452 152498 1396.64804 +21 206394 206404 1396.64804 +21 208624 208638 1396.64804 +21 211938 211950 1396.64804 +21 219166 219180 1396.64804 +21 220139 220151 1396.64804 +21 235083 235091 1396.64804 +21 236084 236098 1396.64804 +21 236227 236238 2793.29609 +21 236238 236252 4189.94413 +21 236252 236259 5586.59218 +21 236259 236268 6983.24022 +21 236268 236275 8379.88827 +21 236275 236278 9776.53631 +21 236278 236293 8379.88827 +21 236293 236297 6983.24022 +21 236297 236319 8379.88827 +21 236319 236323 6983.24022 +21 236323 236333 5586.59218 +21 236333 236346 4189.94413 +21 236346 236360 2793.29609 +21 236360 236365 13966.48045 +21 236365 236374 12569.83240 +21 236374 236380 11173.18436 +21 236380 236381 9776.53631 +21 236381 236382 8379.88827 +21 236382 236384 6983.24022 +21 236384 236387 5586.59218 +21 236387 236388 1396.64804 +21 236840 236882 1396.64804 +21 236882 236927 2793.29609 +21 236927 236972 1396.64804 +21 242722 242813 1396.64804 +21 246287 246319 1396.64804 +21 247415 247498 1396.64804 +21 248899 248905 1396.64804 +21 248905 248929 2793.29609 +21 248929 248993 1396.64804 +21 248993 248996 2793.29609 +21 248996 249004 1396.64804 +21 250020 250027 1396.64804 +21 250676 250683 1396.64804 +21 251516 251586 1396.64804 +21 318889 318980 1396.64804 +21 319674 319765 1396.64804 +21 319905 319993 1396.64804 +21 355605 355655 1396.64804 +21 355655 355688 2793.29609 +21 355688 355696 4189.94413 +21 355696 355724 2793.29609 +21 355724 355730 4189.94413 +21 355730 355746 5586.59218 +21 355746 355777 4189.94413 +21 355777 355815 2793.29609 +21 355815 355821 1396.64804 +21 435548 435566 1396.64804 +21 436967 437015 1396.64804 +21 437149 437173 1396.64804 +21 487343 487355 1396.64804 +21 487355 487359 5586.59218 +21 487359 487361 9776.53631 +21 487361 487367 8379.88827 +21 487367 487383 6983.24022 +21 487383 487399 5586.59218 +21 487399 487400 4189.94413 +21 487400 487404 2793.29609 +21 487404 487414 1396.64804 +21 495672 495682 1396.64804 +21 497013 497026 1396.64804 +21 499647 499657 1396.64804 +21 502310 502353 1396.64804 +21 503894 503904 1396.64804 +21 528944 528955 1396.64804 +21 538543 538555 1396.64804 +21 552533 552599 1396.64804 +21 552676 552704 1396.64804 +21 553677 553684 1396.64804 +21 566920 566929 1396.64804 +21 577666 577679 1396.64804 +21 578711 578722 1396.64804 +21 583123 583131 1396.64804 +21 597024 597037 1396.64804 +21 602235 602252 1396.64804 +21 602252 602255 2793.29609 +21 602255 602261 5586.59218 +21 602261 602269 4189.94413 +21 602269 602302 2793.29609 +21 602302 602313 1396.64804 +21 682300 682361 1396.64804 +21 682361 682382 2793.29609 +21 682382 682389 1396.64804 +21 682389 682449 2793.29609 +21 682449 682451 1396.64804 +21 682451 682480 2793.29609 +21 682480 682504 1396.64804 +21 682557 682564 1396.64804 +21 682564 682589 2793.29609 +21 682589 682601 1396.64804 +21 682606 682616 1396.64804 +21 689226 689256 1396.64804 +21 689294 689305 1396.64804 +21 695155 695200 1396.64804
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Signal.UniqueMultiple.str1.out.bg Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,2479 @@ +21 2314 2324 744.04762 +21 3910 3929 248.01587 +21 4077 4087 744.04762 +21 5357 5369 248.01587 +21 9248 9258 744.04762 +21 10032 10044 744.04762 +21 10858 10867 279.01786 +21 11381 11401 744.04762 +21 12115 12126 372.02381 +21 13182 13194 744.04762 +21 13247 13254 496.03175 +21 13818 13821 744.04762 +21 13821 13822 1041.66667 +21 13822 13823 1289.68254 +21 13823 13825 2033.73016 +21 13825 13826 2777.77778 +21 13826 13828 3149.80159 +21 13828 13830 4017.85714 +21 13830 13835 4513.88889 +21 13835 13842 4885.91270 +21 13842 13846 5257.93651 +21 13846 13847 5789.39909 +21 13847 13853 6161.42290 +21 13853 13857 7649.51814 +21 13857 13861 8145.54989 +21 13861 13862 8517.57370 +21 13862 13863 10962.30159 +21 13863 13864 11272.32143 +21 13864 13866 12264.38492 +21 13866 13867 13008.43254 +21 13867 13870 13256.44841 +21 13870 13871 13752.48016 +21 13871 13872 14868.55159 +21 13872 13873 13876.48810 +21 13873 13874 14248.51190 +21 13874 13875 14992.55952 +21 13875 13876 15426.58730 +21 13876 13881 16170.63492 +21 13881 13886 12760.41667 +21 13886 13889 6932.04365 +21 13889 13893 7676.09127 +21 13893 13901 8420.13889 +21 13901 13905 8048.11508 +21 13905 13906 7775.29762 +21 13906 13908 6393.49490 +21 13908 13915 6492.70125 +21 13915 13917 6678.71315 +21 13917 13918 6492.70125 +21 13918 13921 7236.74887 +21 13921 13930 7980.79649 +21 13930 13936 8352.82029 +21 13936 13937 8848.85204 +21 13937 13940 9406.88776 +21 13940 13943 9555.69728 +21 13943 13944 9704.50680 +21 13944 13945 8960.45918 +21 13945 13946 8216.41156 +21 13946 13947 8960.45918 +21 13947 13950 9332.48299 +21 13950 13951 10076.53061 +21 13951 13952 10820.57823 +21 13952 13955 10423.75283 +21 13955 13962 10051.72902 +21 13962 13964 9307.68141 +21 13964 13967 8563.63379 +21 13967 13975 7819.58617 +21 13975 13978 4322.56236 +21 13978 13980 3578.51474 +21 13980 13984 2834.46712 +21 13984 13990 2090.41950 +21 13990 13995 1346.37188 +21 13995 13999 1240.07937 +21 13999 14011 496.03175 +21 15341 15345 744.04762 +21 15345 15393 1488.09524 +21 15393 15416 744.04762 +21 17835 17843 330.68783 +21 18810 18819 148.80952 +21 18844 18859 372.02381 +21 18874 18889 372.02381 +21 18889 18895 558.03571 +21 18895 18907 930.05952 +21 18907 18908 1674.10714 +21 18908 18916 2418.15476 +21 18916 18918 3162.20238 +21 18918 18919 2418.15476 +21 18919 18922 3162.20238 +21 18922 18923 3906.25000 +21 18923 18936 4278.27381 +21 18936 18948 4154.26587 +21 18948 18952 2480.15873 +21 18952 18954 2046.13095 +21 18954 18957 1302.08333 +21 18957 18983 930.05952 +21 18983 18986 1525.29762 +21 18986 19000 1339.28571 +21 19000 19007 744.04762 +21 19233 19235 248.01587 +21 19235 19258 496.03175 +21 19258 19266 1240.07937 +21 19266 19281 744.04762 +21 19597 19657 744.04762 +21 19711 19736 558.03571 +21 19736 19740 372.02381 +21 19772 19778 372.02381 +21 19778 19784 744.04762 +21 19784 19789 2480.15873 +21 19789 19794 3720.23810 +21 19794 19796 4166.66667 +21 19796 19803 4228.67063 +21 19803 19804 4972.71825 +21 19804 19806 6014.38492 +21 19806 19807 6634.42460 +21 19807 19815 7626.48810 +21 19815 19818 10602.67857 +21 19818 19819 11594.74206 +21 19819 19823 13826.88492 +21 19823 19824 14570.93254 +21 19824 19825 15314.98016 +21 19825 19828 13678.07540 +21 19828 19829 14670.13889 +21 19829 19831 11693.94841 +21 19831 19835 12437.99603 +21 19835 19841 12810.01984 +21 19841 19849 6560.01984 +21 19849 19851 6808.03571 +21 19851 19852 6436.01190 +21 19852 19857 6250.00000 +21 19857 19860 5233.13492 +21 19860 19861 4861.11111 +21 19861 19875 4365.07937 +21 19875 19880 3621.03175 +21 19880 19887 3472.22222 +21 19887 19888 3224.20635 +21 19888 19892 2480.15873 +21 19892 19894 2852.18254 +21 19894 19897 3100.19841 +21 19897 19900 3249.00794 +21 19900 19902 3000.99206 +21 19902 19903 3249.00794 +21 19903 19906 3621.03175 +21 19906 19907 2132.93651 +21 19907 19916 2876.98413 +21 19916 19920 3249.00794 +21 19920 19924 3621.03175 +21 19924 19929 3435.01984 +21 19929 19932 3062.99603 +21 19932 19937 5629.96032 +21 19937 19946 5736.25283 +21 19946 19947 6480.30045 +21 19947 19956 6108.27664 +21 19956 19958 5736.25283 +21 19958 19963 6480.30045 +21 19963 19968 6480.30045 +21 19968 19969 5984.26871 +21 19969 19973 5612.24490 +21 19973 19982 4992.20522 +21 19982 19987 4620.18141 +21 19987 19988 3752.12585 +21 19988 19996 3454.50680 +21 19996 19998 2710.45918 +21 19998 20012 1966.41156 +21 20012 20023 1860.11905 +21 20023 20035 1488.09524 +21 20035 20073 744.04762 +21 20555 20562 372.02381 +21 20647 20648 1116.07143 +21 20648 20650 2221.51361 +21 20650 20652 2965.56122 +21 20652 20653 3213.57710 +21 20653 20654 4329.64853 +21 20654 20657 5073.69615 +21 20657 20658 6189.76757 +21 20658 20659 6778.80527 +21 20659 20660 7629.14541 +21 20660 20661 7877.16128 +21 20661 20662 8497.20096 +21 20662 20663 10530.93112 +21 20663 20665 12267.04223 +21 20665 20667 13011.08985 +21 20667 20670 13159.89938 +21 20670 20671 10338.71882 +21 20671 20674 10586.73469 +21 20674 20676 10958.75850 +21 20676 20677 11330.78231 +21 20677 20681 11454.79025 +21 20681 20682 12769.27438 +21 20682 20688 13017.29025 +21 20688 20689 13389.31406 +21 20689 20692 13538.12358 +21 20692 20693 13786.13946 +21 20693 20694 14716.19898 +21 20694 20695 14592.19104 +21 20695 20698 14716.19898 +21 20698 20703 14964.21485 +21 20703 20704 9213.78968 +21 20704 20705 9957.83730 +21 20705 20707 11036.70635 +21 20707 20709 11966.76587 +21 20709 20711 12214.78175 +21 20711 20712 12586.80556 +21 20712 20715 13826.88492 +21 20715 20716 14570.93254 +21 20716 20718 15314.98016 +21 20718 20720 15811.01190 +21 20720 20721 16059.02778 +21 20721 20723 16307.04365 +21 20723 20726 17671.13095 +21 20726 20727 18415.17857 +21 20727 20728 19159.22619 +21 20728 20731 20647.32143 +21 20731 20732 20151.28968 +21 20732 20739 20275.29762 +21 20739 20743 21019.34524 +21 20743 20744 21416.17063 +21 20744 20745 21044.14683 +21 20745 20746 20300.09921 +21 20746 20747 20672.12302 +21 20747 20750 19779.26587 +21 20750 20752 18787.20238 +21 20752 20753 18415.17857 +21 20753 20754 17671.13095 +21 20754 20755 17423.11508 +21 20755 20756 16927.08333 +21 20756 20759 16778.27381 +21 20759 20761 15414.18651 +21 20761 20765 15166.17063 +21 20765 20766 14422.12302 +21 20766 20767 13678.07540 +21 20767 20772 13554.06746 +21 20772 20773 12996.03175 +21 20773 20775 12748.01587 +21 20775 20776 12541.33598 +21 20776 20777 12355.32407 +21 20777 20778 11648.47884 +21 20778 20779 10532.40741 +21 20779 20780 9540.34392 +21 20780 20781 7159.39153 +21 20781 20783 7010.58201 +21 20783 20784 6514.55026 +21 20784 20786 5522.48677 +21 20786 20788 5150.46296 +21 20788 20789 3951.71958 +21 20789 20790 3455.68783 +21 20790 20791 2256.94444 +21 20791 20792 2108.13492 +21 20792 20793 1922.12302 +21 20793 20817 930.05952 +21 20817 20829 186.01190 +21 20829 20832 930.05952 +21 20832 20858 1302.08333 +21 20858 20862 1116.07143 +21 20862 20915 930.05952 +21 20915 20922 186.01190 +21 21371 21382 248.01587 +21 21515 21524 744.04762 +21 24070 24079 744.04762 +21 25229 25245 744.04762 +21 26648 26665 372.02381 +21 27194 27204 744.04762 +21 27210 27220 372.02381 +21 27437 27493 148.80952 +21 27657 27658 992.06349 +21 27658 27659 1736.11111 +21 27659 27660 1984.12698 +21 27660 27661 4290.67460 +21 27661 27662 4538.69048 +21 27662 27663 6175.59524 +21 27663 27671 6919.64286 +21 27671 27672 7291.66667 +21 27672 27673 6547.61905 +21 27673 27674 6919.64286 +21 27674 27677 7663.69048 +21 27677 27680 6919.64286 +21 27680 27681 7291.66667 +21 27681 27683 7663.69048 +21 27683 27693 4067.46032 +21 27693 27712 3819.44444 +21 27712 27716 967.26190 +21 27716 27724 818.45238 +21 27724 27728 74.40476 +21 27728 27738 260.41667 +21 27738 27739 1004.46429 +21 27739 27742 1252.48016 +21 27742 27748 1178.07540 +21 27748 27749 186.01190 +21 27793 27794 531.46259 +21 27794 27798 3991.28401 +21 27798 27803 4140.09354 +21 27803 27804 4618.40986 +21 27804 27805 5145.44359 +21 27805 27806 5393.45947 +21 27806 27807 5542.26899 +21 27807 27808 6360.72137 +21 27808 27811 8096.83248 +21 27811 27815 8840.88010 +21 27815 27816 9336.91185 +21 27816 27818 11110.22534 +21 27818 27825 12350.30471 +21 27825 27826 12722.32851 +21 27826 27829 13466.37613 +21 27829 27830 14210.42375 +21 27830 27833 14954.47137 +21 27833 27835 16194.55074 +21 27835 27836 17682.64598 +21 27836 27837 18054.66978 +21 27837 27838 18798.71740 +21 27838 27839 19914.78883 +21 27839 27840 21030.86026 +21 27840 27842 21402.88407 +21 27842 27845 21650.89994 +21 27845 27849 17690.61791 +21 27849 27850 18434.66553 +21 27850 27852 19178.71315 +21 27852 27853 21100.83617 +21 27853 27856 21348.85204 +21 27856 27858 20604.80442 +21 27858 27859 15823.41270 +21 27859 27861 15451.38889 +21 27861 27862 15823.41270 +21 27862 27863 16567.46032 +21 27863 27867 8829.36508 +21 27867 27868 9201.38889 +21 27868 27870 9307.68141 +21 27870 27874 10547.76077 +21 27874 27875 9803.71315 +21 27875 27877 9989.72506 +21 27877 27878 10733.77268 +21 27878 27881 10547.76077 +21 27881 27882 10398.95125 +21 27882 27883 9654.90363 +21 27883 27884 11887.04649 +21 27884 27886 12259.07029 +21 27886 27888 11515.02268 +21 27888 27890 12073.05839 +21 27890 27891 11949.05045 +21 27891 27892 11453.01871 +21 27892 27895 12197.06633 +21 27895 27897 12941.11395 +21 27897 27899 14057.18537 +21 27899 27900 14801.23299 +21 27900 27901 15173.25680 +21 27901 27905 15917.30442 +21 27905 27906 16661.35204 +21 27906 27909 16413.33617 +21 27909 27914 17157.38379 +21 27914 27920 17405.39966 +21 27920 27926 18149.44728 +21 27926 27928 16909.36791 +21 27928 27934 16537.34410 +21 27934 27937 13437.14569 +21 27937 27939 14181.19331 +21 27939 27940 14925.24093 +21 27940 27942 13957.97902 +21 27942 27943 13213.93141 +21 27943 27950 12469.88379 +21 27950 27953 9121.66950 +21 27953 27955 8749.64569 +21 27955 27956 7261.55045 +21 27956 27957 6889.52664 +21 27957 27958 6783.23413 +21 27958 27959 7527.28175 +21 27959 27961 8023.31349 +21 27961 27964 7775.29762 +21 27964 27968 7180.05952 +21 27968 27972 6436.01190 +21 27972 27974 6250.00000 +21 27974 27982 5877.97619 +21 27982 27984 5133.92857 +21 27984 27989 4389.88095 +21 27989 27991 3645.83333 +21 27991 27999 4389.88095 +21 27999 28003 3645.83333 +21 28003 28011 2901.78571 +21 28011 28021 1860.11905 +21 28021 28029 1116.07143 +21 28029 28050 372.02381 +21 28105 28115 744.04762 +21 28115 28120 1488.09524 +21 28120 28123 2418.15476 +21 28123 28124 2790.17857 +21 28124 28136 3038.19444 +21 28136 28142 2852.18254 +21 28142 28153 3596.23016 +21 28153 28161 3745.03968 +21 28161 28167 4117.06349 +21 28167 28168 4489.08730 +21 28168 28185 4737.10317 +21 28185 28229 744.04762 +21 28229 28233 1488.09524 +21 28233 28266 744.04762 +21 29108 29121 82.67196 +21 29437 29438 93.00595 +21 29438 29449 837.05357 +21 29449 29472 372.02381 +21 29484 29543 248.01587 +21 29543 29544 992.06349 +21 29544 29553 1140.87302 +21 29553 29567 992.06349 +21 29567 29568 248.01587 +21 29589 29613 595.23810 +21 29743 29746 372.02381 +21 29746 29749 454.69577 +21 29749 29754 826.71958 +21 29754 29756 919.72553 +21 29756 29766 1167.74140 +21 29766 29780 1074.73545 +21 29780 29784 1818.78307 +21 29784 29785 2934.85450 +21 29785 29786 3703.70370 +21 29786 29789 4447.75132 +21 29789 29792 4633.76323 +21 29792 29794 5377.81085 +21 29794 29795 6741.89815 +21 29795 29796 7485.94577 +21 29796 29797 8229.99339 +21 29797 29799 9408.06878 +21 29799 29802 10152.11640 +21 29802 29803 10300.92593 +21 29803 29805 11789.02116 +21 29805 29807 12533.06878 +21 29807 29808 14269.17989 +21 29808 29809 15757.27513 +21 29809 29810 16501.32275 +21 29810 29811 18919.47751 +21 29811 29813 18361.44180 +21 29813 29814 19105.48942 +21 29814 29815 19353.50529 +21 29815 29816 19849.53704 +21 29816 29817 21585.64815 +21 29817 29818 21957.67196 +21 29818 29819 22701.71958 +21 29819 29820 22949.73545 +21 29820 29822 23693.78307 +21 29822 29823 23611.11111 +21 29823 29824 25471.23016 +21 29824 29825 25719.24603 +21 29825 29826 28323.41270 +21 29826 29828 29067.46032 +21 29828 29830 29439.48413 +21 29830 29833 29652.06916 +21 29833 29834 30396.11678 +21 29834 29836 30024.09297 +21 29836 29837 30396.11678 +21 29837 29839 31288.97392 +21 29839 29842 32330.64059 +21 29842 29843 33446.71202 +21 29843 29845 32888.67630 +21 29845 29846 34748.79535 +21 29846 29848 35244.82710 +21 29848 29849 34500.77948 +21 29849 29850 34748.79535 +21 29850 29851 36112.88265 +21 29851 29855 36608.91440 +21 29855 29862 36236.89059 +21 29862 29863 35492.84297 +21 29863 29865 36236.89059 +21 29865 29868 35492.84297 +21 29868 29869 36385.70011 +21 29869 29870 35492.84297 +21 29870 29871 35827.66440 +21 29871 29872 35538.31255 +21 29872 29874 36282.36017 +21 29874 29875 36431.16969 +21 29875 29876 34571.05064 +21 29876 29877 33244.16572 +21 29877 29884 32351.30858 +21 29884 29885 32268.63662 +21 29885 29886 31462.58503 +21 29886 29888 31586.59297 +21 29888 29889 30594.52948 +21 29889 29890 30222.50567 +21 29890 29892 29478.45805 +21 29892 29894 29329.64853 +21 29894 29896 28585.60091 +21 29896 29897 27841.55329 +21 29897 29898 26849.48980 +21 29898 29899 24369.33107 +21 29899 29900 24183.31916 +21 29900 29901 17237.10317 +21 29901 29902 16245.03968 +21 29902 29903 14012.89683 +21 29903 29904 13516.86508 +21 29904 29905 12772.81746 +21 29905 29906 11408.73016 +21 29906 29907 10664.68254 +21 29907 29910 9548.61111 +21 29910 29911 8370.53571 +21 29911 29914 7998.51190 +21 29914 29915 7068.45238 +21 29915 29916 6076.38889 +21 29916 29917 4960.31746 +21 29917 29918 4216.26984 +21 29918 29922 3472.22222 +21 29922 29937 2356.15079 +21 29937 29940 1612.10317 +21 29940 29948 868.05556 +21 29948 29955 372.02381 +21 29955 29977 744.04762 +21 29977 30017 372.02381 +21 30017 30020 1116.07143 +21 30020 30023 744.04762 +21 30023 30035 2976.19048 +21 30035 30043 2232.14286 +21 30043 30044 744.04762 +21 30078 30083 372.02381 +21 30083 30084 1116.07143 +21 30084 30089 1860.11905 +21 30089 30098 1984.12698 +21 30098 30102 2281.74603 +21 30102 30104 4067.46032 +21 30104 30107 4811.50794 +21 30107 30110 6299.60317 +21 30110 30111 7787.69841 +21 30111 30115 8965.77381 +21 30115 30121 9399.80159 +21 30121 30123 8159.72222 +21 30123 30126 7415.67460 +21 30126 30158 744.04762 +21 30198 30256 1488.09524 +21 30256 30259 744.04762 +21 30285 30315 744.04762 +21 30845 30847 186.01190 +21 30847 30848 504.88946 +21 30848 30853 653.69898 +21 30853 30858 1397.74660 +21 30858 30863 1211.73469 +21 30863 30868 1955.78231 +21 30868 30869 2699.82993 +21 30869 30873 3071.85374 +21 30873 30878 3443.87755 +21 30878 30881 4559.94898 +21 30881 30887 5197.70408 +21 30887 30889 5848.74575 +21 30889 30891 5476.72194 +21 30891 30900 6054.24461 +21 30900 30905 4752.16128 +21 30905 30923 1793.68622 +21 30923 30924 2537.73384 +21 30924 30925 3281.78146 +21 30925 30937 2909.75765 +21 30937 30938 2816.75170 +21 30938 30944 2604.16667 +21 30944 30951 2232.14286 +21 30951 30954 1488.09524 +21 30954 30955 1116.07143 +21 30955 30959 744.04762 +21 30960 30994 248.01587 +21 35183 35245 496.03175 +21 35245 35274 248.01587 +21 35927 35934 372.02381 +21 35934 35938 1116.07143 +21 35938 35941 1860.11905 +21 35941 35943 2604.16667 +21 35943 35950 2852.18254 +21 35950 35956 3745.03968 +21 35956 35957 4117.06349 +21 35957 35958 4861.11111 +21 35958 35961 5605.15873 +21 35961 35966 6163.19444 +21 35966 35967 6659.22619 +21 35967 35968 7739.86678 +21 35968 35969 8483.91440 +21 35969 35970 8979.94615 +21 35970 35973 9972.00964 +21 35973 35974 10804.63435 +21 35974 35975 11017.21939 +21 35975 35976 11389.24320 +21 35976 35978 11761.26701 +21 35978 35979 12505.31463 +21 35979 35980 11761.26701 +21 35980 35981 12567.31859 +21 35981 35982 11823.27098 +21 35982 35985 12939.34240 +21 35985 35989 13996.06718 +21 35989 35993 14740.11480 +21 35993 35994 10251.02749 +21 35994 35995 10995.07511 +21 35995 35997 11925.13464 +21 35997 35998 13041.20607 +21 35998 36002 13785.25368 +21 36002 36006 14529.30130 +21 36006 36011 14343.28940 +21 36011 36013 14529.30130 +21 36013 36016 14901.32511 +21 36016 36017 16761.44416 +21 36017 36018 15942.10601 +21 36018 36020 15694.09014 +21 36020 36023 15942.10601 +21 36023 36025 14826.03458 +21 36025 36029 14081.98696 +21 36029 36032 13337.93934 +21 36032 36034 13151.92744 +21 36034 36036 11911.84807 +21 36036 36037 11185.51587 +21 36037 36039 10441.46825 +21 36039 36045 10317.46032 +21 36045 36047 9573.41270 +21 36047 36048 9201.38889 +21 36048 36049 8308.53175 +21 36049 36051 7564.48413 +21 36051 36057 7192.46032 +21 36057 36065 7564.48413 +21 36065 36066 7405.04535 +21 36066 36071 7033.02154 +21 36071 36073 6288.97392 +21 36073 36075 5110.89853 +21 36075 36079 4898.31349 +21 36079 36084 5270.33730 +21 36084 36087 4898.31349 +21 36087 36088 4526.28968 +21 36088 36093 3782.24206 +21 36093 36097 3038.19444 +21 36097 36099 3410.21825 +21 36099 36105 3224.20635 +21 36105 36108 1736.11111 +21 36108 36114 2480.15873 +21 36114 36125 3224.20635 +21 36125 36134 2976.19048 +21 36134 36136 3534.22619 +21 36136 36164 4278.27381 +21 36164 36169 3534.22619 +21 36169 36171 2418.15476 +21 36171 36183 1674.10714 +21 36183 36187 1488.09524 +21 36187 36204 744.04762 +21 37374 37382 744.04762 +21 37382 37387 1116.07143 +21 37387 37396 1264.88095 +21 37396 37411 1116.07143 +21 37411 37441 1302.08333 +21 37441 37451 1116.07143 +21 37451 37472 372.02381 +21 37503 37522 186.01190 +21 37556 37562 297.61905 +21 37562 37566 669.64286 +21 37566 37568 1201.10544 +21 37568 37573 1945.15306 +21 37573 37577 3805.27211 +21 37577 37579 4185.56311 +21 37579 37580 5673.65835 +21 37580 37584 6417.70597 +21 37584 37585 6603.71788 +21 37585 37587 7037.74565 +21 37587 37594 7781.79327 +21 37594 37602 7409.76946 +21 37602 37606 8153.81708 +21 37606 37611 8897.86470 +21 37611 37613 9641.91232 +21 37613 37616 10385.95994 +21 37616 37617 11316.01946 +21 37617 37620 14093.79724 +21 37620 37623 14837.84486 +21 37623 37626 17069.98772 +21 37626 37627 16325.94010 +21 37627 37629 17442.01153 +21 37629 37639 8968.72638 +21 37639 37640 9340.75019 +21 37640 37641 9154.73828 +21 37641 37643 9898.78590 +21 37643 37647 9824.38114 +21 37647 37652 9718.08862 +21 37652 37653 8974.04101 +21 37653 37660 9532.07672 +21 37660 37661 10648.14815 +21 37661 37664 11206.18386 +21 37664 37665 12198.24735 +21 37665 37668 12942.29497 +21 37668 37670 13231.64683 +21 37670 37678 13417.65873 +21 37678 37679 13169.64286 +21 37679 37680 12797.61905 +21 37680 37684 14285.71429 +21 37684 37688 13913.69048 +21 37688 37689 13541.66667 +21 37689 37690 13913.69048 +21 37690 37692 14182.37434 +21 37692 37693 13810.35053 +21 37693 37696 13066.30291 +21 37696 37703 11429.39815 +21 37703 37704 11346.72619 +21 37704 37705 10602.67857 +21 37705 37710 8556.54762 +21 37710 37711 8184.52381 +21 37711 37716 7440.47619 +21 37716 37719 7068.45238 +21 37719 37725 12177.57937 +21 37725 37726 12921.62698 +21 37726 37729 12177.57937 +21 37729 37730 11619.54365 +21 37730 37732 11247.51984 +21 37732 37733 10503.47222 +21 37733 37742 9945.43651 +21 37742 37746 9387.40079 +21 37746 37747 9015.37698 +21 37747 37748 8767.36111 +21 37748 37750 8953.37302 +21 37750 37751 8023.31349 +21 37751 37752 7279.26587 +21 37752 37753 6535.21825 +21 37753 37754 6349.20635 +21 37754 37755 5605.15873 +21 37755 37756 4861.11111 +21 37756 37759 4117.06349 +21 37759 37760 3869.04762 +21 37760 37770 3435.01984 +21 37770 37774 2690.97222 +21 37774 37775 2256.94444 +21 37775 37776 1884.92063 +21 37776 37781 1636.90476 +21 37781 37784 2008.92857 +21 37784 37785 1860.11905 +21 37785 37792 1116.07143 +21 37792 37817 372.02381 +21 38948 38981 148.80952 +21 39436 39447 558.03571 +21 41557 41560 248.01587 +21 41560 41576 620.03968 +21 41576 41579 372.02381 +21 41605 41609 1674.10714 +21 41609 41611 2046.13095 +21 41611 41624 2294.14683 +21 41624 41631 1550.09921 +21 41631 41638 1656.39172 +21 41638 41641 912.34410 +21 41641 41643 806.05159 +21 41643 41648 558.03571 +21 41648 41660 186.01190 +21 44046 44056 372.02381 +21 45215 45227 744.04762 +21 45921 45941 248.01587 +21 45941 45946 620.03968 +21 45946 45954 1364.08730 +21 45954 45962 2108.13492 +21 45962 45974 2480.15873 +21 45974 45982 744.04762 +21 45982 45983 1488.09524 +21 45983 45984 1736.11111 +21 45984 45987 3702.52268 +21 45987 45989 4446.57029 +21 45989 45996 5190.61791 +21 45996 45999 5934.66553 +21 45999 46006 6182.68141 +21 46006 46007 6554.70522 +21 46007 46013 6852.32426 +21 46013 46016 7596.37188 +21 46016 46018 10200.53855 +21 46018 46019 11688.63379 +21 46019 46021 11936.64966 +21 46021 46022 12060.65760 +21 46022 46023 13548.75283 +21 46023 46030 14292.80045 +21 46030 46033 16524.94331 +21 46033 46034 16950.11338 +21 46034 46035 17694.16100 +21 46035 46040 19182.25624 +21 46040 46042 18438.20862 +21 46042 46043 19182.25624 +21 46043 46044 19926.30385 +21 46044 46045 20422.33560 +21 46045 46046 21166.38322 +21 46046 46047 22654.47846 +21 46047 46052 23398.52608 +21 46052 46053 22654.47846 +21 46053 46056 23398.52608 +21 46056 46057 20085.74263 +21 46057 46058 19341.69501 +21 46058 46064 18969.67120 +21 46064 46065 17747.30726 +21 46065 46067 17499.29138 +21 46067 46068 18243.33900 +21 46068 46071 17375.28345 +21 46071 46072 17524.09297 +21 46072 46074 15185.65760 +21 46074 46075 14441.60998 +21 46075 46078 13697.56236 +21 46078 46085 12953.51474 +21 46085 46087 13046.52069 +21 46087 46090 12153.66355 +21 46090 46093 11905.64768 +21 46093 46095 11756.83815 +21 46095 46096 11291.80839 +21 46096 46102 10919.78458 +21 46102 46103 11291.80839 +21 46103 46104 11440.61791 +21 46104 46105 9952.52268 +21 46105 46106 10101.33220 +21 46106 46107 8861.25283 +21 46107 46109 7745.18141 +21 46109 46111 7931.19331 +21 46111 46115 7187.14569 +21 46115 46119 7559.16950 +21 46119 46120 6815.12188 +21 46120 46127 6485.61508 +21 46127 46133 5493.55159 +21 46133 46137 5319.94048 +21 46137 46138 4575.89286 +21 46138 46141 3831.84524 +21 46141 46158 3087.79762 +21 46158 46159 2343.75000 +21 46159 46170 1599.70238 +21 46170 46193 1302.08333 +21 46193 46197 930.05952 +21 46197 46200 1674.10714 +21 46200 46203 1488.09524 +21 46203 46217 744.04762 +21 46769 46773 372.02381 +21 46773 46812 1116.07143 +21 46812 46813 372.02381 +21 49251 49259 106.29252 +21 50145 50147 496.03175 +21 50147 50149 868.05556 +21 50149 50152 1054.06746 +21 50152 50153 1798.11508 +21 50153 50158 2542.16270 +21 50158 50167 2914.18651 +21 50167 50170 2232.14286 +21 50170 50180 2480.15873 +21 50180 50185 1922.12302 +21 50185 50187 3286.21032 +21 50187 50189 4030.25794 +21 50189 50191 4242.84297 +21 50191 50192 4986.89059 +21 50192 50193 4242.84297 +21 50193 50195 6358.06406 +21 50195 50200 7102.11168 +21 50200 50203 7846.15930 +21 50203 50205 7739.86678 +21 50205 50207 8271.32937 +21 50207 50210 9573.41270 +21 50210 50213 10019.84127 +21 50213 50214 10243.05556 +21 50214 50215 10391.86508 +21 50215 50217 11135.91270 +21 50217 50221 10639.88095 +21 50221 50222 10267.85714 +21 50222 50231 11011.90476 +21 50231 50234 10799.31973 +21 50234 50236 11121.74036 +21 50236 50237 10625.70862 +21 50237 50239 9881.66100 +21 50239 50240 9757.65306 +21 50240 50243 9608.84354 +21 50243 50244 6793.86338 +21 50244 50245 6049.81576 +21 50245 50249 6421.83957 +21 50249 50256 5491.78005 +21 50256 50257 5119.75624 +21 50257 50259 4871.74036 +21 50259 50269 4623.72449 +21 50269 50273 5243.76417 +21 50273 50278 4832.76644 +21 50278 50279 4088.71882 +21 50279 50284 3344.67120 +21 50284 50289 2600.62358 +21 50289 50296 1160.35998 +21 50296 50299 1054.06746 +21 50299 50305 868.05556 +21 50305 50317 620.03968 +21 50317 50321 868.05556 +21 50321 50334 496.03175 +21 50617 50637 372.02381 +21 50637 50647 744.04762 +21 50647 50650 1488.09524 +21 50650 50657 2232.14286 +21 50657 50661 1488.09524 +21 50661 50670 1860.11905 +21 50670 50698 2604.16667 +21 50698 50706 2232.14286 +21 50706 50715 1488.09524 +21 51181 51220 372.02381 +21 51220 51230 868.05556 +21 51230 51231 1612.10317 +21 51231 51242 1760.91270 +21 51242 51272 2504.96032 +21 51272 51287 2132.93651 +21 51287 51292 1884.92063 +21 51292 51301 1760.91270 +21 51301 51320 1512.89683 +21 51320 51321 1364.08730 +21 51321 51333 744.04762 +21 51810 51811 372.02381 +21 51811 51813 620.03968 +21 51813 51814 868.05556 +21 51814 51816 1612.10317 +21 51816 51817 1984.12698 +21 51817 51828 2356.15079 +21 51828 51829 3348.21429 +21 51829 51830 4092.26190 +21 51830 51837 5059.52381 +21 51837 51842 6051.58730 +21 51842 51846 6795.63492 +21 51846 51847 7539.68254 +21 51847 51848 7787.69841 +21 51848 51851 7341.26984 +21 51851 51852 8457.34127 +21 51852 51853 7564.48413 +21 51853 51854 7936.50794 +21 51854 51855 8042.80045 +21 51855 51856 9185.44501 +21 51856 51859 9557.46882 +21 51859 51861 10301.51644 +21 51861 51862 11045.56406 +21 51862 51863 11789.61168 +21 51863 51866 12037.62755 +21 51866 51868 18468.32483 +21 51868 51869 19584.39626 +21 51869 51870 20328.44388 +21 51870 51872 23145.19558 +21 51872 51873 23517.21939 +21 51873 51874 24261.26701 +21 51874 51875 26847.71825 +21 51875 51877 26186.34259 +21 51877 51878 28046.46164 +21 51878 51885 28790.50926 +21 51885 51888 29410.54894 +21 51888 51889 29162.53307 +21 51889 51891 28418.48545 +21 51891 51892 29162.53307 +21 51892 51894 29348.54497 +21 51894 51896 28604.49735 +21 51896 51898 27860.44974 +21 51898 51899 23847.90722 +21 51899 51902 23165.86357 +21 51902 51903 22421.81595 +21 51903 51904 21677.76833 +21 51904 51905 21429.75246 +21 51905 51906 21677.76833 +21 51906 51907 21057.72865 +21 51907 51912 20685.70484 +21 51912 51915 20287.10790 +21 51915 51916 20163.09996 +21 51916 51917 20552.83919 +21 51917 51920 20180.81538 +21 51920 51922 19994.80348 +21 51922 51925 19002.73998 +21 51925 51928 19188.75189 +21 51928 51930 18444.70427 +21 51930 51931 17700.65665 +21 51931 51933 17576.64872 +21 51933 51934 17204.62491 +21 51934 51935 16956.60903 +21 51935 51936 15255.92876 +21 51936 51938 14511.88114 +21 51938 51941 13457.81368 +21 51941 51943 11969.71844 +21 51943 51946 10853.64701 +21 51946 51947 8515.21164 +21 51947 51948 7771.16402 +21 51948 51954 6407.07672 +21 51954 51957 5166.99735 +21 51957 51960 4794.97354 +21 51960 51964 4050.92593 +21 51964 51966 2934.85450 +21 51966 51968 2480.15873 +21 51968 51969 2108.13492 +21 51969 51970 1364.08730 +21 51970 51980 1116.07143 +21 51980 51981 930.05952 +21 51981 51983 682.04365 +21 51983 51993 496.03175 +21 52014 52034 93.00595 +21 52091 52094 372.02381 +21 52094 52096 1636.90476 +21 52096 52098 1884.92063 +21 52098 52099 2628.96825 +21 52099 52102 3559.02778 +21 52102 52104 4303.07540 +21 52104 52105 5738.02438 +21 52105 52107 5886.83390 +21 52107 52108 6035.64342 +21 52108 52109 7523.73866 +21 52109 52111 8515.80215 +21 52111 52115 8664.61168 +21 52115 52116 9036.63549 +21 52116 52117 8701.81406 +21 52117 52118 9507.86565 +21 52118 52123 10251.91327 +21 52123 52124 10375.92120 +21 52124 52125 11417.58787 +21 52125 52130 12781.67517 +21 52130 52132 14269.77041 +21 52132 52139 13525.72279 +21 52139 52141 13376.91327 +21 52141 52142 13252.90533 +21 52142 52144 13376.91327 +21 52144 52145 13748.93707 +21 52145 52147 14368.97676 +21 52147 52148 14927.01247 +21 52148 52149 15423.04422 +21 52149 52151 20893.56576 +21 52151 52152 21228.38719 +21 52152 52153 22220.45068 +21 52153 52158 22406.46259 +21 52158 52160 23628.82653 +21 52160 52161 24000.85034 +21 52161 52168 11918.93424 +21 52168 52170 11670.91837 +21 52170 52171 11174.88662 +21 52171 52172 11026.07710 +21 52172 52176 10840.06519 +21 52176 52177 10654.05329 +21 52177 52181 10406.03741 +21 52181 52182 10220.02551 +21 52182 52183 10007.44048 +21 52183 52185 10751.48810 +21 52185 52186 10007.44048 +21 52186 52187 9263.39286 +21 52187 52189 9412.20238 +21 52189 52190 8668.15476 +21 52190 52191 8296.13095 +21 52191 52192 8110.11905 +21 52192 52193 9598.21429 +21 52193 52199 7589.28571 +21 52199 52200 6845.23810 +21 52200 52206 6597.22222 +21 52206 52211 5481.15079 +21 52211 52214 6225.19841 +21 52214 52215 5233.13492 +21 52215 52216 5605.15873 +21 52216 52219 4861.11111 +21 52219 52220 3968.25397 +21 52220 52221 3720.23810 +21 52221 52222 4861.11111 +21 52222 52225 5109.12698 +21 52225 52226 5257.93651 +21 52226 52230 5629.96032 +21 52230 52235 6374.00794 +21 52235 52236 5629.96032 +21 52236 52237 4885.91270 +21 52237 52242 5257.93651 +21 52242 52246 5629.96032 +21 52246 52249 6374.00794 +21 52249 52251 6622.02381 +21 52251 52256 5753.96825 +21 52256 52260 5860.26077 +21 52260 52267 6604.30839 +21 52267 52274 5860.26077 +21 52274 52279 6009.07029 +21 52279 52280 5860.26077 +21 52280 52281 6046.27268 +21 52281 52294 5302.22506 +21 52294 52296 6046.27268 +21 52296 52299 6790.32029 +21 52299 52300 6939.12982 +21 52300 52306 7311.15363 +21 52306 52310 6939.12982 +21 52310 52312 6790.32029 +21 52312 52316 6046.27268 +21 52316 52317 5897.46315 +21 52317 52328 5525.43934 +21 52328 52341 2418.15476 +21 52341 52351 1822.91667 +21 52351 52373 1078.86905 +21 52373 52387 930.05952 +21 52387 52391 186.01190 +21 57419 57474 372.02381 +21 60233 60266 744.04762 +21 60266 60272 248.01587 +21 60345 60429 744.04762 +21 60654 60698 248.01587 +21 60708 60763 372.02381 +21 60763 60799 744.04762 +21 60852 60881 372.02381 +21 60881 60910 186.01190 +21 61616 61624 186.01190 +21 62335 62339 186.01190 +21 62339 62340 1798.11508 +21 62340 62344 2914.18651 +21 62344 62353 3658.23413 +21 62353 62354 3906.25000 +21 62354 62356 4278.27381 +21 62356 62359 4526.28968 +21 62359 62360 5518.35317 +21 62360 62361 6262.40079 +21 62361 62363 5890.37698 +21 62363 62366 6262.40079 +21 62366 62368 7378.47222 +21 62368 62370 7484.76474 +21 62370 62371 7732.78061 +21 62371 62383 7484.76474 +21 62383 62385 7856.78855 +21 62385 62387 7980.79649 +21 62387 62390 8228.81236 +21 62390 62394 8476.82823 +21 62394 62396 8352.82029 +21 62396 62398 8724.84410 +21 62398 62402 8972.85998 +21 62402 62403 8786.84807 +21 62403 62405 6802.72109 +21 62405 62407 7546.76871 +21 62407 62408 7918.79252 +21 62408 62412 11337.86848 +21 62412 62414 11709.89229 +21 62414 62418 12453.93991 +21 62418 62419 11709.89229 +21 62419 62420 12639.95181 +21 62420 62422 12887.96769 +21 62422 62424 12515.94388 +21 62424 62425 11771.89626 +21 62425 62426 13259.99150 +21 62426 62428 13153.69898 +21 62428 62431 12409.65136 +21 62431 62432 12037.62755 +21 62432 62440 11665.60374 +21 62440 62444 12409.65136 +21 62444 62445 11665.60374 +21 62445 62447 11293.57993 +21 62447 62448 11045.56406 +21 62448 62453 10673.54025 +21 62453 62456 9557.46882 +21 62456 62459 9929.49263 +21 62459 62461 10460.95522 +21 62461 62462 10212.93934 +21 62462 62467 10956.98696 +21 62467 62471 12073.05839 +21 62471 62473 11080.99490 +21 62473 62474 10708.97109 +21 62474 62479 9858.63095 +21 62479 62485 10584.96315 +21 62485 62487 11329.01077 +21 62487 62491 10956.98696 +21 62491 62493 10584.96315 +21 62493 62495 11329.01077 +21 62495 62496 11577.02664 +21 62496 62501 11329.01077 +21 62501 62502 10956.98696 +21 62502 62504 10708.97109 +21 62504 62506 9964.92347 +21 62506 62507 9716.90760 +21 62507 62511 9530.89569 +21 62511 62512 9530.89569 +21 62512 62514 8910.85601 +21 62514 62522 9654.90363 +21 62522 62526 9406.88776 +21 62526 62532 8662.84014 +21 62532 62535 7918.79252 +21 62535 62542 7174.74490 +21 62542 62543 6802.72109 +21 62543 62550 2976.19048 +21 62550 62551 2232.14286 +21 62551 62556 1488.09524 +21 62837 62838 248.01587 +21 62838 62839 992.06349 +21 62839 62840 1364.08730 +21 62840 62843 1736.11111 +21 62843 62848 2480.15873 +21 62848 62853 3224.20635 +21 62853 62855 3968.25397 +21 62855 62856 4588.29365 +21 62856 62858 13126.24008 +21 62858 62859 13498.26389 +21 62859 62861 13870.28770 +21 62861 62863 14862.35119 +21 62863 62864 15340.66752 +21 62864 62865 15712.69133 +21 62865 62867 16208.72307 +21 62867 62868 17138.78260 +21 62868 62873 17734.02069 +21 62873 62874 18106.04450 +21 62874 62875 18478.06831 +21 62875 62876 19966.16355 +21 62876 62878 20338.18736 +21 62878 62879 22570.33022 +21 62879 62880 25263.07398 +21 62880 62882 26007.12160 +21 62882 62884 26255.13747 +21 62884 62885 26627.16128 +21 62885 62887 28673.29223 +21 62887 62888 28921.30811 +21 62888 62889 29169.32398 +21 62889 62891 29541.34779 +21 62891 62892 30391.68793 +21 62892 62897 31135.73554 +21 62897 62898 31383.75142 +21 62898 62899 27942.53118 +21 62899 62900 27694.51531 +21 62900 62902 28438.56293 +21 62902 62903 29554.63435 +21 62903 62906 28234.83560 +21 62906 62907 28978.88322 +21 62907 62908 29970.94671 +21 62908 62909 30714.99433 +21 62909 62910 31459.04195 +21 62910 62912 32203.08957 +21 62912 62914 32017.07766 +21 62914 62915 32265.09354 +21 62915 62916 33009.14116 +21 62916 62918 33381.16497 +21 62918 62920 34125.21259 +21 62920 62921 33381.16497 +21 62921 62922 33274.87245 +21 62922 62923 32530.82483 +21 62923 62925 32716.83673 +21 62925 62926 31600.76531 +21 62926 62927 30484.69388 +21 62927 62930 29740.64626 +21 62930 62931 29257.01531 +21 62931 62932 28884.99150 +21 62932 62933 29257.01531 +21 62933 62934 28512.96769 +21 62934 62935 28574.97166 +21 62935 62936 25908.80102 +21 62936 62937 25970.80499 +21 62937 62940 26342.82880 +21 62940 62941 26838.86054 +21 62941 62942 26094.81293 +21 62942 62945 26590.84467 +21 62945 62947 25846.79705 +21 62947 62949 25660.78515 +21 62949 62952 25102.74943 +21 62952 62953 24234.69388 +21 62953 62954 24447.27891 +21 62954 62956 23968.96259 +21 62956 62957 23720.94671 +21 62957 62958 23410.92687 +21 62958 62959 22790.88719 +21 62959 62961 22542.87132 +21 62961 62966 22170.84751 +21 62966 62967 21479.94615 +21 62967 62968 17511.69218 +21 62968 62970 15740.15023 +21 62970 62971 14252.05499 +21 62971 62975 13321.99546 +21 62975 62976 6785.00567 +21 62976 62979 5420.91837 +21 62979 62980 4676.87075 +21 62980 62981 3932.82313 +21 62981 62983 4676.87075 +21 62983 62988 4304.84694 +21 62988 62991 4180.83900 +21 62991 62993 4056.83107 +21 62993 62997 3684.80726 +21 62997 62998 2940.75964 +21 62998 62999 2692.74376 +21 62999 63002 1948.69615 +21 63002 63003 1736.11111 +21 63003 63006 1209.07738 +21 63006 63014 1953.12500 +21 63014 63020 1860.11905 +21 63020 63031 2008.92857 +21 63031 63032 1884.92063 +21 63032 63033 2628.96825 +21 63033 63035 3373.01587 +21 63035 63039 3621.03175 +21 63039 63051 5406.74603 +21 63051 63052 6150.79365 +21 63052 63053 5877.97619 +21 63053 63068 6250.00000 +21 63068 63071 6436.01190 +21 63071 63073 4575.89286 +21 63073 63077 3831.84524 +21 63077 63079 3087.79762 +21 63079 63089 2343.75000 +21 63089 63112 1822.91667 +21 63112 63113 1078.86905 +21 63113 63131 930.05952 +21 63131 63136 744.04762 +21 63519 63529 744.04762 +21 63976 63984 558.03571 +21 70296 70306 248.01587 +21 70631 70639 186.01190 +21 72917 72927 496.03175 +21 74366 74378 93.00595 +21 74425 74432 744.04762 +21 74432 74433 1488.09524 +21 74433 74441 2338.43537 +21 74441 74445 2586.45125 +21 74445 74448 2799.03628 +21 74448 74451 3096.65533 +21 74451 74453 2352.60771 +21 74453 74454 3468.67914 +21 74454 74456 4026.71485 +21 74456 74457 4646.75454 +21 74457 74459 5018.77834 +21 74459 74460 6134.84977 +21 74460 74464 6878.89739 +21 74464 74474 7250.92120 +21 74474 74476 7754.03912 +21 74476 74484 8126.06293 +21 74484 74487 8002.05499 +21 74487 74495 7258.00737 +21 74495 74500 6513.95975 +21 74500 74505 5769.91213 +21 74505 74509 3183.46088 +21 74509 74525 1364.08730 +21 74525 74541 558.03571 +21 74541 74544 1302.08333 +21 74544 74550 1116.07143 +21 74550 74555 1302.08333 +21 74555 74561 930.05952 +21 74561 74568 186.01190 +21 74574 74583 744.04762 +21 74583 74613 892.85714 +21 74613 74636 148.80952 +21 75501 75509 372.02381 +21 75664 75679 248.01587 +21 75679 75734 372.02381 +21 75734 75753 248.01587 +21 76053 76062 744.04762 +21 76338 76341 372.02381 +21 76341 76345 558.03571 +21 76345 76354 930.05952 +21 76354 76377 372.02381 +21 80496 80498 248.01587 +21 80498 80507 992.06349 +21 80507 80522 744.04762 +21 80648 80675 148.80952 +21 81280 81283 744.04762 +21 81283 81284 1488.09524 +21 81284 81286 3087.79762 +21 81286 81289 3831.84524 +21 81289 81290 5319.94048 +21 81290 81294 5691.96429 +21 81294 81295 6777.03373 +21 81295 81297 7999.39768 +21 81297 81301 8371.42149 +21 81301 81304 9115.46910 +21 81304 81306 9859.51672 +21 81306 81318 9022.46315 +21 81318 81323 9208.47506 +21 81323 81329 9580.49887 +21 81329 81340 10083.61678 +21 81340 81341 9339.56916 +21 81341 81342 10083.61678 +21 81342 81345 10331.63265 +21 81345 81348 10703.65646 +21 81348 81350 10176.62273 +21 81350 81353 10325.43226 +21 81353 81354 11204.11706 +21 81354 81356 11576.14087 +21 81356 81360 10832.09325 +21 81360 81362 11576.14087 +21 81362 81366 10914.76521 +21 81366 81367 11658.81283 +21 81367 81368 11584.40807 +21 81368 81372 11398.39616 +21 81372 81373 11249.58664 +21 81373 81376 9017.44378 +21 81376 81378 8273.39616 +21 81378 81380 7529.34854 +21 81380 81381 6785.30093 +21 81381 81384 6413.27712 +21 81384 81385 5669.22950 +21 81385 81388 5204.19974 +21 81388 81390 5948.24735 +21 81390 81391 6692.29497 +21 81391 81392 6394.67593 +21 81392 81394 5650.62831 +21 81394 81395 5278.60450 +21 81395 81400 4906.58069 +21 81400 81401 4162.53307 +21 81401 81402 5092.59259 +21 81402 81404 5198.88511 +21 81404 81405 6190.94860 +21 81405 81412 6934.99622 +21 81412 81414 7389.69199 +21 81414 81415 7761.71580 +21 81415 81417 7389.69199 +21 81417 81425 6620.84278 +21 81425 81431 6538.17082 +21 81431 81435 6352.15892 +21 81435 81436 5980.13511 +21 81436 81437 5831.32559 +21 81437 81438 4384.56633 +21 81438 81441 4198.55442 +21 81441 81451 2604.16667 +21 81451 81456 2418.15476 +21 81456 81464 2232.14286 +21 81464 81465 2480.15873 +21 81465 81470 1736.11111 +21 81470 81471 992.06349 +21 81471 81476 1736.11111 +21 81476 81482 992.06349 +21 81482 81491 248.01587 +21 81491 81502 434.02778 +21 81502 81537 582.83730 +21 81537 81539 434.02778 +21 81703 81710 372.02381 +21 82799 82809 248.01587 +21 84749 84759 1488.09524 +21 85524 85538 744.04762 +21 87960 87973 186.01190 +21 87973 87984 292.30442 +21 87984 88002 1036.35204 +21 88002 88003 1408.37585 +21 88003 88016 2152.42347 +21 88016 88018 2896.47109 +21 88018 88019 3392.50283 +21 88019 88021 3888.53458 +21 88021 88024 4260.55839 +21 88024 88026 4508.57426 +21 88026 88027 5438.63379 +21 88027 88028 6182.68141 +21 88028 88031 6951.53061 +21 88031 88032 24198.37727 +21 88032 88034 24570.40108 +21 88034 88035 24818.41695 +21 88035 88038 25916.77296 +21 88038 88040 28148.91582 +21 88040 88041 27859.56396 +21 88041 88043 28045.57587 +21 88043 88044 30071.03883 +21 88044 88045 30815.08645 +21 88045 88046 30740.68169 +21 88046 88047 29624.61026 +21 88047 88050 30368.65788 +21 88050 88053 30988.69756 +21 88053 88054 31732.74518 +21 88054 88055 31360.72137 +21 88055 88059 32104.76899 +21 88059 88060 31732.74518 +21 88060 88063 32476.79280 +21 88063 88064 29035.57256 +21 88064 88067 28362.38662 +21 88067 88068 27618.33900 +21 88068 88069 26874.29138 +21 88069 88070 25832.62472 +21 88070 88072 26576.67234 +21 88072 88073 25683.81519 +21 88073 88075 24939.76757 +21 88075 88077 24753.75567 +21 88077 88078 24461.45125 +21 88078 88080 23035.35998 +21 88080 88082 21430.34297 +21 88082 88083 21324.05045 +21 88083 88084 20580.00283 +21 88084 88085 20580.00283 +21 88085 88086 20158.37585 +21 88086 88090 19910.35998 +21 88090 88091 19042.30442 +21 88091 88093 19538.33617 +21 88093 88094 19166.31236 +21 88094 88095 18087.44331 +21 88095 88096 16946.57029 +21 88096 88098 16388.53458 +21 88098 88099 16016.51077 +21 88099 88100 15272.46315 +21 88100 88102 14528.41553 +21 88102 88103 13784.36791 +21 88103 88104 9931.85469 +21 88104 88107 9187.80707 +21 88107 88108 9001.79516 +21 88108 88109 8505.76342 +21 88109 88110 7761.71580 +21 88110 88112 7307.02003 +21 88112 88113 8051.06765 +21 88113 88114 7617.03987 +21 88114 88115 7096.20654 +21 88115 88119 10789.28099 +21 88119 88121 16286.37566 +21 88121 88125 17030.42328 +21 88125 88129 16286.37566 +21 88129 88131 15542.32804 +21 88131 88132 15004.96032 +21 88132 88133 15097.96627 +21 88133 88135 13857.88690 +21 88135 88139 13237.84722 +21 88139 88140 13131.55471 +21 88140 88142 12982.74518 +21 88142 88147 12677.15420 +21 88147 88149 12429.13832 +21 88149 88150 12280.32880 +21 88150 88151 11908.30499 +21 88151 88152 11660.28912 +21 88152 88154 11474.27721 +21 88154 88155 10358.20578 +21 88155 88159 9738.16610 +21 88159 88167 8498.08673 +21 88167 88170 7576.88492 +21 88170 88171 5642.36111 +21 88171 88174 4154.26587 +21 88174 88176 4092.26190 +21 88176 88178 5022.32143 +21 88178 88179 4774.30556 +21 88179 88180 4030.25794 +21 88180 88183 5208.33333 +21 88183 88198 4464.28571 +21 88198 88200 4278.27381 +21 88200 88210 3534.22619 +21 88210 88215 2790.17857 +21 88215 88217 1302.08333 +21 88217 88229 1116.07143 +21 88229 88244 1302.08333 +21 88244 88246 744.04762 +21 88247 88264 744.04762 +21 89111 89119 744.04762 +21 91494 91495 744.04762 +21 91495 91506 2976.19048 +21 91506 91511 3348.21429 +21 91511 91515 3596.23016 +21 91515 91517 3844.24603 +21 91517 91535 1984.12698 +21 91535 91536 2728.17460 +21 91536 91537 3472.22222 +21 91537 91540 3844.24603 +21 91540 91550 3950.53855 +21 91550 91564 4074.54649 +21 91564 91573 2306.54762 +21 91573 91575 2389.21958 +21 91575 91578 1645.17196 +21 91578 91596 1570.76720 +21 91651 91656 930.05952 +21 91656 91657 1674.10714 +21 91657 91658 2046.13095 +21 91658 91659 2790.17857 +21 91659 91667 4278.27381 +21 91667 91669 4092.26190 +21 91669 91676 2604.16667 +21 91676 91677 1860.11905 +21 91677 91691 3335.81349 +21 91691 91702 3149.80159 +21 91702 91703 2405.75397 +21 91703 91705 2033.73016 +21 91705 91708 1736.11111 +21 91708 91710 992.06349 +21 91710 91717 248.01587 +21 91802 91818 744.04762 +21 91818 91830 372.02381 +21 93477 93485 186.01190 +21 93544 93553 744.04762 +21 94124 94136 248.01587 +21 97934 97948 744.04762 +21 97948 97965 1488.09524 +21 97965 97974 2232.14286 +21 97974 97975 1488.09524 +21 97975 97979 744.04762 +21 97979 98036 1488.09524 +21 98036 98045 744.04762 +21 98045 98060 372.02381 +21 98159 98178 186.01190 +21 98405 98419 372.02381 +21 98605 98618 186.01190 +21 98640 98647 372.02381 +21 98647 98650 1794.57200 +21 98650 98653 2042.58787 +21 98653 98665 2148.88039 +21 98665 98678 1123.15760 +21 98678 98680 1495.18141 +21 98680 98690 2239.22902 +21 98690 98700 2983.27664 +21 98700 98715 3975.34014 +21 98715 98720 4719.38776 +21 98720 98721 4322.56236 +21 98721 98729 4694.58617 +21 98729 98737 4322.56236 +21 98737 98739 5208.33333 +21 98739 98743 4960.31746 +21 98743 98745 4216.26984 +21 98745 98746 3472.22222 +21 98746 98749 3100.19841 +21 98749 98753 2852.18254 +21 98753 98758 620.03968 +21 98758 98759 248.01587 +21 98766 98781 148.80952 +21 98781 98813 595.23810 +21 99712 99720 744.04762 +21 100151 100164 744.04762 +21 100217 100220 744.04762 +21 100220 100249 1488.09524 +21 100249 100259 744.04762 +21 102432 102445 82.67196 +21 102472 102485 82.67196 +21 102512 102525 82.67196 +21 102552 102565 82.67196 +21 102592 102605 82.67196 +21 102632 102645 82.67196 +21 102672 102685 82.67196 +21 102789 102802 82.67196 +21 104015 104017 93.00595 +21 104017 104024 279.01786 +21 104024 104027 186.01190 +21 106012 106022 186.01190 +21 107821 107831 372.02381 +21 108114 108125 744.04762 +21 108125 108126 1116.07143 +21 108126 108138 1488.09524 +21 108138 108147 1984.12698 +21 108147 108150 1612.10317 +21 108150 108157 1240.07937 +21 108157 108178 868.05556 +21 108178 108183 3224.20635 +21 108183 108188 2728.17460 +21 108188 108192 3472.22222 +21 108192 108203 3658.23413 +21 108203 108220 2914.18651 +21 108220 108222 2542.16270 +21 108255 108257 186.01190 +21 108257 108258 334.82143 +21 108258 108263 582.83730 +21 108263 108265 875.14172 +21 108265 108266 1061.15363 +21 108266 108267 1433.17744 +21 108267 108280 6072.84580 +21 108280 108281 6165.85176 +21 108281 108283 6314.66128 +21 108283 108287 6066.64541 +21 108287 108290 5960.35289 +21 108290 108292 5654.76190 +21 108292 108295 4724.70238 +21 108295 108297 4476.68651 +21 108297 108298 4327.87698 +21 108298 108300 3955.85317 +21 108300 108302 3769.84127 +21 108302 108303 3397.81746 +21 108303 108305 2777.77778 +21 108305 108322 2033.73016 +21 108322 108328 1289.68254 +21 108328 108332 768.84921 +21 108332 108346 620.03968 +21 108346 108347 248.01587 +21 108436 108445 372.02381 +21 108933 108945 744.04762 +21 110220 110239 744.04762 +21 112389 112390 744.04762 +21 112390 112395 1488.09524 +21 112395 112411 2232.14286 +21 112411 112442 744.04762 +21 115071 115082 248.01587 +21 115818 115827 744.04762 +21 115827 115828 1860.11905 +21 115828 115829 2108.13492 +21 115829 115830 2480.15873 +21 115830 115831 2728.17460 +21 115831 115832 3472.22222 +21 115832 115834 4216.26984 +21 115834 115836 4836.30952 +21 115836 115839 5022.32143 +21 115839 115850 4650.29762 +21 115850 115851 4278.27381 +21 115851 115855 5022.32143 +21 115855 115864 5766.36905 +21 115864 115866 6138.39286 +21 115866 115869 6386.40873 +21 115869 115871 7130.45635 +21 115871 115875 7378.47222 +21 115875 115880 7591.05726 +21 115880 115881 6847.00964 +21 115881 115882 9227.96202 +21 115882 115886 9475.97789 +21 115886 115894 14514.24320 +21 115894 115895 13770.19558 +21 115895 115896 14514.24320 +21 115896 115900 14142.21939 +21 115900 115901 13770.19558 +21 115901 115903 13398.17177 +21 115903 115904 12654.12415 +21 115904 115913 12547.83163 +21 115913 115918 12250.21259 +21 115918 115919 6253.54308 +21 115919 115921 4517.43197 +21 115921 115922 3525.36848 +21 115922 115923 3153.34467 +21 115923 115924 2781.32086 +21 115924 115925 2037.27324 +21 115925 115945 425.17007 +21 115945 115949 1169.21769 +21 115949 115955 850.34014 +21 115955 115966 1594.38776 +21 115966 115971 1488.09524 +21 115971 115979 744.04762 +21 115979 115984 1116.07143 +21 115984 115986 372.02381 +21 115986 115990 496.03175 +21 115990 116014 644.84127 +21 116014 116022 520.83333 +21 116022 116025 768.84921 +21 116025 116033 620.03968 +21 116033 116035 372.02381 +21 116035 116051 1116.07143 +21 116051 116060 1364.08730 +21 116060 116070 372.02381 +21 116552 116569 93.00595 +21 117319 117351 124.00794 +21 117416 117421 496.03175 +21 117421 117454 744.04762 +21 117454 117455 248.01587 +21 117455 117464 744.04762 +21 117464 117512 248.01587 +21 117684 117699 372.02381 +21 117722 117732 744.04762 +21 120455 120464 1488.09524 +21 120464 120465 744.04762 +21 120465 120466 372.02381 +21 120487 120492 1116.07143 +21 120492 120500 2901.78571 +21 120500 120501 3149.80159 +21 120501 120502 3335.81349 +21 120502 120504 3707.83730 +21 120504 120506 4079.86111 +21 120506 120516 3931.05159 +21 120516 120534 3187.00397 +21 120534 120538 2814.98016 +21 120538 120545 21264.99906 +21 120545 120556 21885.03874 +21 120556 120557 21761.03080 +21 120557 120558 21264.99906 +21 120558 120559 22009.04667 +21 120559 120560 21016.98318 +21 120560 120561 20272.93556 +21 120561 120562 18760.03874 +21 120562 120563 18264.00699 +21 120563 120567 16478.29271 +21 120567 120568 15734.24509 +21 120568 120569 14990.19747 +21 120569 120570 14618.17366 +21 120570 120571 12758.05461 +21 120571 120573 12014.00699 +21 120573 120574 11517.97525 +21 120574 120575 10153.88794 +21 120575 120577 8293.76890 +21 120577 120578 7549.72128 +21 120578 120579 6619.66175 +21 120579 120586 4883.55064 +21 120586 120587 4298.94180 +21 120587 120588 3926.91799 +21 120588 120589 2934.85450 +21 120589 120598 2562.83069 +21 120598 120599 1818.78307 +21 120599 120604 1570.76720 +21 120604 120606 2314.81481 +21 120606 120607 2232.14286 +21 120607 120610 2325.14881 +21 120610 120617 3069.19643 +21 120617 120629 2976.19048 +21 120629 120642 2232.14286 +21 120642 120646 1488.09524 +21 120646 120685 744.04762 +21 120685 120694 372.02381 +21 120920 120932 744.04762 +21 123224 123235 248.01587 +21 125923 125937 744.04762 +21 125938 125954 372.02381 +21 126005 126006 744.04762 +21 126006 126011 2232.14286 +21 126011 126019 2418.15476 +21 126019 126035 2790.17857 +21 126035 126050 2046.13095 +21 126050 126052 1674.10714 +21 126052 126072 744.04762 +21 129416 129428 744.04762 +21 130897 130902 744.04762 +21 131772 131780 744.04762 +21 131780 131782 930.05952 +21 131782 131793 1054.06746 +21 131833 131839 372.02381 +21 131839 131846 620.03968 +21 131846 131854 372.02381 +21 133516 133526 106.29252 +21 134977 134987 372.02381 +21 136801 136805 372.02381 +21 136805 136816 744.04762 +21 136816 136827 1054.06746 +21 136846 136905 248.01587 +21 136938 136949 372.02381 +21 136949 136950 1966.41156 +21 136950 136952 2338.43537 +21 136952 136968 3082.48299 +21 136968 136978 4198.55442 +21 136978 136990 3454.50680 +21 136990 136991 3702.52268 +21 136991 136996 4446.57029 +21 136996 136999 5624.64569 +21 136999 137004 5872.66156 +21 137004 137005 6120.67744 +21 137005 137010 6306.68934 +21 137010 137012 8104.80442 +21 137012 137013 8476.82823 +21 137013 137019 7006.44841 +21 137019 137020 6262.40079 +21 137020 137028 5518.35317 +21 137028 137030 4278.27381 +21 137030 137032 3534.22619 +21 137032 137035 2790.17857 +21 137035 137039 1674.10714 +21 137039 137041 2418.15476 +21 137041 137052 2666.17063 +21 137052 137057 3224.20635 +21 137057 137058 2976.19048 +21 137058 137064 2604.16667 +21 137064 137072 2976.19048 +21 137072 137073 3906.25000 +21 137073 137074 3988.92196 +21 137074 137078 3244.87434 +21 137078 137082 2500.82672 +21 137082 137086 3244.87434 +21 137086 137088 2790.17857 +21 137088 137103 2604.16667 +21 137103 137109 2232.14286 +21 137109 137110 1860.11905 +21 137110 137112 1674.10714 +21 137112 137131 1488.09524 +21 137131 137141 2232.14286 +21 137141 137142 1488.09524 +21 137142 137157 744.04762 +21 137186 137205 186.01190 +21 137226 137249 744.04762 +21 137255 137268 744.04762 +21 137268 137276 3224.20635 +21 137276 137277 3330.49887 +21 137277 137279 2958.47506 +21 137279 137286 3206.49093 +21 137286 137290 3100.19841 +21 137290 137291 2728.17460 +21 137291 137307 1984.12698 +21 137307 137317 2728.17460 +21 137317 137319 3472.22222 +21 137319 137325 3100.19841 +21 137325 137326 2852.18254 +21 137326 137327 2480.15873 +21 137327 137332 3224.20635 +21 137332 137336 2480.15873 +21 137336 137345 1736.11111 +21 137345 137368 1488.09524 +21 137368 137387 2232.14286 +21 137387 137407 1488.09524 +21 137407 137424 744.04762 +21 138069 138077 620.03968 +21 138360 138361 248.01587 +21 138361 138362 434.02778 +21 138362 138367 1798.11508 +21 138367 138370 2170.13889 +21 138370 138373 2542.16270 +21 138373 138376 4885.91270 +21 138376 138379 5381.94444 +21 138379 138382 6125.99206 +21 138382 138384 6684.02778 +21 138384 138386 13752.48016 +21 138386 138387 14868.55159 +21 138387 138392 15612.59921 +21 138392 138394 16356.64683 +21 138394 138399 16108.63095 +21 138399 138403 16666.66667 +21 138403 138410 17410.71429 +21 138410 138413 17782.73810 +21 138413 138414 17906.74603 +21 138414 138417 17162.69841 +21 138417 138424 16418.65079 +21 138424 138426 17162.69841 +21 138426 138427 9660.21825 +21 138427 138430 9412.20238 +21 138430 138431 8978.17460 +21 138431 138434 7031.25000 +21 138434 138440 6659.22619 +21 138440 138441 6473.21429 +21 138441 138442 4985.11905 +21 138442 138446 3683.03571 +21 138446 138453 3311.01190 +21 138453 138457 3162.20238 +21 138457 138458 2418.15476 +21 138458 138460 2108.13492 +21 138460 138461 1364.08730 +21 138466 138475 372.02381 +21 138475 138481 744.04762 +21 138481 138482 992.06349 +21 138482 138483 1558.95692 +21 138483 138488 1930.98073 +21 138488 138500 2178.99660 +21 138500 138505 1930.98073 +21 138505 138512 1310.94104 +21 138512 138516 318.87755 +21 138516 138517 467.68707 +21 138517 138531 1211.73469 +21 138531 138539 892.85714 +21 138539 138540 148.80952 +21 138554 138559 186.01190 +21 138559 138573 930.05952 +21 138573 138580 1922.12302 +21 138580 138582 930.05952 +21 138582 138585 1116.07143 +21 138585 138586 372.02381 +21 138586 138604 620.03968 +21 138604 138605 434.02778 +21 138605 138623 186.01190 +21 139076 139083 165.34392 +21 139652 139673 744.04762 +21 142174 142183 744.04762 +21 143450 143455 248.01587 +21 143455 143491 496.03175 +21 143522 143526 5704.36508 +21 143526 143528 6076.38889 +21 143528 143535 6324.40476 +21 143535 143546 6643.28231 +21 143546 143552 7387.32993 +21 143552 143555 7201.31803 +21 143555 143557 6457.27041 +21 143557 143559 6085.24660 +21 143559 143563 5713.22279 +21 143563 143565 5341.19898 +21 143565 143567 4969.17517 +21 143567 143578 3295.06803 +21 143578 143579 2976.19048 +21 143579 143584 2480.15873 +21 143584 143595 1736.11111 +21 143595 143607 992.06349 +21 143607 143616 1240.07937 +21 143616 143619 992.06349 +21 143619 143635 744.04762 +21 143647 143655 744.04762 +21 143655 143656 2697.17262 +21 143656 143657 3441.22024 +21 143657 143658 3720.23810 +21 143658 143659 4650.29762 +21 143659 143676 4836.30952 +21 143676 143681 4464.28571 +21 143681 143682 3689.23611 +21 143682 143683 2418.15476 +21 143683 143684 1488.09524 +21 145930 145939 372.02381 +21 146262 146270 744.04762 +21 149299 149331 248.01587 +21 149429 149443 620.03968 +21 149443 149453 248.01587 +21 152398 152401 744.04762 +21 152401 152402 1842.40363 +21 152402 152405 1991.21315 +21 152405 152406 2363.23696 +21 152406 152409 3851.33220 +21 152409 152410 4223.35601 +21 152410 152411 6331.49093 +21 152411 152412 7447.56236 +21 152412 152414 9307.68141 +21 152414 152415 10423.75283 +21 152415 152416 10609.76474 +21 152416 152418 10981.78855 +21 152418 152420 12841.90760 +21 152420 152421 13362.74093 +21 152421 152422 14106.78855 +21 152422 152423 14354.80442 +21 152423 152425 14726.82823 +21 152425 152427 15470.87585 +21 152427 152429 15842.89966 +21 152429 152430 16586.94728 +21 152430 152434 16834.96315 +21 152434 152438 16983.77268 +21 152438 152440 17727.82029 +21 152440 152442 18719.88379 +21 152442 152443 19463.93141 +21 152443 152446 19835.95522 +21 152446 152451 21014.03061 +21 152451 152452 21758.07823 +21 152452 152454 21968.89172 +21 152454 152455 22712.93934 +21 152455 152459 25937.14569 +21 152459 152460 26929.20918 +21 152460 152464 29037.34410 +21 152464 152465 29781.39172 +21 152465 152467 35398.95125 +21 152467 152468 37655.89569 +21 152468 152470 38399.94331 +21 152470 152474 50373.79535 +21 152474 152475 50621.81122 +21 152475 152479 51365.85884 +21 152479 152480 51551.87075 +21 152480 152481 50931.83107 +21 152481 152482 50435.79932 +21 152482 152483 49877.76361 +21 152483 152484 49505.73980 +21 152484 152486 49208.12075 +21 152486 152488 48836.09694 +21 152488 152489 47241.70918 +21 152489 152490 46497.66156 +21 152490 152491 47489.72506 +21 152491 152492 46559.66553 +21 152492 152494 42045.77664 +21 152494 152497 41673.75283 +21 152497 152498 40929.70522 +21 152498 152499 40681.68934 +21 152499 152501 41425.73696 +21 152501 152502 39379.60601 +21 152502 152503 37891.51077 +21 152503 152505 37519.48696 +21 152505 152506 38263.53458 +21 152506 152507 36527.42347 +21 152507 152508 36155.39966 +21 152508 152509 34419.28855 +21 152509 152510 34481.29252 +21 152510 152511 33737.24490 +21 152511 152512 32993.19728 +21 152512 152513 31381.09410 +21 152513 152514 31753.11791 +21 152514 152516 30637.04649 +21 152516 152518 28590.91553 +21 152518 152519 27846.86791 +21 152519 152520 26978.81236 +21 152520 152521 26482.78061 +21 152521 152524 25260.41667 +21 152524 152525 24838.78968 +21 152525 152526 24045.13889 +21 152526 152529 23797.12302 +21 152529 152531 23507.77116 +21 152531 152533 22763.72354 +21 152533 152534 21089.61640 +21 152534 152535 17679.39815 +21 152535 152537 17307.37434 +21 152537 152538 15013.22751 +21 152538 152539 14269.17989 +21 152539 152540 12037.03704 +21 152540 152542 10796.95767 +21 152542 152543 6882.44048 +21 152543 152544 5146.32937 +21 152544 152551 4774.30556 +21 152551 152552 4030.25794 +21 152552 152554 3782.24206 +21 152554 152561 3906.25000 +21 152561 152565 3162.20238 +21 152565 152568 2914.18651 +21 152568 152570 2170.13889 +21 152570 152575 868.05556 +21 152575 152576 496.03175 +21 152576 152578 248.01587 +21 152612 152618 744.04762 +21 152618 152623 2232.14286 +21 152623 152627 1488.09524 +21 152627 152641 744.04762 +21 152785 152795 744.04762 +21 206440 206477 372.02381 +21 206493 206505 744.04762 +21 206505 206513 1488.09524 +21 206513 206520 744.04762 +21 206520 206521 1488.09524 +21 206521 206526 4898.31349 +21 206526 206529 5642.36111 +21 206529 206535 4898.31349 +21 206535 206539 4712.30159 +21 206539 206540 3968.25397 +21 206540 206543 3596.23016 +21 206543 206548 3224.20635 +21 206548 206550 2976.19048 +21 206550 206556 2232.14286 +21 206556 206558 1488.09524 +21 206558 206576 744.04762 +21 209464 209485 744.04762 +21 211621 211632 595.23810 +21 211799 211810 744.04762 +21 214550 214561 1116.07143 +21 214734 214744 372.02381 +21 219086 219088 106.29252 +21 219088 219107 602.32426 +21 219215 219228 744.04762 +21 219228 219241 1488.09524 +21 219241 219247 1860.11905 +21 219247 219259 2232.14286 +21 219259 219261 1860.11905 +21 219261 219266 1116.07143 +21 221718 221720 93.00595 +21 221720 221726 651.04167 +21 221726 221748 948.66071 +21 221748 221752 2064.73214 +21 221752 221753 2147.40410 +21 221753 221756 2891.45172 +21 221756 221773 3449.48743 +21 221773 221783 4193.53505 +21 221783 221784 3337.88029 +21 221784 221789 2686.83862 +21 221789 221792 3058.86243 +21 221792 221793 3802.91005 +21 221793 221796 4918.98148 +21 221796 221799 5067.79101 +21 221799 221801 5811.83862 +21 221801 221811 6741.89815 +21 221811 221813 5997.85053 +21 221813 221815 5811.83862 +21 221815 221816 5439.81481 +21 221816 221818 4695.76720 +21 221818 221824 3951.71958 +21 221824 221827 4613.09524 +21 221827 221840 4241.07143 +21 221840 221843 3497.02381 +21 221843 221844 3249.00794 +21 221844 221847 2504.96032 +21 221847 221860 2653.76984 +21 221860 221862 2281.74603 +21 221862 221868 1537.69841 +21 221868 221871 2281.74603 +21 221871 221879 2157.73810 +21 221879 221882 2405.75397 +21 221882 221884 2256.94444 +21 221884 221886 1884.92063 +21 221886 221887 1636.90476 +21 221887 221890 1488.09524 +21 221890 221892 744.04762 +21 221892 221915 892.85714 +21 221915 221927 1078.86905 +21 221927 221934 930.05952 +21 221934 221955 744.04762 +21 228850 228857 272.81746 +21 228857 228858 124.00794 +21 234205 234220 744.04762 +21 243027 243038 148.80952 +21 244704 244712 744.04762 +21 246178 246193 744.04762 +21 246281 246300 148.80952 +21 246300 246321 520.83333 +21 246321 246336 148.80952 +21 246344 246360 297.61905 +21 246363 246378 248.01587 +21 248926 249007 744.04762 +21 251511 251516 2232.14286 +21 251516 251524 3295.06803 +21 251524 251531 3613.94558 +21 251531 251535 2869.89796 +21 251535 251540 3241.92177 +21 251540 251548 2869.89796 +21 251548 251550 2232.14286 +21 251550 251557 1860.11905 +21 251557 251568 1116.07143 +21 251568 251583 372.02381 +21 252531 252540 372.02381 +21 256405 256421 372.02381 +21 256421 256426 744.04762 +21 256426 256496 1116.07143 +21 256496 256512 744.04762 +21 256512 256517 372.02381 +21 256584 256591 372.02381 +21 256591 256675 744.04762 +21 256675 256682 372.02381 +21 258364 258374 744.04762 +21 284513 284522 248.01587 +21 289413 289422 744.04762 +21 289422 289423 1562.50000 +21 289423 289424 1934.52381 +21 289424 289425 6295.46958 +21 289425 289426 9643.68386 +21 289426 289428 10387.73148 +21 289428 289429 11379.79497 +21 289429 289431 11486.08749 +21 289431 289435 11858.11130 +21 289435 289436 12230.13511 +21 289436 289438 12602.15892 +21 289438 289446 13532.21844 +21 289446 289448 15268.32955 +21 289448 289450 16012.37717 +21 289450 289451 16384.40098 +21 289451 289452 16756.42479 +21 289452 289453 17128.44860 +21 289453 289455 17996.50416 +21 289455 289457 18368.52797 +21 289457 289458 19385.39305 +21 289458 289463 19633.40892 +21 289463 289464 19726.41487 +21 289464 289465 21214.51011 +21 289465 289468 22851.41487 +21 289468 289469 23099.43074 +21 289469 289470 25145.56170 +21 289470 289471 25021.55376 +21 289471 289472 25145.56170 +21 289472 289474 25889.60932 +21 289474 289475 27253.69662 +21 289475 289477 29299.82757 +21 289477 289478 30229.88709 +21 289478 289479 31159.94662 +21 289479 289481 30415.89900 +21 289481 289483 30564.70852 +21 289483 289485 31308.75614 +21 289485 289488 31556.77201 +21 289488 289489 32548.83551 +21 289489 289490 32362.82360 +21 289490 289491 32796.85138 +21 289491 289492 41741.36669 +21 289492 289497 40997.31907 +21 289497 289499 40253.27145 +21 289499 289501 41431.34684 +21 289501 289502 40687.29923 +21 289502 289503 40108.59552 +21 289503 289504 39364.54790 +21 289504 289505 39736.57171 +21 289505 289506 39662.16695 +21 289506 289508 39414.15108 +21 289508 289509 38670.10346 +21 289509 289510 37607.17829 +21 289510 289512 37235.15448 +21 289512 289514 37022.56944 +21 289514 289516 35906.49802 +21 289516 289517 32930.30754 +21 289517 289519 32186.25992 +21 289519 289520 30946.18056 +21 289520 289522 30450.14881 +21 289522 289523 30636.16071 +21 289523 289524 31008.18452 +21 289524 289525 31752.23214 +21 289525 289526 32496.27976 +21 289526 289528 31008.18452 +21 289528 289529 30636.16071 +21 289529 289530 30884.17659 +21 289530 289532 32044.53656 +21 289532 289533 32230.54847 +21 289533 289535 33253.61395 +21 289535 289536 33005.59807 +21 289536 289537 31517.50283 +21 289537 289541 30525.43934 +21 289541 289543 29781.39172 +21 289543 289544 29533.37585 +21 289544 289545 28541.31236 +21 289545 289546 28690.12188 +21 289546 289548 27202.02664 +21 289548 289549 25999.14966 +21 289549 289550 25751.13379 +21 289550 289551 28962.93934 +21 289551 289554 28218.89172 +21 289554 289555 27065.61791 +21 289555 289556 23965.41950 +21 289556 289559 21150.43934 +21 289559 289560 20654.40760 +21 289560 289562 18546.27268 +21 289562 289563 17616.21315 +21 289563 289564 18360.26077 +21 289564 289565 17616.21315 +21 289565 289566 15818.09807 +21 289566 289567 15074.05045 +21 289567 289569 14081.98696 +21 289569 289571 13709.96315 +21 289571 289572 13089.92347 +21 289572 289573 12048.25680 +21 289573 289574 11676.23299 +21 289574 289576 11490.22109 +21 289576 289577 10746.17347 +21 289577 289578 9816.11395 +21 289578 289581 9444.09014 +21 289581 289587 9196.07426 +21 289587 289588 8452.02664 +21 289588 289590 8824.05045 +21 289590 289591 8576.03458 +21 289591 289592 8427.22506 +21 289592 289595 9047.26474 +21 289595 289597 8675.24093 +21 289597 289598 8303.21712 +21 289598 289600 8196.92460 +21 289600 289608 8568.94841 +21 289608 289611 8420.13889 +21 289611 289614 8234.12698 +21 289614 289615 6870.03968 +21 289615 289617 6684.02778 +21 289617 289619 6498.01587 +21 289619 289620 6125.99206 +21 289620 289621 5877.97619 +21 289621 289622 5195.93254 +21 289622 289624 4823.90873 +21 289624 289625 4079.86111 +21 289625 289630 4823.90873 +21 289630 289633 4451.88492 +21 289633 289634 4079.86111 +21 289634 289639 3931.05159 +21 289639 289640 3745.03968 +21 289640 289641 3000.99206 +21 289641 289645 2256.94444 +21 289645 289654 2108.13492 +21 289654 289657 1364.08730 +21 289657 289662 1736.11111 +21 289662 289669 1364.08730 +21 289669 289671 1116.07143 +21 289671 289685 744.04762 +21 289685 289701 3484.62302 +21 289701 289709 3236.60714 +21 289709 289711 2790.17857 +21 289711 289712 3534.22619 +21 289712 289716 13950.89286 +21 289716 289727 13206.84524 +21 289727 289732 13020.83333 +21 289732 289735 12276.78571 +21 289735 289740 11904.76190 +21 289740 289757 11160.71429 +21 289757 289758 10044.64286 +21 290258 290269 106.29252 +21 293509 293520 106.29252 +21 309907 309915 248.01587 +21 312715 312725 248.01587 +21 313334 313344 248.01587 +21 337612 337622 744.04762 +21 338079 338170 744.04762 +21 339544 339550 496.03175 +21 339550 339551 248.01587 +21 339843 339858 744.04762 +21 339859 339862 744.04762 +21 339862 339867 1116.07143 +21 339867 339899 1860.11905 +21 339899 339905 1116.07143 +21 339905 339934 1860.11905 +21 339934 339948 1116.07143 +21 339948 339964 744.04762 +21 341963 342052 248.01587 +21 342879 342965 372.02381 +21 343012 343027 744.04762 +21 355779 355870 744.04762 +21 357940 357949 248.01587 +21 362604 362615 106.29252 +21 364986 364999 106.29252 +21 366862 366873 106.29252 +21 369598 369609 106.29252 +21 370626 370639 106.29252 +21 376648 376718 372.02381 +21 433506 433516 186.01190 +21 436933 436941 744.04762 +21 436941 436983 992.06349 +21 436983 437022 1240.07937 +21 437022 437029 496.03175 +21 437122 437200 248.01587 +21 487332 487405 496.03175 +21 487405 487408 248.01587 +21 488375 488384 744.04762 +21 489917 489927 186.01190 +21 494900 494909 106.29252 +21 498315 498321 425.17007 +21 498321 498322 212.58503 +21 498394 498404 744.04762 +21 500964 500978 248.01587 +21 509285 509295 372.02381 +21 509333 509352 818.45238 +21 509352 509371 372.02381 +21 509422 509440 372.02381 +21 509478 509484 372.02381 +21 509484 509496 520.83333 +21 509496 509519 148.80952 +21 511798 511809 992.06349 +21 511809 511812 744.04762 +21 518893 518939 744.04762 +21 530553 530598 744.04762 +21 530693 530694 744.04762 +21 530694 530707 1488.09524 +21 530707 530715 744.04762 +21 532128 532134 212.58503 +21 540660 540665 334.82143 +21 540665 540681 1078.86905 +21 540681 540701 892.85714 +21 540701 540715 1636.90476 +21 540715 540716 2232.14286 +21 540716 540723 1488.09524 +21 540723 540733 744.04762 +21 540797 540868 744.04762 +21 541160 541170 372.02381 +21 541758 541811 744.04762 +21 544614 544621 165.34392 +21 545498 545501 744.04762 +21 545501 545504 2666.17063 +21 545504 545515 3038.19444 +21 545515 545528 2294.14683 +21 545528 545541 1922.12302 +21 545541 545543 1550.09921 +21 545543 545555 1798.11508 +21 545555 545563 1426.09127 +21 545563 545573 1612.10317 +21 545573 545575 1364.08730 +21 545575 545578 1178.07540 +21 545578 545579 992.06349 +21 545579 545589 248.01587 +21 545589 545591 1178.07540 +21 545591 545605 930.05952 +21 545605 545622 1116.07143 +21 545622 545624 744.04762 +21 545624 545628 558.03571 +21 545628 545640 372.02381 +21 545654 545670 967.26190 +21 545670 545675 2393.35317 +21 545675 545679 2021.32937 +21 545679 545682 1773.31349 +21 545682 545689 1525.29762 +21 545689 545693 930.05952 +21 545693 545712 558.03571 +21 545718 545738 744.04762 +21 548371 548460 744.04762 +21 553388 553396 620.03968 +21 553446 553486 372.02381 +21 553486 553488 1860.11905 +21 553488 553492 1488.09524 +21 553492 553494 2232.14286 +21 553494 553504 2604.16667 +21 553504 553505 1860.11905 +21 553505 553506 2604.16667 +21 553506 553512 1860.11905 +21 553512 553537 1488.09524 +21 553537 553538 744.04762 +21 553538 553545 850.34014 +21 553545 553575 744.04762 +21 553583 553656 744.04762 +21 556343 556352 425.17007 +21 557530 557548 531.46259 +21 557548 557551 212.58503 +21 557590 557602 372.02381 +21 557602 557612 2604.16667 +21 557612 557618 2232.14286 +21 557618 557636 1488.09524 +21 557636 557667 744.04762 +21 557695 557700 850.34014 +21 557700 557750 744.04762 +21 566285 566311 744.04762 +21 566331 566349 248.01587 +21 566409 566421 372.02381 +21 566421 566428 4363.89834 +21 566428 566449 4198.55442 +21 566449 566450 4570.57823 +21 566450 566451 4322.56236 +21 566451 566453 3578.51474 +21 566453 566457 2940.75964 +21 566457 566458 2692.74376 +21 566458 566459 2320.71995 +21 566459 566460 1576.67234 +21 566460 566471 1470.37982 +21 566471 566474 1222.36395 +21 566474 566482 850.34014 +21 566482 566485 106.29252 +21 566563 566589 3720.23810 +21 566589 566590 2604.16667 +21 570941 570947 248.01587 +21 570947 570956 496.03175 +21 570971 571004 620.03968 +21 571004 571007 372.02381 +21 571042 571043 744.04762 +21 571043 571051 1116.07143 +21 571051 571059 1736.11111 +21 571059 571085 248.01587 +21 571250 571268 669.64286 +21 571268 571269 297.61905 +21 571681 571690 372.02381 +21 572934 572942 106.29252 +21 573571 573580 744.04762 +21 573590 573595 930.05952 +21 573595 573615 1178.07540 +21 573615 573616 1922.12302 +21 573616 573622 1178.07540 +21 573622 573628 992.06349 +21 573628 573661 744.04762 +21 576301 576336 744.04762 +21 576989 576998 372.02381 +21 577645 577675 744.04762 +21 591439 591446 165.34392 +21 592252 592263 248.01587 +21 592604 592612 496.03175 +21 594277 594285 106.29252 +21 594311 594317 744.04762 +21 596626 596644 318.87755 +21 596644 596658 1062.92517 +21 596658 596697 744.04762 +21 601927 601935 372.02381 +21 601935 601953 520.83333 +21 601953 601975 148.80952 +21 602326 602342 669.64286 +21 602342 602355 372.02381 +21 604865 604882 248.01587 +21 606083 606092 248.01587 +21 615168 615177 186.01190 +21 667938 667955 248.01587 +21 669156 669165 248.01587 +21 678241 678250 186.01190 +21 681752 681762 372.02381 +21 682368 682387 248.01587 +21 682451 682471 744.04762 +21 682479 682509 1116.07143 +21 682509 682535 744.04762 +21 683486 683495 744.04762 +21 686930 687021 744.04762 +21 687170 687188 744.04762 +21 687423 687433 744.04762 +21 689692 689704 744.04762 +21 690173 690191 297.61905 +21 693741 693756 744.04762 +21 693888 693904 744.04762 +21 694392 694394 372.02381 +21 694394 694403 1302.08333 +21 694403 694406 2046.13095 +21 694406 694412 2418.15476 +21 694412 694417 2604.16667 +21 694417 694423 2852.18254 +21 694423 694425 4402.28175 +21 694425 694435 4216.26984 +21 694435 694439 4588.29365 +21 694439 694440 4340.27778 +21 694440 694443 3968.25397 +21 694443 694455 4154.26587 +21 694455 694457 3968.25397 +21 694457 694459 3596.23016 +21 694459 694467 4340.27778 +21 694467 694472 4092.26190 +21 694472 694480 3720.23810 +21 694480 694481 3348.21429 +21 694481 694484 2976.19048 +21 694484 694485 2232.14286 +21 694485 694490 1860.11905 +21 694490 694496 1116.07143 +21 694496 694514 744.04762
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Signal.UniqueMultiple.str2.out.bg Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,1520 @@ +21 6317 6325 124.00794 +21 6887 6892 744.04762 +21 6892 6893 1488.09524 +21 6893 6905 1636.90476 +21 6905 6927 1488.09524 +21 6927 6936 744.04762 +21 6936 6940 372.02381 +21 6940 6942 1116.07143 +21 6942 6960 1302.08333 +21 6960 6968 1550.09921 +21 6968 6974 1178.07540 +21 6974 6988 2294.14683 +21 7022 7026 744.04762 +21 7026 7036 1488.09524 +21 7036 7039 2232.14286 +21 7039 7058 1488.09524 +21 7058 7068 2232.14286 +21 7068 7070 2976.19048 +21 7070 7078 1736.11111 +21 7078 7092 1364.08730 +21 7092 7096 1612.10317 +21 7096 7102 620.03968 +21 7102 7142 372.02381 +21 7953 7965 372.02381 +21 8591 8599 744.04762 +21 9145 9152 148.80952 +21 13073 13082 372.02381 +21 13853 13881 148.80952 +21 15200 15271 372.02381 +21 15271 15291 186.01190 +21 15314 15317 372.02381 +21 15317 15318 2604.16667 +21 15318 15320 3162.20238 +21 15320 15323 3906.25000 +21 15323 15326 4055.05952 +21 15326 15327 4427.08333 +21 15327 15328 4799.10714 +21 15328 15329 6287.20238 +21 15329 15330 7031.25000 +21 15330 15331 7279.26587 +21 15331 15332 10131.44841 +21 15332 15333 11991.56746 +21 15333 15334 12841.90760 +21 15334 15338 14330.00283 +21 15338 15339 15074.05045 +21 15339 15340 17430.20125 +21 15340 15341 18546.27268 +21 15341 15342 19290.32029 +21 15342 15344 20183.17744 +21 15344 15346 20741.21315 +21 15346 15348 21485.26077 +21 15348 15349 22154.90363 +21 15349 15350 22774.94331 +21 15350 15351 23022.95918 +21 15351 15352 24883.07823 +21 15352 15353 25627.12585 +21 15353 15356 25999.14966 +21 15356 15359 26185.16156 +21 15359 15360 26929.20918 +21 15360 15363 27673.25680 +21 15363 15364 28789.32823 +21 15364 15365 29719.38776 +21 15365 15366 29967.40363 +21 15366 15368 30711.45125 +21 15368 15371 31207.48299 +21 15371 15375 31951.53061 +21 15375 15376 31703.51474 +21 15376 15378 32695.57823 +21 15378 15380 33439.62585 +21 15380 15382 34183.67347 +21 15382 15383 32943.59410 +21 15383 15384 33687.64172 +21 15384 15385 33395.33730 +21 15385 15391 34139.38492 +21 15391 15392 33544.14683 +21 15392 15393 34288.19444 +21 15393 15394 32502.48016 +21 15394 15397 32948.90873 +21 15397 15398 33196.92460 +21 15398 15401 32824.90079 +21 15401 15402 32080.85317 +21 15402 15403 31336.80556 +21 15403 15406 31088.78968 +21 15406 15408 29414.68254 +21 15408 15409 29042.65873 +21 15409 15410 28521.82540 +21 15410 15411 28893.84921 +21 15411 15412 29637.89683 +21 15412 15413 29017.85714 +21 15413 15414 28273.80952 +21 15414 15416 28645.83333 +21 15416 15417 23846.72619 +21 15417 15419 23970.73413 +21 15419 15420 21738.59127 +21 15420 15421 19258.43254 +21 15421 15422 17398.31349 +21 15422 15424 15662.20238 +21 15424 15425 14918.15476 +21 15425 15426 15215.77381 +21 15426 15428 15587.79762 +21 15428 15429 14843.75000 +21 15429 15430 13851.68651 +21 15430 15431 13107.63889 +21 15431 15432 12735.61508 +21 15432 15434 8680.55556 +21 15434 15435 7564.48413 +21 15435 15440 6026.78571 +21 15440 15441 6770.83333 +21 15441 15448 6522.81746 +21 15448 15450 6374.00794 +21 15450 15451 5629.96032 +21 15451 15454 4885.91270 +21 15454 15462 4513.88889 +21 15462 15465 3769.84127 +21 15465 15467 3852.51323 +21 15467 15477 3108.46561 +21 15477 15499 2628.96825 +21 15499 15501 1364.08730 +21 15501 15503 1116.07143 +21 15503 15504 372.02381 +21 15504 15513 1116.07143 +21 15513 15531 744.04762 +21 15578 15599 248.01587 +21 15599 15611 434.02778 +21 15611 15616 186.01190 +21 15616 15624 930.05952 +21 15624 15627 1302.08333 +21 15627 15628 1550.09921 +21 15628 15644 2294.14683 +21 15657 15675 744.04762 +21 15675 15714 1488.09524 +21 15714 15732 744.04762 +21 15732 15733 992.06349 +21 15733 15737 744.04762 +21 15737 15751 248.01587 +21 18432 18443 744.04762 +21 18451 18457 106.29252 +21 19249 19266 744.04762 +21 19476 19484 372.02381 +21 19484 19507 744.04762 +21 19507 19514 1488.09524 +21 19514 19521 2232.14286 +21 19521 19532 2976.19048 +21 19532 19537 1488.09524 +21 19537 19538 1736.11111 +21 19538 19545 992.06349 +21 19545 19557 744.04762 +21 19557 19568 1860.11905 +21 19568 19572 2046.13095 +21 19572 19581 3534.22619 +21 19581 19584 4065.68878 +21 19584 19590 4809.73639 +21 19590 19593 5181.76020 +21 19593 19599 5925.80782 +21 19599 19611 6669.85544 +21 19611 19612 7254.46429 +21 19612 19624 6510.41667 +21 19624 19627 5766.36905 +21 19627 19638 4278.27381 +21 19638 19643 3831.84524 +21 19643 19644 3459.82143 +21 19644 19652 2715.77381 +21 19652 19657 2529.76190 +21 19667 19677 744.04762 +21 19677 19685 1178.07540 +21 19685 19692 1922.12302 +21 19692 19700 1674.10714 +21 19700 19714 1488.09524 +21 19714 19726 1736.11111 +21 19726 19753 1488.09524 +21 19753 19767 744.04762 +21 19918 19931 248.01587 +21 19931 20009 434.02778 +21 20009 20021 186.01190 +21 20792 20801 248.01587 +21 20801 20803 434.02778 +21 20803 20891 186.01190 +21 21409 21419 744.04762 +21 26050 26063 248.01587 +21 27372 27373 1302.08333 +21 27373 27374 4154.26587 +21 27374 27375 4526.28968 +21 27375 27377 4675.09921 +21 27377 27379 4923.11508 +21 27379 27380 5295.13889 +21 27380 27381 5667.16270 +21 27381 27385 6783.23413 +21 27385 27386 6889.52664 +21 27386 27388 8005.59807 +21 27388 27389 8377.62188 +21 27389 27391 9369.68537 +21 27391 27392 9741.70918 +21 27392 27393 10857.78061 +21 27393 27405 10940.45257 +21 27405 27408 5084.32540 +21 27408 27411 4340.27778 +21 27411 27424 5084.32540 +21 27424 27429 4340.27778 +21 27429 27439 4712.30159 +21 27439 27444 4861.11111 +21 27444 27452 5109.12698 +21 27452 27453 5853.17460 +21 27453 27454 6597.22222 +21 27454 27458 7341.26984 +21 27458 27459 7093.25397 +21 27459 27464 6721.23016 +21 27464 27465 5977.18254 +21 27465 27471 6225.19841 +21 27471 27475 5853.17460 +21 27475 27477 5959.46712 +21 27477 27479 5587.44331 +21 27479 27481 4099.34807 +21 27481 27482 4347.36395 +21 27482 27493 3231.29252 +21 27493 27497 1594.38776 +21 27497 27528 1346.37188 +21 27528 27531 1429.04384 +21 27531 27540 684.99622 +21 27540 27556 248.01587 +21 27666 27697 744.04762 +21 27788 27796 124.00794 +21 27819 27847 372.02381 +21 27847 27863 1116.07143 +21 27863 27906 744.04762 +21 27906 27935 992.06349 +21 27935 27950 248.01587 +21 28241 28265 124.00794 +21 28265 28266 248.01587 +21 28266 28273 124.00794 +21 29113 29121 248.01587 +21 29780 29781 248.01587 +21 29781 29787 992.06349 +21 29787 29788 1736.11111 +21 29788 29811 2480.15873 +21 29811 29835 3224.20635 +21 29835 29840 3968.25397 +21 29840 29843 4712.30159 +21 29843 29862 3224.20635 +21 29862 29868 2852.18254 +21 29868 29870 2108.13492 +21 29870 29872 1860.11905 +21 29872 29913 1116.07143 +21 29913 29923 372.02381 +21 31074 31082 372.02381 +21 33178 33186 372.02381 +21 34867 34876 82.67196 +21 35013 35028 558.03571 +21 35028 35057 186.01190 +21 35057 35073 334.82143 +21 35073 35074 441.11395 +21 35074 35083 813.13776 +21 35083 35087 1557.18537 +21 35087 35088 1929.20918 +21 35088 35094 2226.82823 +21 35094 35104 2598.85204 +21 35104 35105 3156.88776 +21 35105 35112 2194.94048 +21 35112 35113 3435.01984 +21 35113 35114 3683.03571 +21 35114 35118 4055.05952 +21 35118 35120 4799.10714 +21 35120 35123 6845.23810 +21 35123 35124 6994.04762 +21 35124 35125 7738.09524 +21 35125 35126 7986.11111 +21 35126 35127 8358.13492 +21 35127 35128 9102.18254 +21 35128 35129 10590.27778 +21 35129 35130 11334.32540 +21 35130 35132 11520.33730 +21 35132 35135 12264.38492 +21 35135 35136 13114.72506 +21 35136 35138 13486.74887 +21 35138 35139 14106.78855 +21 35139 35140 14850.83617 +21 35140 35142 16338.93141 +21 35142 35143 17678.21712 +21 35143 35145 17926.23299 +21 35145 35150 18112.24490 +21 35150 35151 18360.26077 +21 35151 35152 19104.30839 +21 35152 35153 20096.37188 +21 35153 35154 21033.51757 +21 35154 35157 21405.54138 +21 35157 35159 21653.55726 +21 35159 35160 22025.58107 +21 35160 35161 22955.64059 +21 35161 35164 23104.45011 +21 35164 35166 23848.49773 +21 35166 35167 24096.51361 +21 35167 35168 24096.51361 +21 35168 35173 25460.60091 +21 35173 35174 25832.62472 +21 35174 35177 25336.59297 +21 35177 35178 26068.23980 +21 35178 35179 26440.26361 +21 35179 35180 26291.45408 +21 35180 35183 25547.40646 +21 35183 35184 24555.34297 +21 35184 35185 24803.35884 +21 35185 35186 25758.21995 +21 35186 35188 26502.26757 +21 35188 35189 26130.24376 +21 35189 35190 25758.21995 +21 35190 35195 26006.23583 +21 35195 35198 26750.28345 +21 35198 35200 28052.36678 +21 35200 35201 27494.33107 +21 35201 35203 27122.30726 +21 35203 35204 26708.94747 +21 35204 35205 26460.93159 +21 35205 35207 25344.86017 +21 35207 35209 25592.87604 +21 35209 35210 24848.82842 +21 35210 35211 22988.70937 +21 35211 35212 19516.48715 +21 35212 35214 19665.29667 +21 35214 35216 18437.61810 +21 35216 35217 17693.57048 +21 35217 35218 17321.54667 +21 35218 35220 17073.53080 +21 35220 35221 16143.47128 +21 35221 35222 16249.76379 +21 35222 35223 16869.80348 +21 35223 35225 15541.14701 +21 35225 35226 14797.09940 +21 35226 35228 14648.28987 +21 35228 35229 13284.20257 +21 35229 35231 14028.25019 +21 35231 35232 13284.20257 +21 35232 35233 12688.96447 +21 35233 35234 14177.05971 +21 35234 35237 13929.04384 +21 35237 35238 14301.06765 +21 35238 35242 14053.05178 +21 35242 35245 13433.01209 +21 35245 35248 11304.20918 +21 35248 35251 11056.19331 +21 35251 35256 11651.43141 +21 35256 35258 11217.40363 +21 35258 35259 11031.39172 +21 35259 35261 10597.36395 +21 35261 35262 10473.35601 +21 35262 35264 10597.36395 +21 35264 35265 10287.34410 +21 35265 35268 9667.30442 +21 35268 35269 8898.45522 +21 35269 35275 8154.40760 +21 35275 35276 7989.06368 +21 35276 35280 6848.19067 +21 35280 35287 6724.18273 +21 35287 35288 3996.00813 +21 35288 35294 3809.99622 +21 35294 35297 3727.32426 +21 35297 35305 3479.30839 +21 35305 35306 3125.00000 +21 35306 35308 2380.95238 +21 35308 35310 1488.09524 +21 35310 35312 744.04762 +21 36000 36006 372.02381 +21 36006 36075 992.06349 +21 36075 36090 372.02381 +21 37043 37068 186.01190 +21 37068 37106 1116.07143 +21 37106 37117 744.04762 +21 37117 37122 372.02381 +21 37124 37150 248.01587 +21 37195 37205 248.01587 +21 37205 37207 330.68783 +21 37207 37212 82.67196 +21 37529 37536 124.00794 +21 37536 37561 248.01587 +21 37573 37607 744.04762 +21 37608 37629 744.04762 +21 37662 37686 372.02381 +21 37706 37719 248.01587 +21 37719 37796 496.03175 +21 38735 38774 297.61905 +21 38774 38788 446.42857 +21 38788 38827 148.80952 +21 38827 38828 1140.87302 +21 38828 38834 1512.89683 +21 38834 38842 2256.94444 +21 38842 38844 2504.96032 +21 38844 38846 2876.98413 +21 38846 38848 2728.17460 +21 38848 38858 2810.84656 +21 38858 38860 2562.83069 +21 38860 38862 3265.54233 +21 38862 38865 4009.58995 +21 38865 38868 4902.44709 +21 38868 38876 5274.47090 +21 38876 38883 6018.51852 +21 38883 38886 5274.47090 +21 38886 38890 5646.49471 +21 38890 38893 6018.51852 +21 38893 38898 5274.47090 +21 38898 38910 3786.37566 +21 38910 38914 4530.42328 +21 38914 38919 5274.47090 +21 38919 38920 5646.49471 +21 38920 38922 5894.51058 +21 38922 38925 6266.53439 +21 38925 38926 6861.77249 +21 38926 38927 6861.77249 +21 38927 38929 7605.82011 +21 38929 38930 7357.80423 +21 38930 38931 8101.85185 +21 38931 38939 9589.94709 +21 38939 38941 9176.58730 +21 38941 38943 10664.68254 +21 38943 38944 11408.73016 +21 38944 38948 12896.82540 +21 38948 38950 14484.12698 +21 38950 38951 14112.10317 +21 38951 38952 13963.29365 +21 38952 38953 13219.24603 +21 38953 38956 13963.29365 +21 38956 38958 14558.53175 +21 38958 38959 13814.48413 +21 38959 38962 14558.53175 +21 38962 38963 14012.89683 +21 38963 38964 13268.84921 +21 38964 38977 12896.82540 +21 38977 38978 12152.77778 +21 38978 38980 11408.73016 +21 38980 38986 11036.70635 +21 38986 38995 10664.68254 +21 38995 38997 6951.53061 +21 38997 38999 6207.48299 +21 38999 39006 5835.45918 +21 39006 39012 4198.55442 +21 39012 39017 3826.53061 +21 39017 39022 2232.14286 +21 39022 39023 1488.09524 +21 39023 39027 744.04762 +21 45858 45868 186.01190 +21 46059 46067 372.02381 +21 46067 46069 744.04762 +21 46069 46082 1488.09524 +21 46082 46101 2232.14286 +21 46101 46148 1860.11905 +21 46148 46157 1488.09524 +21 46157 46163 744.04762 +21 46616 46626 372.02381 +21 46719 46724 248.01587 +21 46724 46735 992.06349 +21 46735 46739 1984.12698 +21 46739 46741 2728.17460 +21 46741 46742 3472.22222 +21 46742 46746 4216.26984 +21 46746 46748 4365.07937 +21 46748 46749 5109.12698 +21 46749 46757 6225.19841 +21 46757 46758 6101.19048 +21 46758 46760 6969.24603 +21 46760 46762 7713.29365 +21 46762 46764 8085.31746 +21 46764 46768 9201.38889 +21 46768 46769 9945.43651 +21 46769 46771 10689.48413 +21 46771 46772 9945.43651 +21 46772 46773 10615.07937 +21 46773 46775 10987.10317 +21 46775 46777 11656.74603 +21 46777 46780 10912.69841 +21 46780 46781 10168.65079 +21 46781 46782 9424.60317 +21 46782 46783 10168.65079 +21 46783 46784 11656.74603 +21 46784 46788 10540.67460 +21 46788 46789 11656.74603 +21 46789 46793 12400.79365 +21 46793 46795 12507.08617 +21 46795 46799 12755.10204 +21 46799 46801 12581.49093 +21 46801 46808 12457.48299 +21 46808 46809 12351.19048 +21 46809 46810 11855.15873 +21 46810 46813 12599.20635 +21 46813 46815 11408.73016 +21 46815 46816 11780.75397 +21 46816 46817 11631.94444 +21 46817 46824 11135.91270 +21 46824 46825 10763.88889 +21 46825 46826 11383.92857 +21 46826 46829 11197.91667 +21 46829 46831 10081.84524 +21 46831 46848 8965.77381 +21 46848 46851 9957.83730 +21 46851 46853 9213.78968 +21 46853 46858 8841.76587 +21 46858 46859 8924.43783 +21 46859 46860 8626.81878 +21 46860 46863 7262.73148 +21 46863 46865 5625.82672 +21 46865 46866 5543.15476 +21 46866 46867 5208.33333 +21 46867 46869 4960.31746 +21 46869 46870 2108.13492 +21 46870 46875 1364.08730 +21 46875 46877 620.03968 +21 50123 50183 744.04762 +21 51151 51157 248.01587 +21 51157 51161 744.04762 +21 51161 51162 868.05556 +21 51162 51165 1240.07937 +21 51165 51166 1984.12698 +21 51166 51170 5146.32937 +21 51170 51172 5332.34127 +21 51172 51173 6820.43651 +21 51173 51174 8680.55556 +21 51174 51176 9703.62103 +21 51176 51178 10447.66865 +21 51178 51179 12254.64144 +21 51179 51181 12360.93396 +21 51181 51182 13197.98753 +21 51182 51183 13446.00340 +21 51183 51184 14190.05102 +21 51184 51185 15182.11451 +21 51185 51186 15926.16213 +21 51186 51187 17662.27324 +21 51187 51188 19336.38039 +21 51188 51189 19442.67290 +21 51189 51190 25767.07766 +21 51190 51192 26511.12528 +21 51192 51193 26759.14116 +21 51193 51194 27875.21259 +21 51194 51196 29611.32370 +21 51196 51197 32215.49036 +21 51197 51199 34447.63322 +21 51199 51201 38167.87132 +21 51201 51202 38415.88719 +21 51202 51204 39903.98243 +21 51204 51205 40276.00624 +21 51205 51206 41888.10941 +21 51206 51207 42136.12528 +21 51207 51208 42986.46542 +21 51208 51210 43978.52891 +21 51210 51211 47016.72336 +21 51211 51213 48132.79478 +21 51213 51214 48380.81066 +21 51214 51215 49744.89796 +21 51215 51217 48504.81859 +21 51217 51218 49992.91383 +21 51218 51219 50736.96145 +21 51219 51220 51108.98526 +21 51220 51222 51357.00113 +21 51222 51223 52101.04875 +21 51223 51224 56441.32653 +21 51224 51225 56813.35034 +21 51225 51226 57557.39796 +21 51226 51229 58301.44558 +21 51229 51231 57238.52041 +21 51231 51232 57734.55215 +21 51232 51234 59594.67120 +21 51234 51236 59842.68707 +21 51236 51237 59594.67120 +21 51237 51238 60586.73469 +21 51238 51239 63314.90930 +21 51239 51243 63208.61678 +21 51243 51245 63421.20181 +21 51245 51246 63607.21372 +21 51246 51247 64500.07086 +21 51247 51248 65244.11848 +21 51248 51249 65368.12642 +21 51249 51250 65740.15023 +21 51250 51252 65616.14229 +21 51252 51253 66236.18197 +21 51253 51255 65864.15816 +21 51255 51256 65957.16412 +21 51256 51257 61895.90420 +21 51257 51258 61802.89824 +21 51258 51259 60810.83475 +21 51259 51261 61306.86650 +21 51261 51262 60376.80697 +21 51262 51263 60004.78316 +21 51263 51264 59260.73554 +21 51264 51265 58764.70380 +21 51265 51267 58299.67404 +21 51267 51268 57431.61848 +21 51268 51269 56687.57086 +21 51269 51271 55837.23073 +21 51271 51272 55403.20295 +21 51272 51273 54411.13946 +21 51273 51274 53815.90136 +21 51274 51275 53815.90136 +21 51275 51276 52327.80612 +21 51276 51277 49847.64739 +21 51277 51278 49103.59977 +21 51278 51279 48173.54025 +21 51279 51280 48917.58787 +21 51280 51281 41105.08787 +21 51281 51282 40733.06406 +21 51282 51283 39306.97279 +21 51283 51284 37358.27664 +21 51284 51285 36242.20522 +21 51285 51286 34506.09410 +21 51286 51287 29917.80045 +21 51287 51289 26420.77664 +21 51289 51290 25428.71315 +21 51290 51291 23047.76077 +21 51291 51292 22613.73299 +21 51292 51297 22774.94331 +21 51297 51298 21286.84807 +21 51298 51301 19692.46032 +21 51301 51302 14670.13889 +21 51302 51305 13306.05159 +21 51305 51306 12562.00397 +21 51306 51308 11817.95635 +21 51308 51311 11445.93254 +21 51311 51312 9957.83730 +21 51312 51314 8841.76587 +21 51314 51316 8097.71825 +21 51316 51317 7353.67063 +21 51317 51319 6609.62302 +21 51319 51323 6237.59921 +21 51323 51324 5865.57540 +21 51324 51332 5121.52778 +21 51332 51335 4377.48016 +21 51335 51336 4228.67063 +21 51336 51339 1562.50000 +21 51339 51345 1116.07143 +21 51345 51352 744.04762 +21 51352 51355 372.02381 +21 51828 51833 496.03175 +21 51833 51848 644.84127 +21 51848 51882 496.03175 +21 51882 51891 868.05556 +21 51891 51898 496.03175 +21 51898 51916 248.01587 +21 56224 56227 124.00794 +21 56227 56237 496.03175 +21 56726 56737 372.02381 +21 56737 56754 558.03571 +21 56754 56756 930.05952 +21 56756 56764 1674.10714 +21 56764 56779 1302.08333 +21 56779 56824 930.05952 +21 56824 56838 744.04762 +21 57003 57010 248.01587 +21 57337 57358 744.04762 +21 57358 57380 1240.07937 +21 57380 57393 1984.12698 +21 57393 57394 2108.13492 +21 57394 57409 2852.18254 +21 57409 57415 744.04762 +21 57431 57449 248.01587 +21 57449 57470 566.89342 +21 57470 57474 318.87755 +21 57548 57560 248.01587 +21 57560 57565 1364.08730 +21 57565 57571 1116.07143 +21 57571 57589 372.02381 +21 57618 57629 744.04762 +21 58212 58221 82.67196 +21 59293 59302 82.67196 +21 60170 60181 372.02381 +21 60181 60236 744.04762 +21 60236 60244 1488.09524 +21 60244 60245 2232.14286 +21 60245 60253 2976.19048 +21 60253 60257 2232.14286 +21 60257 60258 1488.09524 +21 60258 60266 1736.11111 +21 60266 60269 744.04762 +21 60269 60285 1116.07143 +21 60314 60324 372.02381 +21 60346 60347 744.04762 +21 60347 60351 1488.09524 +21 60351 60357 1860.11905 +21 60357 60360 3720.23810 +21 60360 60361 4464.28571 +21 60361 60362 5208.33333 +21 60362 60365 5580.35714 +21 60365 60370 6324.40476 +21 60370 60375 6510.41667 +21 60375 60377 7130.45635 +21 60377 60379 8459.11281 +21 60379 60382 9203.16043 +21 60382 60389 8459.11281 +21 60389 60397 7715.06519 +21 60397 60398 6971.01757 +21 60398 60402 7219.03345 +21 60402 60411 7112.74093 +21 60411 60417 7633.57426 +21 60417 60439 7527.28175 +21 60439 60442 7155.25794 +21 60442 60444 6783.23413 +21 60444 60445 3311.01190 +21 60445 60450 2938.98810 +21 60450 60455 1450.89286 +21 60455 60461 1302.08333 +21 60461 60465 1116.07143 +21 60465 60466 372.02381 +21 60500 60509 744.04762 +21 60509 60519 1488.09524 +21 60519 60523 1594.38776 +21 60523 60525 1966.41156 +21 60525 60534 2040.81633 +21 60534 60539 1190.47619 +21 60539 60553 372.02381 +21 60648 60656 372.02381 +21 60656 60661 744.04762 +21 60661 60663 1116.07143 +21 60663 60670 1264.88095 +21 60670 60671 2008.92857 +21 60671 60673 2504.96032 +21 60673 60678 3249.00794 +21 60678 60680 3993.05556 +21 60680 60682 4365.07937 +21 60682 60690 4737.10317 +21 60690 60691 5481.15079 +21 60691 60698 6225.19841 +21 60698 60704 6349.20635 +21 60704 60710 5977.18254 +21 60710 60711 6225.19841 +21 60711 60714 6969.24603 +21 60714 60721 6597.22222 +21 60721 60725 7341.26984 +21 60725 60730 8085.31746 +21 60730 60734 8457.34127 +21 60734 60738 8829.36508 +21 60738 60742 8935.65760 +21 60742 60744 8191.60998 +21 60744 60747 8935.65760 +21 60747 60748 9121.66950 +21 60748 60749 9865.71712 +21 60749 60750 10981.78855 +21 60750 60751 11725.83617 +21 60751 60754 12469.88379 +21 60754 60757 13065.12188 +21 60757 60759 13809.16950 +21 60759 60760 13251.13379 +21 60760 60761 12879.10998 +21 60761 60762 13623.15760 +21 60762 60763 13375.14172 +21 60763 60765 12205.92404 +21 60765 60766 13321.99546 +21 60766 60767 13570.01134 +21 60767 60768 14314.05896 +21 60768 60770 13942.03515 +21 60770 60773 14686.08277 +21 60773 60774 15058.10658 +21 60774 60776 15554.13832 +21 60776 60777 15182.11451 +21 60777 60778 16174.17800 +21 60778 60780 15430.13039 +21 60780 60781 16174.17800 +21 60781 60789 16174.17800 +21 60789 60792 15749.00794 +21 60792 60795 15997.02381 +21 60795 60796 15252.97619 +21 60796 60797 15004.96032 +21 60797 60799 14260.91270 +21 60799 60801 14632.93651 +21 60801 60804 15004.96032 +21 60804 60809 14260.91270 +21 60809 60814 13516.86508 +21 60814 60817 13623.15760 +21 60817 60825 13995.18141 +21 60825 60827 13437.14569 +21 60827 60829 13543.43821 +21 60829 60831 14287.48583 +21 60831 60833 12613.37868 +21 60833 60837 11943.73583 +21 60837 60838 11757.72392 +21 60838 60840 11013.67630 +21 60840 60842 10145.62075 +21 60842 60847 9481.29252 +21 60847 60848 2790.17857 +21 60848 60849 2542.16270 +21 60849 60852 2356.15079 +21 60852 60855 3782.24206 +21 60855 60861 3931.05159 +21 60861 60862 4799.10714 +21 60862 60863 4551.09127 +21 60863 60865 3807.04365 +21 60865 60869 3435.01984 +21 60869 60883 2938.98810 +21 60883 60894 2380.95238 +21 60894 60901 4422.94974 +21 60901 60906 3844.24603 +21 60906 60908 3100.19841 +21 60908 60910 2728.17460 +21 60910 60915 2232.14286 +21 60915 60916 1488.09524 +21 60916 60919 372.02381 +21 61160 61187 248.01587 +21 61199 61201 744.04762 +21 61201 61215 1488.09524 +21 61215 61216 744.04762 +21 61216 61230 992.06349 +21 61230 61232 1098.35601 +21 61232 61233 885.77098 +21 61233 61236 354.30839 +21 61236 61239 248.01587 +21 62447 62495 248.01587 +21 62863 62870 372.02381 +21 62870 62873 520.83333 +21 62873 62879 1016.86508 +21 62879 62885 1264.88095 +21 62885 62898 1413.69048 +21 62898 62903 1562.50000 +21 62903 62919 1934.52381 +21 62919 62928 2306.54762 +21 62928 62933 1934.52381 +21 62933 62935 1562.50000 +21 62935 62936 1314.48413 +21 62936 62954 1686.50794 +21 62954 62959 1314.48413 +21 62959 62960 868.05556 +21 62960 62962 496.03175 +21 62962 62970 248.01587 +21 63021 63109 744.04762 +21 63397 63404 248.01587 +21 67793 67801 248.01587 +21 69393 69401 93.00595 +21 70098 70108 744.04762 +21 70108 70112 992.06349 +21 70112 70139 1736.11111 +21 70144 70147 248.01587 +21 70147 70148 992.06349 +21 70148 70151 1364.08730 +21 70151 70153 1612.10317 +21 70153 70164 1860.11905 +21 70164 70193 1488.09524 +21 70226 70227 1488.09524 +21 70227 70232 1860.11905 +21 70232 70233 2232.14286 +21 70233 70234 2728.17460 +21 70234 70236 3472.22222 +21 70236 70239 4340.27778 +21 70239 70241 4898.31349 +21 70241 70243 5270.33730 +21 70243 70244 5642.36111 +21 70244 70246 5791.17063 +21 70246 70247 6535.21825 +21 70247 70257 7527.28175 +21 70257 70266 7155.25794 +21 70266 70267 6411.21032 +21 70267 70269 6659.22619 +21 70269 70282 7403.27381 +21 70282 70286 4836.30952 +21 70286 70288 4092.26190 +21 70288 70296 5580.35714 +21 70296 70300 6101.19048 +21 70300 70307 5357.14286 +21 70307 70309 4985.11905 +21 70309 70314 4799.10714 +21 70314 70318 4427.08333 +21 70318 70322 4241.07143 +21 70322 70327 3869.04762 +21 70327 70342 3125.00000 +21 70342 70345 2976.19048 +21 70345 70347 2232.14286 +21 70347 70350 1488.09524 +21 70350 70360 744.04762 +21 72264 72276 372.02381 +21 73382 73395 372.02381 +21 73395 73401 186.01190 +21 74532 74574 248.01587 +21 75600 75608 372.02381 +21 75608 75627 1116.07143 +21 75627 75633 1364.08730 +21 75633 75639 1736.11111 +21 75639 75640 2480.15873 +21 75640 75641 3224.20635 +21 75641 75645 3596.23016 +21 75645 75650 8928.57143 +21 75650 75651 9325.39683 +21 75651 75654 12177.57937 +21 75654 75658 12921.62698 +21 75658 75660 15123.65363 +21 75660 75667 15867.70125 +21 75667 75673 16983.77268 +21 75673 75676 16239.72506 +21 75676 75682 16388.53458 +21 75682 75683 16760.55839 +21 75683 75685 16884.56633 +21 75685 75688 17628.61395 +21 75688 75689 16884.56633 +21 75689 75690 17628.61395 +21 75690 75691 18000.63776 +21 75691 75692 18992.70125 +21 75692 75694 18843.89172 +21 75694 75699 19215.91553 +21 75699 75701 19109.62302 +21 75701 75706 19357.63889 +21 75706 75708 20101.68651 +21 75708 75710 18117.55952 +21 75710 75713 17745.53571 +21 75713 75715 18489.58333 +21 75715 75718 18241.56746 +21 75718 75719 16753.47222 +21 75719 75720 16009.42460 +21 75720 75722 15265.37698 +21 75722 75724 16505.45635 +21 75724 75726 16133.43254 +21 75726 75727 15389.38492 +21 75727 75728 13405.25794 +21 75728 75730 14149.30556 +21 75730 75731 14521.32937 +21 75731 75732 13777.28175 +21 75732 75734 13628.47222 +21 75734 75735 11396.32937 +21 75735 75736 10652.28175 +21 75736 75738 9908.23413 +21 75738 75741 9722.22222 +21 75741 75742 8829.36508 +21 75742 75743 9573.41270 +21 75743 75745 9697.42063 +21 75745 75751 9325.39683 +21 75751 75753 8767.36111 +21 75753 75754 9511.40873 +21 75754 75756 8767.36111 +21 75756 75757 9098.04894 +21 75757 75758 9842.09656 +21 75758 75761 10214.12037 +21 75761 75762 10958.16799 +21 75762 75766 11702.21561 +21 75766 75767 12446.26323 +21 75767 75768 12297.45370 +21 75768 75771 12669.47751 +21 75771 75773 14529.59656 +21 75773 75775 13785.54894 +21 75775 75776 14529.59656 +21 75776 75777 13785.54894 +21 75777 75778 14033.56481 +21 75778 75779 13289.51720 +21 75779 75780 13661.54101 +21 75780 75781 13289.51720 +21 75781 75782 13810.35053 +21 75782 75783 13562.33466 +21 75783 75785 14058.36640 +21 75785 75790 13835.15212 +21 75790 75792 14579.19974 +21 75792 75795 14083.16799 +21 75795 75798 14355.98545 +21 75798 75799 12599.20635 +21 75799 75803 12351.19048 +21 75803 75805 11421.13095 +21 75805 75807 10429.06746 +21 75807 75808 10987.10317 +21 75808 75811 10429.06746 +21 75811 75817 8940.97222 +21 75817 75818 8816.96429 +21 75818 75826 7824.90079 +21 75826 75840 8568.94841 +21 75840 75847 10329.86111 +21 75847 75848 9709.82143 +21 75848 75849 9337.79762 +21 75849 75851 8965.77381 +21 75851 75852 9213.78968 +21 75852 75854 8283.73016 +21 75854 75857 7539.68254 +21 75857 75860 6795.63492 +21 75860 75861 5803.57143 +21 75861 75862 5059.52381 +21 75862 75864 2281.74603 +21 75864 75865 1537.69841 +21 75865 75866 1240.07937 +21 75866 75869 496.03175 +21 76760 76768 248.01587 +21 76842 76852 248.01587 +21 76857 76866 82.67196 +21 81294 81377 496.03175 +21 87102 87111 372.02381 +21 88028 88031 744.04762 +21 88031 88074 1116.07143 +21 88074 88075 1860.11905 +21 88075 88103 1488.09524 +21 88103 88162 744.04762 +21 91066 91075 82.67196 +21 91534 91564 248.01587 +21 93350 93361 124.00794 +21 94559 94570 620.03968 +21 94631 94639 744.04762 +21 96520 96529 82.67196 +21 97561 97562 744.04762 +21 97562 97595 1860.11905 +21 97595 97596 1488.09524 +21 97596 97599 1116.07143 +21 97599 97614 1860.11905 +21 97674 97693 744.04762 +21 97693 97702 826.71958 +21 97702 97719 744.04762 +21 97748 97771 744.04762 +21 97965 98013 744.04762 +21 98625 98676 744.04762 +21 98724 98746 744.04762 +21 99656 99663 248.01587 +21 102839 102847 372.02381 +21 103066 103073 744.04762 +21 103563 103571 93.00595 +21 104118 104127 372.02381 +21 104863 104954 744.04762 +21 108266 108267 744.04762 +21 108267 108310 1984.12698 +21 108310 108340 1488.09524 +21 108340 108348 744.04762 +21 112924 112929 372.02381 +21 114567 114576 620.03968 +21 114576 114577 496.03175 +21 115352 115360 248.01587 +21 115846 115886 248.01587 +21 115886 115916 868.05556 +21 115916 115918 496.03175 +21 116008 116029 372.02381 +21 117343 117403 372.02381 +21 117403 117407 744.04762 +21 117407 117409 2232.14286 +21 117409 117419 2976.19048 +21 117419 117423 2604.16667 +21 117423 117426 2852.18254 +21 117426 117431 2108.13492 +21 117431 117434 2480.15873 +21 117434 117438 2108.13492 +21 117438 117446 2294.14683 +21 117446 117447 2666.17063 +21 117447 117453 3410.21825 +21 117453 117455 3658.23413 +21 117455 117459 3764.52664 +21 117459 117460 5500.63776 +21 117460 117464 6988.73299 +21 117464 117466 7732.78061 +21 117466 117470 9220.87585 +21 117470 117472 9964.92347 +21 117472 117474 10336.94728 +21 117474 117478 10708.97109 +21 117478 117483 11453.01871 +21 117483 117485 11949.05045 +21 117485 117488 12693.09807 +21 117488 117492 14131.59014 +21 117492 117495 12643.49490 +21 117495 117500 13387.54252 +21 117500 117505 12643.49490 +21 117505 117507 13387.54252 +21 117507 117512 14131.59014 +21 117512 117514 14379.60601 +21 117514 117519 12891.51077 +21 117519 117520 13077.52268 +21 117520 117522 12705.49887 +21 117522 117523 12457.48299 +21 117523 117527 12829.50680 +21 117527 117528 12643.49490 +21 117528 117531 12457.48299 +21 117531 117535 11713.43537 +21 117535 117536 9853.31633 +21 117536 117537 9667.30442 +21 117537 117538 8923.25680 +21 117538 117540 8179.20918 +21 117540 117544 7931.19331 +21 117544 117546 7311.15363 +21 117546 117547 7204.86111 +21 117547 117549 6832.83730 +21 117549 117550 6088.78968 +21 117550 117551 4600.69444 +21 117551 117556 4476.68651 +21 117556 117561 6398.80952 +21 117561 117562 6150.79365 +21 117562 117566 5778.76984 +21 117566 117569 4786.70635 +21 117569 117571 3038.19444 +21 117571 117572 2666.17063 +21 117572 117574 2046.13095 +21 117574 117576 1922.12302 +21 117576 117591 2170.13889 +21 117591 117594 1922.12302 +21 117594 117598 1550.09921 +21 117598 117600 1632.77116 +21 117600 117601 1446.75926 +21 117601 117605 702.71164 +21 117605 117610 620.03968 +21 117610 117616 248.01587 +21 117791 117882 744.04762 +21 120527 120538 124.00794 +21 120538 120556 1860.11905 +21 120556 120557 1116.07143 +21 120557 120565 620.03968 +21 120565 120573 124.00794 +21 127504 127530 1488.09524 +21 127559 127575 992.06349 +21 127575 127583 744.04762 +21 127618 127661 744.04762 +21 127823 127834 186.01190 +21 130391 130400 372.02381 +21 133349 133357 93.00595 +21 135340 135349 93.00595 +21 137055 137063 248.01587 +21 137063 137086 620.03968 +21 137086 137146 248.01587 +21 138357 138375 124.00794 +21 138375 138391 868.05556 +21 138391 138419 1240.07937 +21 138419 138420 496.03175 +21 138420 138431 1240.07937 +21 138431 138461 744.04762 +21 139522 139543 106.29252 +21 139575 139590 2604.16667 +21 139590 139596 2976.19048 +21 139596 139599 2232.14286 +21 139599 139604 2604.16667 +21 139604 139605 4650.29762 +21 139605 139607 4278.27381 +21 139607 139609 5766.36905 +21 139609 139612 6138.39286 +21 139612 139618 6882.44048 +21 139618 139621 7626.48810 +21 139621 139629 6882.44048 +21 139629 139643 7626.48810 +21 139643 139650 7998.51190 +21 139650 139653 7626.48810 +21 139653 139654 8370.53571 +21 139654 139661 9114.58333 +21 139661 139663 8370.53571 +21 139663 139664 7254.46429 +21 139664 139672 7998.51190 +21 139672 139673 8659.88757 +21 139673 139676 7626.48810 +21 139676 139677 6882.44048 +21 139677 139680 6696.42857 +21 139680 139682 6324.40476 +21 139682 139684 5580.35714 +21 139684 139688 5663.02910 +21 139688 139690 3430.88624 +21 139690 139693 2686.83862 +21 139693 139695 2604.16667 +21 139695 139697 2232.14286 +21 139697 139707 1488.09524 +21 139707 139710 744.04762 +21 139710 139726 1860.11905 +21 139726 139732 1116.07143 +21 139732 139739 372.02381 +21 139739 139747 1488.09524 +21 139747 139750 1116.07143 +21 139750 139761 744.04762 +21 140471 140481 744.04762 +21 141272 141279 372.02381 +21 142851 142859 744.04762 +21 143528 143619 186.01190 +21 146463 146471 82.67196 +21 146990 147000 93.00595 +21 147010 147017 82.67196 +21 148694 148701 372.02381 +21 149223 149280 744.04762 +21 149280 149302 850.34014 +21 149302 149307 1098.35601 +21 149307 149334 726.33220 +21 149334 149341 620.03968 +21 149341 149357 1054.06746 +21 149357 149365 1798.11508 +21 149365 149375 1946.92460 +21 149375 149376 954.86111 +21 149376 149380 1574.90079 +21 149380 149394 1698.90873 +21 149394 149395 1450.89286 +21 149395 149398 1698.90873 +21 149398 149400 1326.88492 +21 149400 149413 954.86111 +21 149413 149415 768.84921 +21 149415 149429 843.25397 +21 149429 149434 8117.20522 +21 149434 149437 8654.57294 +21 149437 149443 8282.54913 +21 149443 149444 7786.51738 +21 149444 149445 7538.50151 +21 149445 149447 7166.47770 +21 149447 149448 6050.40627 +21 149448 149453 5008.73961 +21 149453 149454 4264.69199 +21 149454 149462 3520.64437 +21 149462 149465 3892.66818 +21 149465 149474 3148.62056 +21 149474 149476 2652.58881 +21 149476 149480 5876.79516 +21 149480 149483 5504.77135 +21 149483 149485 5339.42744 +21 149485 149487 4595.37982 +21 149487 149489 3745.03968 +21 149489 149494 3596.23016 +21 149494 149498 3224.20635 +21 149498 149500 2232.14286 +21 149500 149501 1488.09524 +21 152394 152403 124.00794 +21 152403 152410 868.05556 +21 152410 152412 1612.10317 +21 152412 152452 2356.15079 +21 152452 152470 1612.10317 +21 152470 152494 1364.08730 +21 152494 152498 1116.07143 +21 152498 152521 372.02381 +21 152618 152662 248.01587 +21 206394 206404 744.04762 +21 208412 208419 372.02381 +21 208624 208638 744.04762 +21 208832 208865 248.01587 +21 209926 209933 82.67196 +21 210431 210438 82.67196 +21 211687 211694 82.67196 +21 211901 211908 82.67196 +21 211938 211950 744.04762 +21 214586 214594 248.01587 +21 217543 217551 212.58503 +21 218979 218986 454.69577 +21 218986 218992 372.02381 +21 219166 219180 744.04762 +21 220139 220151 744.04762 +21 221815 221854 372.02381 +21 221865 221886 372.02381 +21 227484 227494 372.02381 +21 228707 228722 372.02381 +21 235083 235091 744.04762 +21 236084 236098 744.04762 +21 236227 236238 1736.11111 +21 236238 236241 2480.15873 +21 236241 236247 2666.17063 +21 236247 236249 2852.18254 +21 236249 236252 2604.16667 +21 236252 236259 3348.21429 +21 236259 236268 4092.26190 +21 236268 236275 4836.30952 +21 236275 236278 5580.35714 +21 236278 236293 4836.30952 +21 236293 236297 4092.26190 +21 236297 236303 4836.30952 +21 236303 236306 5048.89456 +21 236306 236308 5420.91837 +21 236308 236309 5792.94218 +21 236309 236319 6040.95805 +21 236319 236321 5296.91043 +21 236321 236323 5544.92630 +21 236323 236326 4614.86678 +21 236326 236333 4428.85488 +21 236333 236346 3870.81916 +21 236346 236347 3126.77154 +21 236347 236360 2940.75964 +21 236360 236362 10530.04535 +21 236362 236365 10678.85488 +21 236365 236372 9934.80726 +21 236372 236374 9190.75964 +21 236374 236376 8446.71202 +21 236376 236380 7529.05329 +21 236380 236381 6785.00567 +21 236381 236382 5854.94615 +21 236382 236384 5110.89853 +21 236384 236387 4366.85091 +21 236387 236388 2134.70805 +21 236388 236389 248.01587 +21 236840 236882 992.06349 +21 236882 236921 1736.11111 +21 236921 236927 1488.09524 +21 236927 236972 744.04762 +21 237693 237784 248.01587 +21 238177 238185 248.01587 +21 239807 239893 372.02381 +21 241310 241391 248.01587 +21 242173 242237 248.01587 +21 242722 242813 744.04762 +21 245627 245636 372.02381 +21 245727 245736 212.58503 +21 246237 246270 124.00794 +21 246287 246319 744.04762 +21 247259 247269 372.02381 +21 247415 247498 744.04762 +21 248759 248801 744.04762 +21 248815 248855 248.01587 +21 248855 248863 496.03175 +21 248863 248899 868.05556 +21 248899 248900 1612.10317 +21 248900 248905 1984.12698 +21 248905 248906 2728.17460 +21 248906 248913 2480.15873 +21 248913 248917 2852.18254 +21 248917 248919 3373.01587 +21 248919 248921 3670.63492 +21 248921 248929 4042.65873 +21 248929 248937 3298.61111 +21 248937 248940 4303.07540 +21 248940 248942 4154.26587 +21 248942 248945 3782.24206 +21 248945 248953 3286.21032 +21 248953 248968 2542.16270 +21 248968 248973 2914.18651 +21 248973 248982 2418.15476 +21 248982 248986 2500.82672 +21 248986 248989 2128.80291 +21 248989 248990 2046.13095 +21 248990 248991 1860.11905 +21 248991 248993 1488.09524 +21 248993 248996 2232.14286 +21 248996 249003 1488.09524 +21 249003 249004 744.04762 +21 250020 250027 744.04762 +21 250676 250683 744.04762 +21 251516 251586 744.04762 +21 262545 262552 82.67196 +21 269202 269210 372.02381 +21 276644 276658 372.02381 +21 276658 276692 744.04762 +21 276692 276728 992.06349 +21 276728 276731 620.03968 +21 276731 276773 248.01587 +21 284645 284701 372.02381 +21 289533 289578 248.01587 +21 289578 289624 434.02778 +21 289624 289669 186.01190 +21 289697 289704 124.00794 +21 289704 289729 248.01587 +21 318889 318980 744.04762 +21 319674 319765 744.04762 +21 319905 319993 744.04762 +21 343121 343130 124.00794 +21 349509 349526 744.04762 +21 352032 352041 744.04762 +21 355582 355589 372.02381 +21 355589 355605 744.04762 +21 355605 355655 1488.09524 +21 355655 355673 2232.14286 +21 355673 355680 1860.11905 +21 355680 355688 1488.09524 +21 355688 355696 2232.14286 +21 355696 355724 1488.09524 +21 355724 355730 2232.14286 +21 355730 355746 2976.19048 +21 355746 355747 2232.14286 +21 355747 355752 2604.16667 +21 355752 355768 2976.19048 +21 355768 355777 3348.21429 +21 355777 355815 2604.16667 +21 355815 355821 1860.11905 +21 355821 355838 1116.07143 +21 355838 355843 744.04762 +21 355843 355859 372.02381 +21 358072 358128 372.02381 +21 433893 433984 372.02381 +21 435548 435566 744.04762 +21 436967 437015 744.04762 +21 437115 437133 297.61905 +21 437133 437141 620.03968 +21 437141 437149 372.02381 +21 437149 437151 1388.88889 +21 437151 437156 1016.86508 +21 437156 437159 892.85714 +21 437159 437173 744.04762 +21 487332 487343 82.67196 +21 487343 487346 2376.81878 +21 487346 487353 2624.83466 +21 487353 487355 2004.79497 +21 487355 487356 4980.98545 +21 487356 487359 4794.97354 +21 487359 487361 10152.11640 +21 487361 487366 9408.06878 +21 487366 487367 9284.06085 +21 487367 487369 8540.01323 +21 487369 487377 8391.20370 +21 487377 487383 8019.17989 +21 487383 487389 7275.13228 +21 487389 487390 6977.51323 +21 487390 487393 6791.50132 +21 487393 487394 6171.46164 +21 487394 487395 5923.44577 +21 487395 487397 5551.42196 +21 487397 487399 4683.36640 +21 487399 487400 3939.31878 +21 487400 487404 3009.25926 +21 487404 487408 2265.21164 +21 487408 487410 1636.90476 +21 487410 487414 892.85714 +21 490495 490503 93.00595 +21 491986 491988 297.61905 +21 491988 492033 669.64286 +21 492033 492038 297.61905 +21 492195 492219 372.02381 +21 492581 492607 248.01587 +21 495672 495682 744.04762 +21 497013 497024 1240.07937 +21 497024 497025 1116.07143 +21 497025 497026 868.05556 +21 499647 499657 744.04762 +21 502310 502333 744.04762 +21 502333 502348 850.34014 +21 502348 502353 744.04762 +21 503894 503904 744.04762 +21 507933 507941 248.01587 +21 511282 511299 372.02381 +21 511299 511300 186.01190 +21 512179 512194 248.01587 +21 513998 514009 744.04762 +21 514009 514015 148.80952 +21 515109 515118 124.00794 +21 518852 518862 186.01190 +21 523057 523068 186.01190 +21 523503 523523 372.02381 +21 523523 523540 2046.13095 +21 523540 523541 1798.11508 +21 523541 523549 1426.09127 +21 523549 523553 1178.07540 +21 523553 523579 930.05952 +21 523579 523585 744.04762 +21 527710 527776 372.02381 +21 528944 528955 744.04762 +21 529043 529051 186.01190 +21 530566 530577 744.04762 +21 535536 535547 372.02381 +21 538543 538555 744.04762 +21 541467 541499 744.04762 +21 544135 544142 272.81746 +21 544142 544145 148.80952 +21 548331 548338 124.00794 +21 548998 549004 248.01587 +21 552533 552599 744.04762 +21 552653 552660 372.02381 +21 552660 552672 1116.07143 +21 552672 552676 744.04762 +21 552676 552697 1636.90476 +21 552697 552704 1488.09524 +21 552704 552727 744.04762 +21 553677 553684 744.04762 +21 555036 555063 248.01587 +21 555926 555936 496.03175 +21 559223 559231 124.00794 +21 564811 564820 124.00794 +21 566920 566929 744.04762 +21 568193 568201 372.02381 +21 570412 570426 372.02381 +21 571733 571752 148.80952 +21 573711 573758 372.02381 +21 577666 577679 850.34014 +21 577679 577686 106.29252 +21 578711 578722 744.04762 +21 583121 583123 744.04762 +21 583123 583131 1488.09524 +21 584836 584843 372.02381 +21 586945 586957 297.61905 +21 590579 590588 248.01587 +21 590642 590651 248.01587 +21 591208 591217 248.01587 +21 592327 592336 124.00794 +21 593806 593816 744.04762 +21 596408 596418 124.00794 +21 597024 597037 744.04762 +21 598466 598474 93.00595 +21 600711 600719 248.01587 +21 602167 602191 248.01587 +21 602191 602208 620.03968 +21 602208 602216 1364.08730 +21 602216 602235 1116.07143 +21 602235 602252 2108.13492 +21 602252 602255 2852.18254 +21 602255 602260 5332.34127 +21 602260 602261 5084.32540 +21 602261 602269 4340.27778 +21 602269 602270 3596.23016 +21 602270 602274 3348.21429 +21 602274 602275 3720.23810 +21 602275 602279 3348.21429 +21 602279 602280 4092.26190 +21 602280 602291 3968.25397 +21 602291 602294 3596.23016 +21 602294 602297 2852.18254 +21 602297 602302 2604.16667 +21 602302 602304 1860.11905 +21 602304 602306 1488.09524 +21 602306 602313 744.04762 +21 606436 606444 124.00794 +21 669509 669517 124.00794 +21 679943 680034 372.02381 +21 682300 682316 1550.09921 +21 682316 682320 1847.71825 +21 682320 682346 1661.70635 +21 682346 682354 1289.68254 +21 682354 682361 744.04762 +21 682361 682373 1488.09524 +21 682373 682382 1594.38776 +21 682382 682385 850.34014 +21 682385 682389 744.04762 +21 682389 682391 1488.09524 +21 682391 682406 1570.76720 +21 682406 682449 1488.09524 +21 682449 682451 744.04762 +21 682451 682467 2070.93254 +21 682467 682477 2442.95635 +21 682477 682480 1822.91667 +21 682480 682493 892.85714 +21 682493 682504 744.04762 +21 682539 682557 248.01587 +21 682557 682564 1736.11111 +21 682564 682583 2480.15873 +21 682583 682586 2108.13492 +21 682586 682589 2214.42744 +21 682589 682596 1470.37982 +21 682596 682601 1098.35601 +21 682601 682606 248.01587 +21 682606 682614 1240.07937 +21 682614 682616 992.06349 +21 682616 682619 248.01587 +21 682628 682636 372.02381 +21 687366 687371 744.04762 +21 688546 688556 248.01587 +21 689198 689225 248.01587 +21 689226 689256 992.06349 +21 689256 689262 248.01587 +21 689262 689285 396.82540 +21 689285 689290 248.01587 +21 689294 689305 744.04762 +21 690019 690030 446.42857 +21 692348 692360 186.01190 +21 693374 693412 297.61905 +21 694274 694282 148.80952 +21 694443 694500 620.03968 +21 694810 694829 744.04762 +21 694829 694835 992.06349 +21 694835 694836 248.01587 +21 694959 694988 372.02381 +21 695105 695155 248.01587 +21 695155 695192 992.06349 +21 695192 695200 744.04762 +21 695250 695280 496.03175 +21 695498 695506 148.80952
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnastar_test_splicejunctions_PE.bed Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,2 @@ +test_chromosome 251 350 1 1 0 51 0 37 +test_chromosome 401 500 1 1 0 41 0 36
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_Signal.Unique.both.read2.out.wig Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,290 @@ +variableStep chrom=test_chromosome +59 5263.15789 +60 10526.31579 +61 10526.31579 +62 10526.31579 +63 10526.31579 +64 10526.31579 +65 10526.31579 +66 15789.47368 +67 15789.47368 +68 15789.47368 +69 15789.47368 +70 15789.47368 +71 21052.63158 +72 21052.63158 +73 26315.78947 +74 26315.78947 +75 26315.78947 +76 31578.94737 +77 31578.94737 +78 31578.94737 +79 31578.94737 +80 36842.10526 +81 36842.10526 +82 36842.10526 +83 36842.10526 +84 36842.10526 +85 36842.10526 +86 36842.10526 +87 36842.10526 +88 42105.26316 +89 42105.26316 +90 42105.26316 +91 42105.26316 +92 42105.26316 +93 42105.26316 +94 47368.42105 +95 47368.42105 +96 52631.57895 +97 52631.57895 +98 57894.73684 +99 57894.73684 +100 63157.89474 +101 68421.05263 +102 68421.05263 +103 73684.21053 +104 73684.21053 +105 73684.21053 +106 73684.21053 +107 73684.21053 +108 89473.68421 +109 89473.68421 +110 89473.68421 +111 89473.68421 +112 89473.68421 +113 94736.84211 +114 94736.84211 +115 94736.84211 +116 94736.84211 +117 94736.84211 +118 94736.84211 +119 100000.00000 +120 100000.00000 +121 100000.00000 +122 105263.15789 +123 105263.15789 +124 105263.15789 +125 105263.15789 +126 105263.15789 +127 105263.15789 +128 105263.15789 +129 110526.31579 +130 110526.31579 +131 121052.63158 +132 126315.78947 +133 121052.63158 +134 115789.47368 +135 115789.47368 +136 115789.47368 +137 126315.78947 +138 131578.94737 +139 142105.26316 +140 142105.26316 +141 136842.10526 +142 136842.10526 +143 136842.10526 +144 136842.10526 +145 136842.10526 +146 131578.94737 +147 131578.94737 +148 126315.78947 +149 131578.94737 +150 131578.94737 +151 126315.78947 +152 126315.78947 +153 131578.94737 +154 142105.26316 +155 147368.42105 +156 152631.57895 +157 157894.73684 +158 163157.89474 +159 168421.05263 +160 173684.21053 +161 178947.36842 +162 178947.36842 +163 184210.52632 +164 194736.84211 +165 194736.84211 +166 210526.31579 +167 210526.31579 +168 215789.47368 +169 215789.47368 +170 221052.63158 +171 215789.47368 +172 221052.63158 +173 231578.94737 +174 231578.94737 +175 236842.10526 +176 236842.10526 +177 236842.10526 +178 231578.94737 +179 231578.94737 +180 236842.10526 +181 236842.10526 +182 242105.26316 +183 226315.78947 +184 226315.78947 +185 231578.94737 +186 231578.94737 +187 231578.94737 +188 231578.94737 +189 231578.94737 +190 231578.94737 +191 231578.94737 +192 231578.94737 +193 231578.94737 +194 231578.94737 +195 242105.26316 +196 242105.26316 +197 236842.10526 +198 236842.10526 +199 242105.26316 +200 247368.42105 +201 247368.42105 +202 247368.42105 +203 247368.42105 +204 242105.26316 +205 242105.26316 +206 231578.94737 +207 231578.94737 +208 236842.10526 +209 236842.10526 +210 236842.10526 +211 242105.26316 +212 236842.10526 +213 231578.94737 +214 231578.94737 +215 231578.94737 +216 236842.10526 +217 236842.10526 +218 236842.10526 +219 236842.10526 +220 236842.10526 +221 242105.26316 +222 242105.26316 +223 242105.26316 +224 242105.26316 +225 242105.26316 +226 247368.42105 +227 247368.42105 +228 247368.42105 +229 236842.10526 +230 226315.78947 +231 221052.63158 +232 226315.78947 +233 221052.63158 +234 215789.47368 +235 215789.47368 +236 210526.31579 +237 215789.47368 +238 210526.31579 +239 200000.00000 +240 200000.00000 +241 184210.52632 +242 189473.68421 +243 184210.52632 +244 178947.36842 +245 178947.36842 +246 178947.36842 +247 173684.21053 +248 157894.73684 +249 157894.73684 +250 147368.42105 +351 157894.73684 +352 163157.89474 +353 168421.05263 +354 168421.05263 +355 168421.05263 +356 173684.21053 +357 168421.05263 +358 168421.05263 +359 168421.05263 +360 163157.89474 +361 163157.89474 +362 168421.05263 +363 163157.89474 +364 163157.89474 +365 163157.89474 +366 163157.89474 +367 163157.89474 +368 163157.89474 +369 157894.73684 +370 152631.57895 +371 152631.57895 +372 152631.57895 +373 157894.73684 +374 152631.57895 +375 147368.42105 +376 147368.42105 +377 147368.42105 +378 147368.42105 +379 147368.42105 +380 147368.42105 +381 147368.42105 +382 142105.26316 +383 136842.10526 +384 136842.10526 +385 136842.10526 +386 131578.94737 +387 126315.78947 +388 121052.63158 +389 115789.47368 +390 115789.47368 +391 110526.31579 +392 110526.31579 +393 110526.31579 +394 110526.31579 +395 110526.31579 +396 105263.15789 +397 105263.15789 +398 105263.15789 +399 100000.00000 +400 100000.00000 +501 84210.52632 +502 84210.52632 +503 84210.52632 +504 84210.52632 +505 84210.52632 +506 84210.52632 +507 73684.21053 +508 73684.21053 +509 73684.21053 +510 68421.05263 +511 68421.05263 +512 63157.89474 +513 63157.89474 +514 63157.89474 +515 63157.89474 +516 57894.73684 +517 57894.73684 +518 57894.73684 +519 52631.57895 +520 52631.57895 +521 52631.57895 +522 42105.26316 +523 42105.26316 +524 42105.26316 +525 42105.26316 +526 31578.94737 +527 26315.78947 +528 21052.63158 +529 21052.63158 +530 21052.63158 +531 15789.47368 +532 15789.47368 +533 15789.47368 +534 15789.47368 +535 15789.47368 +536 15789.47368 +537 10526.31579 +538 10526.31579 +539 10526.31579 +540 10526.31579 +541 10526.31579 +542 10526.31579 +543 10526.31579 +544 10526.31579 +545 5263.15789 +546 5263.15789 +547 5263.15789
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_rev_Signal.Unique.str2.out.bg Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,124 @@ +test_chromosome 58 59 10416.66667 +test_chromosome 59 65 20833.33333 +test_chromosome 65 70 31250.00000 +test_chromosome 70 72 41666.66667 +test_chromosome 72 75 52083.33333 +test_chromosome 75 79 62500.00000 +test_chromosome 79 87 72916.66667 +test_chromosome 87 93 83333.33333 +test_chromosome 93 95 93750.00000 +test_chromosome 95 97 104166.66667 +test_chromosome 97 99 114583.33333 +test_chromosome 99 100 125000.00000 +test_chromosome 100 102 135416.66667 +test_chromosome 102 107 145833.33333 +test_chromosome 107 112 177083.33333 +test_chromosome 112 118 187500.00000 +test_chromosome 118 121 197916.66667 +test_chromosome 121 128 218750.00000 +test_chromosome 128 130 229166.66667 +test_chromosome 130 131 260416.66667 +test_chromosome 131 132 270833.33333 +test_chromosome 132 133 260416.66667 +test_chromosome 133 136 250000.00000 +test_chromosome 136 137 270833.33333 +test_chromosome 137 138 281250.00000 +test_chromosome 138 140 302083.33333 +test_chromosome 140 145 291666.66667 +test_chromosome 145 147 281250.00000 +test_chromosome 147 150 270833.33333 +test_chromosome 150 152 260416.66667 +test_chromosome 152 153 270833.33333 +test_chromosome 153 154 291666.66667 +test_chromosome 154 155 312500.00000 +test_chromosome 155 156 322916.66667 +test_chromosome 156 159 333333.33333 +test_chromosome 159 160 343750.00000 +test_chromosome 160 161 354166.66667 +test_chromosome 161 163 364583.33333 +test_chromosome 163 164 375000.00000 +test_chromosome 164 165 385416.66667 +test_chromosome 165 167 406250.00000 +test_chromosome 167 168 416666.66667 +test_chromosome 168 169 406250.00000 +test_chromosome 169 171 427083.33333 +test_chromosome 171 172 437500.00000 +test_chromosome 172 177 427083.33333 +test_chromosome 177 182 416666.66667 +test_chromosome 182 183 385416.66667 +test_chromosome 183 187 395833.33333 +test_chromosome 187 194 385416.66667 +test_chromosome 194 196 395833.33333 +test_chromosome 196 199 385416.66667 +test_chromosome 199 200 406250.00000 +test_chromosome 200 204 416666.66667 +test_chromosome 204 205 427083.33333 +test_chromosome 205 207 406250.00000 +test_chromosome 207 209 416666.66667 +test_chromosome 209 211 427083.33333 +test_chromosome 211 212 406250.00000 +test_chromosome 212 213 385416.66667 +test_chromosome 213 220 375000.00000 +test_chromosome 220 224 385416.66667 +test_chromosome 224 226 395833.33333 +test_chromosome 226 227 406250.00000 +test_chromosome 227 228 395833.33333 +test_chromosome 228 229 385416.66667 +test_chromosome 229 232 354166.66667 +test_chromosome 232 233 364583.33333 +test_chromosome 233 234 375000.00000 +test_chromosome 234 235 364583.33333 +test_chromosome 235 236 343750.00000 +test_chromosome 236 238 333333.33333 +test_chromosome 238 239 322916.66667 +test_chromosome 239 240 312500.00000 +test_chromosome 240 242 291666.66667 +test_chromosome 242 243 302083.33333 +test_chromosome 243 244 312500.00000 +test_chromosome 244 245 291666.66667 +test_chromosome 245 246 281250.00000 +test_chromosome 246 249 270833.33333 +test_chromosome 249 250 260416.66667 +test_chromosome 350 351 291666.66667 +test_chromosome 351 352 302083.33333 +test_chromosome 352 353 312500.00000 +test_chromosome 353 354 322916.66667 +test_chromosome 354 357 333333.33333 +test_chromosome 357 358 343750.00000 +test_chromosome 358 359 333333.33333 +test_chromosome 359 361 343750.00000 +test_chromosome 361 365 354166.66667 +test_chromosome 365 369 364583.33333 +test_chromosome 369 370 343750.00000 +test_chromosome 370 372 354166.66667 +test_chromosome 372 374 375000.00000 +test_chromosome 374 379 354166.66667 +test_chromosome 379 380 333333.33333 +test_chromosome 380 381 322916.66667 +test_chromosome 381 383 312500.00000 +test_chromosome 383 395 302083.33333 +test_chromosome 395 399 291666.66667 +test_chromosome 399 400 281250.00000 +test_chromosome 500 505 260416.66667 +test_chromosome 505 506 250000.00000 +test_chromosome 506 507 239583.33333 +test_chromosome 507 508 229166.66667 +test_chromosome 508 516 218750.00000 +test_chromosome 516 517 208333.33333 +test_chromosome 517 518 187500.00000 +test_chromosome 518 521 177083.33333 +test_chromosome 521 522 166666.66667 +test_chromosome 522 524 156250.00000 +test_chromosome 524 526 145833.33333 +test_chromosome 526 527 135416.66667 +test_chromosome 527 528 125000.00000 +test_chromosome 528 529 114583.33333 +test_chromosome 529 532 104166.66667 +test_chromosome 532 534 93750.00000 +test_chromosome 534 536 83333.33333 +test_chromosome 536 540 72916.66667 +test_chromosome 540 543 62500.00000 +test_chromosome 543 545 52083.33333 +test_chromosome 545 547 41666.66667 +test_chromosome 547 549 20833.33333 +test_chromosome 549 550 10416.66667
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_revlib_R1.fastqsanger Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,192 @@ +@test_mRNA_150_290_0/1 +TCCTAAAAAGTCCGCCTCGGTCTCAGTCTCAAGTAGAAAAAGTCCCGTTGGCGATCCGTCTACGTCCGAGTAAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_255_2/1 +GAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAATATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_72_258_4/1 +GTAGAAAAAGTCCCGTTGCCCATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_107_286_5/1 +AAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_122_299_6/1 +CAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGCTCCGTCTACGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_234_7/1 +AGTCTACGTCCGAGTCAGATAATAAACTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_155_9/1 +TACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATAGTACAGTCGCTGCATCTGACGCTCGAAGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_230_b/1 +TACGTCCGAGTGAGTTAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_276_c/1 +CCTCGATCCCAGTCTCAAGTAGAAAAAGCCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_268_d/1 +CCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAATAATAGTGGCGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_118_297_f/1 +AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_16_194_10/1 +TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_266_13/1 +AGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGGATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_218_16/1 +AGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_195_17/1 +ATCCCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGACAAATATGTAGCGTCCTACTGCCCTCCTCAGTCCAATCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_126_282_18/1 +AGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_274_1c/1 +TCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_225_1e/1 +CCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCATATACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_249_20/1 +GTCCCGTTGCCGATCCGTCTCCGTCCGAGTAAGATAGTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_267_22/1 +CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_69_229_23/1 +ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTAGACGCTCAGCCGTAGGGCCGCGCGCCAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_21_208_24/1 +GTAATAGTGGCGTATCGCAAGCTCGACGCTCAGGCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_146_27/1 +ACCTACTGCACTCCTCAGTCCGATCGTCCTAAATAGTCCAGTCGCTGCATCTGACGCTCTAAGTCCGTCCGTAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_103_284_2a/1 +AAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_271_2b/1 +ATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCTGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_50_224_2d/1 +CGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_26_189_30/1 +AGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTACCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_79_256_31/1 +AGAAAAAGTCCCGTTGCCGATCCGGCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATGGCAAGCTCGAC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_267_32/1 +CAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGAAAGATAATAAAGTAATAGTGCCGTATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_145_300_37/1 +GCAAGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTTCCGATCCGTCTACGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_228_3a/1 +CCTACGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAGCCATAGGGCCGCGCGCCAAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_30_231_3c/1 +CTACGTGCGAGTAAGATATTAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTTAGCCGTAGGGCCGCGCGCCAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_220_3d/1 +GAAGATAATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_278_3e/1 +CGCCTCGATTCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_23_186_42/1 +TCGACGCTCAGTCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTTCTGCCCTCCTCCGTCCGATCGTCCTAAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_106_253_45/1 +AAAAGTCCCGTTGCCGATCCGTTTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_47/1 +TCGCAAGCTCGACGCTCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_63_229_4c/1 +ACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACACTCAGCCGTAGGGCCGCGCGCCAAAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_245_4d/1 +CGTTGCCGATCCGTCTACGTCCGAGTAAGATTATAAAGTAATAGTGGCGTATCGCAACCTCGACGCTCAGCCGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_88_257_50/1 +TAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_9_179_52/1 +TCAGCCGTAGGGCCGCGCGCCAAATACGTAGCGTCCTACTGCCCTCCTCAGTCCGATCGTCCTAAATGGTCCAGT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_250_57/1 +AGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGCGTATCGCAAGCTCGACGCTCAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_272_5a/1 +GATCCCAGTGTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAATAGTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_114_277_5b/1 +GCCTCGATCCCAGTCTCAAGCAGAAAAAGTCCCGTTGCCGTTCCGTCTACCTCCGAGTAAGATAATAAAGTAATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_279_5f/1 +CCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTAAGATAATAAAGTAA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_293_60/1 +CCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_297_61/1 +AGTCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCGGATCCGTCTACGTCCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_295_63/1 +TCCCGTCCTAAAAAGTCCGCCTCGATCCCAGTCTCAAGTAGAAAAAGTCCCGTTGCCGATCCGTCTACGTCCGAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat_revlib_R2.fastqsanger Fri Feb 17 20:03:27 2023 +0000 @@ -0,0 +1,192 @@ +@test_mRNA_150_290_0/2 +TACGTATTTGTCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATCCGCCACTATTACTTTATTATCTTACTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_82_255_2/2 +GACTTAGAGCGTCAGATGCAGCGACTGGACTTTTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_72_258_4/2 +ACTACGGACGGACTTAGAGCGTCAGATGCAGCAACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_107_286_5/2 +TGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGCATTTGGCGCGCGGCCCTACGGCTGAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_122_299_6/2 +GATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_234_7/2 +GGATGACGCCTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_8_155_9/2 +TGTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_230_b/2 +AGCGTCAGGTGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_276_c/2 +ACTGGACTATTTAGGACGATCGGACTGAGGAAGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_268_d/2 +CTATTTAAGACGTTCCGCCTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_118_297_f/2 +GGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_16_194_10/2 +GACTGGATGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTCGGACTACGGACGGACTTAAAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_105_266_13/2 +ACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_218_16/2 +GGATGACGACTAGGACTACGGACGGACTTAGAACGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_46_195_17/2 +GTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_126_282_18/2 +GGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTTGCGATACGCC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_274_1c/2 +GAGTGTACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATGTGCCGCGCGGCCCTACGGCTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_44_225_1e/2 +ACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCGGGTGCAGCGACTGGACTATTTAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_48_249_20/2 +GCCACTACGGGGATGACGACTAGGACGACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_110_267_22/2 +ACTAGTTAGGGCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTAGTTGGCGCGCGGCCCTACGACTGAGCGTC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_69_229_23/2 +AGGACTACGGACGGACTTATAGGGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_21_208_24/2 +GAGGCGCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_36_146_27/2 +GCGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACAGACGGACTTAGAGCGTCAGATGCAGCGACTGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_103_284_2a/2 +CGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_271_2b/2 +TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_50_224_2d/2 +CACTACGAGGATGACGTCTAGGACTACGGACGGACTTAGAGCGTCAGACGCAGCGACTGGACTATTTAGGACGAT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_26_189_30/2 +GCTTGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_79_256_31/2 +ACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_89_267_32/2 +AGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGAGTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_145_300_37/2 +GACGCTACGTATTTGGCGCGGGGCCCTATGGCTGAGCGTCGAGCTTGCGATACGCCACTATTACTTTAGTATATT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_228_3a/2 +GGACTGAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGTAGTAGGACGCTACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_30_231_3c/2 +GCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_58_220_3d/2 +GGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_104_278_3e/2 +GACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTTTTTGGCGCGCGGCCCTACGGCTG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_23_186_42/2 +GGCGCTTGTGACTGAGCTAGGACGTGCCACTACGGGGATGAAGACTAGGACTACGGACGGACTTAGAGCGTCAGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_106_253_45/2 +CTGGACTATTTAGGTCGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_51_194_47/2 +ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_63_229_4c/2 +ACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGGGACTGGACTATTTAGGACGATCGGACTGAGGAGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_81_245_4d/2 +GGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGATGAGGGCAGTAGGACGCTACGTA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_88_257_50/2 +GAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_9_179_52/2 +CTGACTAGACTGGAGGCGCTCGCGACTGAGCTAGGACGTGCCACTACGGGGATGACGACTAGGACTACGGACGGA ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_250_57/2 +AGAGCGTCAGATGCAGAGACTGGACTATTTAGGACGATCGGACTGAGGAGTGCAGTAGGACGCTACGTATTTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_53_272_5a/2 +TACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_114_277_5b/2 +TTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGCCTGAGCGTCGAGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_87_279_5f/2 +AGAGCGTCAGATGCAGCGACTGGACTATTTAGGACGATCGGACCGAGGAGGGCAGTAGGACGCTACGTATTTGGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_125_293_60/2 +CGGACTGAGGAGGGCAGTAGGACGCTATGTATTTGGCGCGCGGCCCTACGGCTGAGCTTCGAGGTTGCGATACGC ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_111_297_61/2 +CTATTTAGGACGATCGGACTGGGGAGGGCAGTAGGACGCTACGGATTTGGCGCGCGGCCCTACGGCTGAGCGTCG ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII +@test_mRNA_116_295_63/2 +TAGGACGATCGGACTGAGGAGGGCAGTAGGACGCTACGTATTTGGCGCGCGGCCCTACGGCTGAGCGTCGAGCTT ++ +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII