Mercurial > repos > iuc > sfold

diff test-data/seq.fasta @ 0:6cce721f568c draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/sfold commit 41456127d154f251438945210c2513601bd21ceb
author iuc
date Wed, 27 Nov 2024 13:22:29 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seq.fasta	Wed Nov 27 13:22:29 2024 +0000
@@ -0,0 +1,3 @@
+>gi|395400|emb|X66515|ECTRALA E.coli tRNA-Ala
+GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATC
+CCGCTTAGCTCCACCA   
\ No newline at end of file