# HG changeset patch
# User iuc
# Date 1547497076 18000
# Node ID fc46049f6c2728fc965d26bcabebb0c5c1aede31

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/shorah commit e302de4f94384825ead064acc33b33fc95c081d9

diff -r 000000000000 -r fc46049f6c27 shorah.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/shorah.xml	Mon Jan 14 15:17:56 2019 -0500
@@ -0,0 +1,64 @@
+<?xml version="1.0"?>
+<tool id="shorah_amplicon" version="@VERSION@+galaxy0" name="Reconstruct haplotypes">
+    <description>with ShoRAH in amplicon mode</description>
+    <macros>
+        <token name="@VERSION@">1.1.3</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@VERSION@">shorah</requirement>
+    </requirements>
+    <command detect_errors="exit_code">
+    <![CDATA[
+    ln -s '$bam' input.bam &&
+    ln -s '$fasta' input.fa &&
+    amplian.py
+        --bam input.bam
+        --fasta input.fa
+        #if str($region):
+            --region '$region'
+        #end if
+        $diversity
+        --min_overlap $min_overlap
+        --alpha $alpha
+        --maxcov $maxcov
+        --sigma $sigma &&
+    sed -i.bak 's/,/\t/g' SNVs_0.010000_final.csv
+
+    ]]>
+    </command>
+    <inputs>
+        <param argument="--bam" type="data" format="bam" label="Aligned reads in .bam format" />
+        <param argument="--fasta" type="data" format="fasta" label="Reference genome in fasta format" />
+        <param argument="--region" type="text" value="" optional="true" label="Limit to a specific region" help="e.g. 'ch3:1000-1300'" />
+        <param argument="--diversity" type="boolean" truevalue="--diversity" falsevalue="" label="Run on the highest entropy region" />
+        <param argument="--min_overlap" type="float" value="0.95" min="0" max="1" optional="true" label="Fraction of read overlap to be included" />
+        <param argument="--alpha" type="float" value="0.5" optional="true" label="Alpha in dpm sampling" />
+        <param argument="--maxcov" type="integer" value="50000" optional="true" label="Approximate max coverage allowed" />
+        <param argument="--sigma" type="float" value="0.01" optional="true" label="Sigma value to use when calling SNVs" />
+        <param name="log_output" type="boolean" truevalue="log" falsevalue="" label="Include the log in the history" />
+    </inputs>
+    <outputs>
+        <data name="haplotypes" format="tabular" from_work_dir="SNVs_0.010000_final.csv" label="${tool.name} on ${on_string}: Haplotypes" />
+        <data name="log" format="txt" from_work_dir="SNV.txt" label="${tool.name} on ${on_string}: Log">
+            <filter>log_output</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="bam" ftype="bam" value="shorah-amplicon-in1.bam" />
+            <param name="fasta" ftype="fasta" value="shorah-amplicon-in1.fa" />
+            <param name="min_overlap" value="0.95" />
+            <param name="log_output" value="log" />
+            <output name="haplotypes" file="shorah-amplicon-out1.tsv" compare="re_match" />
+            <output name="log" file="shorah-amplicon-out1.txt" compare="re_match" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+ShoRAH is an open source project for the analysis of next generation sequencing data. It is designed to analyse genetically heterogeneous samples. Its tools are written in different programming languages and provide error correction, haplotype reconstruction and estimation of the frequency of the different genetic variants present in a mixed sample.
+]]>
+    </help>
+    <citations>
+        <citation type="doi">10.1186/1471-2105-12-119</citation>
+    </citations>
+</tool>
\ No newline at end of file
diff -r 000000000000 -r fc46049f6c27 test-data/shorah-amplicon-in1.bam
Binary file test-data/shorah-amplicon-in1.bam has changed
diff -r 000000000000 -r fc46049f6c27 test-data/shorah-amplicon-in1.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-in1.fa	Mon Jan 14 15:17:56 2019 -0500
@@ -0,0 +1,3 @@
+>reference
+CTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGG
+AAGCTCTATTAGA
diff -r 000000000000 -r fc46049f6c27 test-data/shorah-amplicon-out1.tsv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-out1.tsv	Mon Jan 14 15:17:56 2019 -0500
@@ -0,0 +1,4 @@
+Chromosome	Pos	Ref	Var	Freq	Post	Fvar	Rvar	Ftot	Rtot	Pval	Qval
+reference	8	C	A	0.3...	1.0000	147	144	511	489	0.942186	1
+reference	28	T	A	0.3...	1.0000	147	145	511	489	0.918406	1
+reference	35	A	C	0.3...	1.0000	146	144	511	489	0.91896	1
diff -r 000000000000 -r fc46049f6c27 test-data/shorah-amplicon-out1.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-out1.txt	Mon Jan 14 15:17:56 2019 -0500
@@ -0,0 +1,4 @@
+Chromosome	Pos	Ref	Var	Freq	Post
+reference	8	C	A	0.3...	1.0000
+reference	28	T	A	0.3...	1.0000
+reference	35	A	C	0.3...	1.0000