Mercurial > repos > iuc > snippy

changeset 14:08d22d220254 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snippy commit bc5bbb26c53bf2455043cf4b8f552571e6f74530
author iuc
date Mon, 20 Jan 2025 10:10:04 +0000
parents d220115f882b
children
files macros.xml snippy-core.xml snippy.xml snippy_clean_full_aln.xml test-data/contigs.fasta test-data/d_fna_ref_mincov_1_minqual_60.snps.gff test-data/d_fna_ref_mincov_1_minqual_60.snps.txt
diffstat 7 files changed, 58 insertions(+), 6 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Sat Jul 10 07:46:31 2021 +0000
+++ b/macros.xml	Mon Jan 20 10:10:04 2025 +0000
@@ -6,7 +6,11 @@
             <yield />
         </requirements>
     </xml>
-
+    <xml name="bio_tools">
+        <xrefs>
+            <xref type="bio.tools">snippy</xref>
+        </xrefs>
+    </xml>
     <token name="@WRAPPER_VERSION@">4.6.0</token>
     <token name="@VERSION_SUFFIX@">0</token>
 
--- a/snippy-core.xml	Sat Jul 10 07:46:31 2021 +0000
+++ b/snippy-core.xml	Mon Jan 20 10:10:04 2025 +0000
@@ -3,6 +3,7 @@
     <description>
         Combine multiple Snippy outputs into a core SNP alignment
     </description>
+    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
--- a/snippy.xml	Sat Jul 10 07:46:31 2021 +0000
+++ b/snippy.xml	Mon Jan 20 10:10:04 2025 +0000
@@ -21,6 +21,8 @@
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_single.element_identifier)
         #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
             #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fastq_input_interleaved.element_identifier)
+        #elif str( $fastq_input.fastq_input_selector ) == "contigs"
+            #set $dir_name = re.sub('[^\w_]', '_', $fastq_input.fasta_input.element_identifier)
         #end if
 
         snippy
@@ -49,6 +51,8 @@
                 --se '$fastq_input.fastq_input_single'
             #elif str( $fastq_input.fastq_input_selector ) == "paired_iv"
                 --peil '$fastq_input.fastq_input_interleaved'
+            #elif str( $fastq_input.fastq_input_selector ) == "contigs"
+                --ctgs '$fastq_input.fasta_input'
             #end if
 
         #if "outcon" in str($outputs) and $adv.rename_cons
@@ -62,11 +66,12 @@
     <inputs>
         <expand macro="reference_selector" />
         <conditional name="fastq_input">
-            <param name="fastq_input_selector" type="select" label="Single or Paired-end reads" help="Select between paired and single end data">
-                <option value="paired">Paired</option>
-                <option value="single">Single</option>
-                <option value="paired_collection">Paired Collection</option>
-                <option value="paired_iv">Paired Interleaved</option>
+            <param name="fastq_input_selector" type="select" label="Input type" help="Select paired/single end raw read data or assembled contigs">
+                <option value="paired">Paired end reads</option>
+                <option value="single">Single end reads</option>
+                <option value="paired_collection">Paired end reads in a collection</option>
+                <option value="paired_iv">Interleaved paired end reads</option>
+                <option value="contigs">Assembled Contigs</option>
             </param>
             <when value="paired">
                 <param name="fastq_input1" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select first set of reads" help="Specify dataset with forward reads"/>
@@ -81,6 +86,10 @@
             <when value="paired_iv">
                 <param name="fastq_input_interleaved" type="data" format="fastqsanger,fastqsanger.gz" label="Select fastq dataset" help="Specify dataset with interleaved reads"/>
             </when>
+            <when value="contigs">
+                <param name="fasta_input" type="data" format="fasta" label="Select fasta dataset" help="Specify dataset with assembled contigs"/>
+            </when>
+
         </conditional>
 
         <section name="adv" title="Advanced parameters" expanded="false">
@@ -218,6 +227,22 @@
             <output name="snpsum" ftype="tabular" file="b_fna_ref_mincov_2_minqual_60.snps.txt" lines_diff="8" />
             <output name="snpgff" ftype="gff3" file="b_2_fna_ref_mincov_2_minqual_60.snps.gff" lines_diff="2"/>
         </test>
+
+        <test>            <!-- test 5 - fasta ref one snp single -->
+            <conditional name="reference_source">
+                <param name="reference_source_selector" value="history"/>
+                <param name="ref_file" value="reference.fasta" ftype="fasta"/>
+            </conditional>
+            <conditional name="fastq_input">
+                <param name="fastq_input_selector" value="contigs" />
+                <param name="fasta_input" value="contigs.fasta" ftype="fasta" />
+            </conditional>
+            <param name="mincov" value="2" />
+            <param name="minqual" value="60" />
+            <param name="outputs" value="outgff,outsum" />
+            <output name="snpsum" ftype="tabular" file="d_fna_ref_mincov_1_minqual_60.snps.txt" lines_diff="6" />
+            <output name="snpgff" ftype="gff3" file="d_fna_ref_mincov_1_minqual_60.snps.gff" lines_diff="2"/>
+        </test>
     </tests>
 
 
--- a/snippy_clean_full_aln.xml	Sat Jul 10 07:46:31 2021 +0000
+++ b/snippy_clean_full_aln.xml	Mon Jan 20 10:10:04 2025 +0000
@@ -3,6 +3,7 @@
     <description>
         Replace any non-standard sequence characters in snippy 'core.full.aln' file.
     </description>
+    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.fasta	Mon Jan 20 10:10:04 2025 +0000
@@ -0,0 +1,11 @@
+>reference
+TCCACAAGCCATTGTGTGTAATTAACCACTAATTGTGTATAAGTTTAAACTAATTGAAAAGGTTATCCAC
+AATAAAAAGGCGTTATTCAGGAGTTATCCACACTTTCTAGGAAAGGATTTCATTGCGCCAATGTGTTAAA
+TTATTTACCGAATACGAAAAAAAGACAAATAAATGAGGTTGTGAAAAATGATATTTCAACGGCTTTTGAA
+GACTAGAGATACAGAGTTTTATCGAGTTATACAAAACAGGAATATTGACGACGTATTTGGATACTTATTA
+ATTCACGATAAACGGGAACCAGCAGAAATTGACGATTTTAAGGTATTTGCAAAAAGTAATATAAATAAAG
+AAGCTTTTTCAGTGAATATCAAAAAAAATCATATTTACACGATGTTTTTCCACTTTACTGATTTAGAGGA
+AGAACAGGAAATTCCAAAATTTACTAAAGTTATTCGTTTTATAGAAGGACTTTTATCTTTTCAGCCAGAA
+ACAAGCCATTACGTTGATAACTATTTAATAAAGGAAAAACTAATTTTTGAATATCCTGCTGAATTTGAGA
+AAATCGGGGAGTTTGCTAAATATTTAGTAAAGCTTTCGGGTCGTAAAATTACTATTCCAGACACAACGAG
+AGAAAAATATATCTATTTAACGCAATAATTTTCGAAAAATGGTTTTTCTCTCTATAAAAATATGATATGA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/d_fna_ref_mincov_1_minqual_60.snps.gff	Mon Jan 20 10:10:04 2025 +0000
@@ -0,0 +1,3 @@
+##gff-version 3
+reference	snippy:4.6.0	variation	141	141	.	.	0	note=snp C=>T T:4 C:0
+reference	snippy:4.6.0	variation	211	211	.	.	0	note=snp A=>G G:5 A:0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/d_fna_ref_mincov_1_minqual_60.snps.txt	Mon Jan 20 10:10:04 2025 +0000
@@ -0,0 +1,7 @@
+DateTime	2025-01-15T12:20:46
+ReadFiles	fake_reads.fq
+Reference	reference.fasta
+ReferenceSize	700
+Software	snippy 4.6.0
+Variant-SNP	2
+VariantTotal	2