Mercurial > repos > iuc > snpeff
changeset 1:500832f27cbc draft
Uploaded
| author | iuc |
|---|---|
| date | Thu, 22 Jan 2015 08:28:37 -0500 |
| parents | e8adfc4c0a6b |
| children | e09ce114d240 |
| files | .shed.yml data_manager/data_manager_snpEff_databases.py data_manager/data_manager_snpEff_databases.xml data_manager/data_manager_snpEff_download.py data_manager/data_manager_snpEff_download.xml data_manager_conf.xml datatypes_conf.xml lib/galaxy/datatypes/snpeff.py lib/galaxy/datatypes/snpeff.pyc readme.rst repository_dependencies.xml snpEff.xml snpEff_databases.xml snpEff_download.xml snpEff_macros.xml snpSift_annotate.xml snpSift_caseControl.xml snpSift_filter.xml snpSift_int.xml test-data/annotate_1.vcf test-data/annotate_5.vcf test-data/db_test_1.vcf test-data/interval.bed test-data/test.private.01.vcf test-data/test.private.02.vcf test-data/test01.vcf tool-data/snpeff_annotations.loc.sample tool-data/snpeff_databases.loc.sample tool-data/snpeff_genomedb.loc.sample tool-data/snpeff_regulationdb.loc.sample tool-data/snpeffv_annotations.loc.sample tool-data/snpeffv_databases.loc.sample tool-data/snpeffv_genomedb.loc.sample tool-data/snpeffv_regulationdb.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 36 files changed, 196 insertions(+), 1940 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/.shed.yml Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,3 @@ +# repository published to https://toolshed.g2.bx.psu.edu/repos/iuc/snpeff +owner: iuc +name: snpeff
--- a/data_manager/data_manager_snpEff_databases.py Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,82 +0,0 @@ -#!/usr/bin/env python - -import sys -import os -import re -import tempfile -import subprocess -import fileinput -import shutil -import optparse -import urllib2 -from ftplib import FTP -import tarfile - -from galaxy.util.json import from_json_string, to_json_string - -def stop_err(msg): - sys.stderr.write(msg) - sys.exit(1) - -def fetch_databases(data_manager_dict, target_directory, jar_path): - (snpEff_dir,snpEff_jar) = os.path.split(jar_path) - if not os.path.exists(target_directory): - os.makedirs(target_directory) - databases_path = os.path.join( target_directory, 'databases.out' ) - databases_output = open(databases_path,'w') - args = [ 'java','-jar', ] - args.append( snpEff_jar ) - args.append( 'databases' ) - # tmp_stderr = tempfile.NamedTemporaryFile( prefix = "tmp-data-manager-snpEff-stderr" ) - # databases_output = open(databases_path) - # proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir, stdout=databases_output.fileno(), stderr=tmp_stderr.fileno() ) - proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir, stdout=databases_output.fileno() ) - return_code = proc.wait() - if return_code: - sys.exit( return_code ) - databases_output.close() - try: - data_manager_dict['data_tables'] = data_manager_dict.get( 'data_tables', {} ) - data_manager_dict['data_tables']['snpeff_databases'] = data_manager_dict['data_tables'].get( 'snpeff_databases', [] ) - data_table_entries = [] - fh = open(databases_path,'r') - for i,line in enumerate(fh): - fields = line.split('\t') - if len(fields) >= 2: - genome_version = fields[0].strip() - if genome_version.startswith("Genome") or genome_version.startswith("-"): - continue - #snpeff test genome - if genome_version == '30c2c903' or fields[1].strip() == 'TestCase' or fields[1].strip().startswith('Test_'): - continue - description = fields[1].strip() + ' : ' + genome_version - data_table_entries.append(dict(value=genome_version, name=description)) - data_manager_dict['data_tables']['snpeff_databases'] = data_table_entries - except Exception, e: - stop_err( 'Error parsing %s %s\n' % (config,str( e )) ) - else: - fh.close() - return data_manager_dict - -def main(): - #Parse Command Line - parser = optparse.OptionParser() - parser.add_option( '-j', '--jar_path', dest='jar_path', action='store', type="string", default=None, help='snpEff.jar path' ) - (options, args) = parser.parse_args() - - filename = args[0] - - params = from_json_string( open( filename ).read() ) - target_directory = params[ 'output_data' ][0]['extra_files_path'] - os.mkdir( target_directory ) - data_manager_dict = {} - - - #Create Defuse Reference Data - data_manager_dict = fetch_databases( data_manager_dict, target_directory, options.jar_path) - - #save info to json file - open( filename, 'wb' ).write( to_json_string( data_manager_dict ) ) - -if __name__ == "__main__": main() -
--- a/data_manager/data_manager_snpEff_databases.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,41 +0,0 @@ -<tool id="data_manager_snpeff_databases" name="SnpEff Databases" version="3.4" tool_type="manage_data"> - <description>Read the list of available snpEff databases</description> - <requirements> - <requirement type="package" version="3.4">snpEff</requirement> - </requirements> - <command interpreter="python"> - data_manager_snpEff_databases.py --jar_path \$SNPEFF_JAR_PATH/snpEff.jar "$out_file" - </command> - <inputs> - </inputs> - <outputs> - <data name="out_file" format="data_manager_json"/> - </outputs> - <stdio> - <exit_code range=":-1" level="fatal" description="Error: Cannot open file" /> - <exit_code range="1:" level="fatal" description="Error" /> - </stdio> - <tests> - <test> - <output name="out_file"> - <assert_contents> - <!-- Check that a genome was added --> - <has_text text="GRCh37.72" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -This tool updatess the list of SnpEff databases for the SnpEff Download data manager. -It should only need to be run once for a snpEff version, -since it populates the SnpEff Download data manager from the snpEff config file. - -For information about snpEff: http://snpEff.sourceforge.net - -Please cite: -"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process] - - </help> -</tool> -
--- a/data_manager/data_manager_snpEff_download.py Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,114 +0,0 @@ -#!/usr/bin/env python - -import sys -import os -import re -import tempfile -import subprocess -import fileinput -import shutil -import optparse -import urllib2 -from ftplib import FTP -import tarfile - -from galaxy.util.json import from_json_string, to_json_string - -def stop_err(msg): - sys.stderr.write(msg) - sys.exit(1) - -""" -# Download human database 'hg19' -java -jar snpEff.jar download -v hg19 - - <command>java -jar \$SNPEFF_JAR_PATH/snpEff.jar download -c \$JAVA_JAR_PATH/snpEff.config $genomeVersion > $logfile </command> - -snpEffectPredictor.bin -regulation_HeLa-S3.bin -regulation_pattern = 'regulation_(.+).bin' - - -""" -def download_database(data_manager_dict, target_directory, jar_path,config,genome_version,organism): - ## get data_dir from config - ##--- - ## Databases are stored here - ## E.g.: Information for 'hg19' is stored in data_dir/hg19/ - ## - ## Note: Since version 2.1 you can use tilde ('~') as first character to refer to your home directory - ##--- - #data_dir = ~/snpEff/data/ - data_dir = target_directory - (snpEff_dir,snpEff_jar) = os.path.split(jar_path) - args = [ 'java','-jar' ] - args.append( jar_path ) - args.append( 'download' ) - args.append( '-c' ) - args.append( config ) - args.append( '-dataDir' ) - args.append( data_dir ) - args.append( '-v' ) - args.append( genome_version ) - proc = subprocess.Popen( args=args, shell=False, cwd=snpEff_dir ) - return_code = proc.wait() - if return_code: - sys.exit( return_code ) - ## search data_dir/genome_version for files - regulation_pattern = 'regulation_(.+).bin' - # annotation files that are included in snpEff by a flag - annotations_dict = {'nextProt.bin' : '-nextprot','motif.bin': '-motif'} - genome_path = os.path.join(data_dir,genome_version) - if os.path.isdir(genome_path): - for root, dirs, files in os.walk(genome_path): - for fname in files: - if fname.startswith('snpEffectPredictor'): - # if snpEffectPredictor.bin download succeeded - name = genome_version + (' : ' + organism if organism else '') - data_table_entry = dict(value=genome_version, name=name, path=data_dir) - _add_data_table_entry( data_manager_dict, 'snpeff_genomedb', data_table_entry ) - else: - m = re.match(regulation_pattern,fname) - if m: - name = m.groups()[0] - data_table_entry = dict(genome=genome_version,value=name, name=name) - _add_data_table_entry( data_manager_dict, 'snpeff_regulationdb', data_table_entry ) - elif fname in annotations_dict: - value = annotations_dict[fname] - name = value.lstrip('-') - data_table_entry = dict(genome=genome_version,value=value, name=name) - _add_data_table_entry( data_manager_dict, 'snpeff_annotations', data_table_entry ) - return data_manager_dict - -def _add_data_table_entry( data_manager_dict, data_table, data_table_entry ): - data_manager_dict['data_tables'] = data_manager_dict.get( 'data_tables', {} ) - data_manager_dict['data_tables'][data_table] = data_manager_dict['data_tables'].get( data_table, [] ) - data_manager_dict['data_tables'][data_table].append( data_table_entry ) - return data_manager_dict - -def main(): - #Parse Command Line - parser = optparse.OptionParser() - parser.add_option( '-j', '--jar_path', dest='jar_path', action='store', type="string", default=None, help='snpEff.jar path' ) - parser.add_option( '-c', '--config', dest='config', action='store', type="string", default=None, help='snpEff.config path' ) - parser.add_option( '-g', '--genome_version', dest='genome_version', action='store', type="string", default=None, help='genome_version' ) - parser.add_option( '-o', '--organism', dest='organism', action='store', type="string", default=None, help='organism name' ) - (options, args) = parser.parse_args() - - filename = args[0] - - params = from_json_string( open( filename ).read() ) - target_directory = params[ 'output_data' ][0]['extra_files_path'] - os.mkdir( target_directory ) - data_manager_dict = {} - - - #Create SnpEff Reference Data - for genome_version, organism in zip(options.genome_version.split(','), options.organism.split(',')): - download_database( data_manager_dict, target_directory, options.jar_path, options.config, genome_version, organism ) - - #save info to json file - open( filename, 'wb' ).write( to_json_string( data_manager_dict ) ) - -if __name__ == "__main__": main() -
--- a/data_manager/data_manager_snpEff_download.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,51 +0,0 @@ -<tool id="data_manager_snpeff_download" name="SnpEff Download" version="3.4" tool_type="manage_data"> - <description>Download a new database</description> - <requirements> - <requirement type="package" version="3.4">snpEff</requirement> - </requirements> - <command interpreter="python"> - data_manager_snpEff_download.py --jar_path \$SNPEFF_JAR_PATH/snpEff.jar --config \$SNPEFF_JAR_PATH/snpEff.config - --genome_version "${genome_databases.fields.value}" - --organism "${genome_databases.fields.name}" - "$out_file" - </command> - <inputs> - <param name="genome_databases" type="select" display="checkboxes" multiple="true" label="Genome Version"> - <options from_data_table="snpeff_databases"> - <filter type="sort_by" column="0" /> - </options> - </param> - </inputs> - - <outputs> - <data name="out_file" format="data_manager_json" label="${tool.name} : ${genome_databases.fields.value}"/> - </outputs> - <stdio> - <exit_code range=":-1" level="fatal" description="Error: Cannot open file" /> - <exit_code range="1:" level="fatal" description="Error" /> - </stdio> - <tests> - <test> - <param name="genome_databases" value="GRCh37.71"/> - <output name="out_file"> - <assert_contents> - <!-- Check that a genome was added --> - <has_text text="GRCh37.71" /> - <has_text text="snpeff_regulationdb" /> - <has_text text="snpeff_annotations" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -This tool downloads a SnpEff database. - -For details about this tool, please go to http://snpEff.sourceforge.net - -Please cite: -"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process] - - </help> -</tool> -
--- a/data_manager_conf.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,42 +0,0 @@ -<?xml version="1.0"?> -<data_managers> - <data_manager tool_file="data_manager/data_manager_snpEff_databases.xml" id="data_manager_snpeff_databases" > - <data_table name="snpeff_databases"> <!-- Defines a Data Table to be modified. --> - <output> <!-- Handle the output of the Data Manager Tool --> - <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="name" /> <!-- columns that are going to be specified by the Data Manager Tool --> - </output> - </data_table> - </data_manager> - <data_manager tool_file="data_manager/data_manager_snpEff_download.xml" id="data_manager_snpeff_download" > - <data_table name="snpeff_genomedb"> <!-- Defines a Data Table to be modified. --> - <output> <!-- Handle the output of the Data Manager Tool --> - <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="name" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="path" output_ref="out_file" > - <move type="directory" relativize_symlinks="True"> - <target base="${GALAXY_DATA_MANAGER_DATA_PATH}">snpEff/data</target> - </move> - <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/snpEff/data</value_translation> - <value_translation type="function">abspath</value_translation> - </column> - </output> - </data_table> - <data_table name="snpeff_regulationdb"> <!-- Defines a Data Table to be modified. --> - <output> <!-- Handle the output of the Data Manager Tool --> - <column name="genome" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="name" /> <!-- columns that are going to be specified by the Data Manager Tool --> - </output> - </data_table> - <data_table name="snpeff_annotations"> <!-- Defines a Data Table to be modified. --> - <output> <!-- Handle the output of the Data Manager Tool --> - <column name="genome" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="value" /> <!-- columns that are going to be specified by the Data Manager Tool --> - <column name="name" /> <!-- columns that are going to be specified by the Data Manager Tool --> - </output> - </data_table> - </data_manager> -</data_managers> - -
--- a/datatypes_conf.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,10 +0,0 @@ -<?xml version="1.0"?> -<datatypes> - <datatype_files> - <datatype_file name="snpeff.py"/> - </datatype_files> - <registration> - <datatype extension="snpeffdb" type="galaxy.datatypes.snpeff:SnpEffDb" display_in_upload="True"/> - </registration> -</datatypes> -
--- a/lib/galaxy/datatypes/snpeff.py Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,46 +0,0 @@ -""" -SnpEff datatypes -""" -import os,os.path,re,sys -import galaxy.datatypes.data -from galaxy.datatypes.data import Text -from galaxy.datatypes.metadata import MetadataElement - -class SnpEffDb( Text ): - """Class describing an IGV tiled data file (TDF) .tdf binary file""" - file_ext = "snpeffdb" - MetadataElement( name="genome_version", default=None, desc="Genome Version", readonly=True, visible=True, no_value=None ) - MetadataElement( name="regulation", default=[], desc="Regulation Names", readonly=True, visible=True, no_value=[] ) - MetadataElement( name="annotation", default=[], desc="Annotation Names", readonly=True, visible=True, no_value=[] ) - - def __init__( self, **kwd ): - Text.__init__( self, **kwd ) - - def set_meta( self, dataset, **kwd ): - Text.set_meta(self, dataset, **kwd ) - data_dir = dataset.extra_files_path - ## search data_dir/genome_version for files - regulation_pattern = 'regulation_(.+).bin' - # annotation files that are included in snpEff by a flag - annotations_dict = {'nextProt.bin' : '-nextprot','motif.bin': '-motif'} - regulations = [] - annotations = [] - if data_dir and os.path.isdir(data_dir): - for root, dirs, files in os.walk(data_dir): - for fname in files: - if fname.startswith('snpEffectPredictor'): - # if snpEffectPredictor.bin download succeeded - genome_version = os.path.basename(root) - dataset.metadata.genome_version = genome_version - else: - m = re.match(regulation_pattern,fname) - if m: - name = m.groups()[0] - regulations.append(name) - elif fname in annotations_dict: - value = annotations_dict[fname] - name = value.lstrip('-') - annotations.append(name) - dataset.metadata.regulation = regulations - dataset.metadata.annotation = annotations -
--- a/readme.rst Wed Dec 11 08:53:32 2013 -0500 +++ b/readme.rst Thu Jan 22 08:28:37 2015 -0500 @@ -1,24 +1,38 @@ -These are galaxy tools for SnpEff a variant annotation and effect prediction tool by Pablo Cingolani. +SnpEff wrappers +=============== + +These are galaxy tools for SnpEff_, a variant annotation and effect prediction tool by Pablo Cingolani. It annotates and predicts the effects of variants on genes (such as amino acid changes). -( http://snpeff.sourceforge.net/ ) + +.. _SnpEff: http://snpeff.sourceforge.net/ + -This repository contains a tool_dependencies.xml file that will attempt to automatically install SnpEff and SnpSift. +This repository let you automatically install SnpEff and SnpSift. +This will use the default location for genome reference downloads from the ``snpEff.config`` file: + + data_dir = ~/snpEff/data/ -This will use the default location for genome reference downloads from the snpEff.config: -data_dir = ~/snpEff/data/ -You can manually edit the installed snpEff.config and change the location, or you can create a symbolic link to the desired data location from ~/snpEff. +You can manually edit the installed ``snpEff.config`` file and change the location, or you can create a symbolic link to the desired data location from ``~/snpEff``. + +The genome reference options used by the tools "SnpEff" (snpEff.xml) and "SnpEff Download" (snpEff_download.xml) are taken from the ``tool-data/snpeffect_genomedb.loc`` file. +You can fill this file by running the following command: -The genome reference options used by the tools: - "SnpEff" snpEff.xml - "SnpEff Download" snpEff_download.xml -are taken from: tool-data/snpeffect_genomedb.loc + java -jar snpEff.jar databases | tail -n +3 | cut -f 1,2 | awk '{ gsub(/_/, " ", $2); printf "%s\\t%s : %s\\n", $1, $2, $1 }' | sort -k 2 > snpeffect_genomedb.loc + +There are 2 datamanagers to download and install prebuilt SnpEff genome databases: + +* data_manager_snpeff_databases: generates a list of available SnpEff genome databases into the ``tool-data/snpeff_databases.loc`` file +* data_manager_snpeff_download: downloads a SnpEff genome database selected from ``tool-data/snpeff_databases.loc`` and adds entries to ``snpeff_genomedb.loc``, ``snpeff_regulationdb.loc`` and ``snpeff_annotations.loc`` + +SnpEff citation: |Cingolani2012program|_. -There are 2 datamanagers to download and install prebuilt SnpEff Genome databases: - data_manager_snpeff_databases - generates a list of available SnpEff genome databases into the tool-data/snpeff_databases.loc - data_manager_snpeff_download - downloads a SnpEff genome database selected from: tool-data/snpeff_databases.loc and adds entries to snpeff_genomedb.loc,snpeff_regulationdb.loc,snpeff_annotations.loc +.. |Cingolani2012program| replace:: Cingolani, P., Platts, A., Wang, L. L., Coon, M., Nguyen, T., Wang, L., Land, S. J., Lu, X., Ruden, D. M. (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of *Drosophila melanogaster* strain w1118; iso-2; iso-3. *Fly* 6(2):80-92 +.. _Cingolani2012program: https://www.landesbioscience.com/journals/fly/article/19695/ + +SnpSift citation: |Cingolani2012using|_. -SnpEff citation: -"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process] +.. |Cingolani2012using| replace:: Cingolani, P., Patel, V. M., Coon, M., Nguyen, T., Land, S. J., Ruden, D. M., Lu, X. (2012) Using *Drosophila melanogaster* as a model for genotoxic chemical mutational studies with a new program, SnpSift. *Front. Genet.* 3:35 +.. _Cingolani2012using: http://journal.frontiersin.org/Journal/10.3389/fgene.2012.00035/ -SnpSift citation: -"Using Drosophila melanogaster as a model for genotoxic chemical mutational studies with a new program, SnpSift", Cingolani, P., et. al., Frontiers in Genetics, 3, 2012. +Wrapper authors: Jim Johnson +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,4 @@ +<?xml version="1.0"?> +<repositories description="This requires the SnpEff datatype definitions."> + <repository name="snpeff_datatypes" owner="iuc" changeset_revision="d78b2b2a3388" toolshed="http://toolshed.g2.bx.psu.edu" /> +</repositories>
--- a/snpEff.xml Wed Dec 11 08:53:32 2013 -0500 +++ b/snpEff.xml Thu Jan 22 08:28:37 2015 -0500 @@ -1,13 +1,14 @@ -<tool id="snpEff" name="SnpEff" version="3.4"> +<tool id="snpEff" name="SnpEff" version="@WRAPPER_VERSION@.0"> <description>Variant effect and annotation</description> <expand macro="requirements" /> <macros> <import>snpEff_macros.xml</import> </macros> <command> +<![CDATA[ java -Xmx6G -jar \$SNPEFF_JAR_PATH/snpEff.jar eff -c \$SNPEFF_JAR_PATH/snpEff.config - -i $inputFormat -o $outputFormat -upDownStreamLen $udLength + -i $inputFormat -o ${outputConditional.outputFormat} -upDownStreamLen $udLength #if $spliceSiteSize and $spliceSiteSize.__str__ != '': -spliceSiteSize $spliceSiteSize #end if @@ -34,7 +35,7 @@ #if $statsFile: -stats $statsFile #end if - #if $offset.__str__ != '': + #if $offset.__str__ != 'default': ${offset} #end if #if $chr.__str__.strip() != '': @@ -66,7 +67,19 @@ -download $snpDb.genome_version #end if - $input > $snpeff_output + $input > $snpeff_output ; + #if $statsFile: + #import os + #set $genes_file = str($statsFile) + '.genes.txt' + #set $genes_file_name = os.path.split($genes_file)[-1] + mkdir $statsFile.files_path; + mv $genes_file #echo os.path.join($statsFile.files_path, $genes_file_name)#; + #end if + #if $outputConditional.outputFormat == 'gatk' and $outputConditional.gatk_v1 + ## Replace real SnpEff version with 2.0.5 to prevent this GATK 1.x error: "The version of SnpEff used to generate the SnpEff input file (x.x) is not currently supported by the GATK. Supported versions are: [2.0.5]" + sed -i 's/^\#\#SnpEffVersion="\(\S*\s\)/\#\#SnpEffVersion="2.0.5 - real is \1/' $snpeff_output + #end if +]]> </command> <inputs> <param format="vcf,tabular,pileup,bed" name="input" type="data" label="Sequence changes (SNPs, MNPs, InDels)"/> @@ -78,12 +91,22 @@ <option value="bed">BED (Deprecated)</option> </param> - <param name="outputFormat" type="select" label="Output format"> - <option value="vcf" selected="true">VCF (only if input is VCF)</option> - <option value="txt">Tabular</option> - <option value="bed">BED</option> - <option value="bedAnn">BED Annotations</option> - </param> + <conditional name="outputConditional"> + <param name="outputFormat" type="select" label="Output format"> + <option value="vcf" selected="true">VCF (only if input is VCF)</option> + <option value="gatk">GATK-compatible VCF (only if input is VCF)</option> + <option value="txt">Tabular</option> + <option value="bed">BED</option> + <option value="bedAnn">BED annotations</option> + </param> + <when value="vcf" /> + <when value="gatk"> + <param name="gatk_v1" type="boolean" checked="true" label="Compatible with GATK 1.x" /> + </when> + <when value="txt" /> + <when value="bed" /> + <when value="bedAnn" /> + </conditional> <conditional name="snpDb"> <param name="genomeSrc" type="select" label="Genome source"> @@ -94,35 +117,41 @@ <when value="cached"> <param name="genomeVersion" type="select" label="Genome"> <!--GENOME DESCRIPTION--> - <options from_data_table="snpeff_genomedb"> - <filter type="unique_value" column="0" /> + <options from_data_table="snpeffv_genomedb"> + <filter type="static_value" name="snpeff_version" value="@SNPEFF_VERSION@" column="1"/> + <filter type="unique_value" column="2" /> </options> </param> - <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional Annotations"> + <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional annotations"> <help>These are available for only a few genomes</help> - <options from_data_table="snpeff_annotations"> - <filter type="param_value" ref="genomeVersion" key="genome" column="0" /> - <filter type="unique_value" column="1" /> + <options from_data_table="snpeffv_annotations"> + <filter type="param_value" ref="genomeVersion" key="genome" column="2" /> + <filter type="unique_value" column="3" /> </options> </param> - <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory Annotation"> + <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory annotation"> <help>These are available for only a few genomes</help> - <options from_data_table="snpeff_regulationdb"> - <filter type="param_value" ref="genomeVersion" key="genome" column="0" /> - <filter type="unique_value" column="1" /> + <options from_data_table="snpeffv_regulationdb"> + <filter type="param_value" ref="genomeVersion" key="genome" column="2" /> + <filter type="unique_value" column="3" /> </options> </param> </when> <when value="history"> - <param format="snpeffdb" name="snpeff_db" type="data" label="SnpEff Genome Version Data"/> + <param format="snpeffdb" name="snpeff_db" type="data" label="@SNPEFF_VERSION@ Genome Data"> + <options options_filter_attribute="metadata.snpeff_version" > + <filter type="add_value" value="@SNPEFF_VERSION@" /> + </options> + <validator type="expression" message="This version of SnpEff will only work with @SNPEFF_VERSION@ Genome databases.">value is not None and value.metadata.snpeff_version == "@SNPEFF_VERSION@"</validator> + </param> <!-- From metadata --> - <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional Annotations"> + <param name="extra_annotations" type="select" display="checkboxes" multiple="true" label="Additional annotations"> <help>These are available for only a few genomes</help> <options> <filter type="data_meta" ref="snpeff_db" key="annotation" /> </options> </param> - <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory Annotation"> + <param name="regulation" type="select" display="checkboxes" multiple="true" label="Non-coding and regulatory annotation"> <help>These are available for only a few genomes</help> <options> <filter type="data_meta" ref="snpeff_db" key="regulation" /> @@ -130,7 +159,10 @@ </param> </when> <when value="named"> - <param name="genome_version" type="text" value="GRCh37.68" label="Snpff Version Name"/> + <param name="genome_version" type="text" size="40" value="" label="Snpff Genome Version Name (e.g. GRCh38.76)"> + <help>@SNPEFF_DATABASE_URL@</help> + <validator type="regex" message="A genome version name is required">\S+</validator> + </param> </when> </conditional> @@ -147,7 +179,7 @@ <param name="spliceSiteSize" type="select" optional="true" label="Set size for splice sites (donor and acceptor) in bases" help="Default: 2"> <option value="1">1 base</option> - <option value="2">2 bases</option> + <option value="2" selected="true">2 bases</option> <option value="3">3 bases</option> <option value="4">4 bases</option> <option value="5">5 bases</option> @@ -159,28 +191,29 @@ <param name="filterHomHet" type="select" display="radio" label="Filter homozygous / heterozygous changes"> <option value="no_filter" selected="true">No filter (analyze everything)</option> - <option value="-hom">Analyze homozygous sequence changes only </option> - <option value="-het">Analyze heterozygous sequence changes only </option> + <option value="-hom">Analyze homozygous sequence changes only</option> + <option value="-het">Analyze heterozygous sequence changes only</option> </param> <!-- The tool testing code can not handle select,radio,check boxes values that start with '-', so the '-' is added in the command generation --> <param name="filterIn" type="select" display="radio" label="Filter sequence changes"> <option value="no_filter" selected="true">No filter (analyze everything)</option> - <option value="-del">Analyze deletions only </option> - <option value="-ins">Analyze insertions only </option> - <option value="-mnp">Only MNPs (multiple nucleotide polymorphisms) </option> - <option value="-snp">Only SNPs (single nucleotide polymorphisms) </option> + <option value="-del">Analyze deletions only</option> + <option value="-ins">Analyze insertions only</option> + <option value="-mnp">Only MNPs (multiple nucleotide polymorphisms)</option> + <option value="-snp">Only SNPs (single nucleotide polymorphisms)</option> </param> <param name="annotations" type="select" display="checkboxes" multiple="true" label="Annotation options"> - <option value="-cancer">Perform 'cancer' comparissons (Somatic vs Germline)</option> + <option value="-cancer">Perform 'cancer' comparisons (somatic vs. germline)</option> <option value="-canon">Only use canonical transcripts</option> <option value="-geneId">Use gene ID instead of gene name (VCF output)</option> - <option value="-hgvs">Use HGVS annotations for amino acid sub-field</option> - <option value="-lof">Add loss of function (LOF) and Nonsense mediated decay (NMD) tags</option> + <option value="-lof">Add loss of function (LOF) and nonsense mediated decay (NMD) tags</option> <option value="-oicr">Add OICR tag in VCF file</option> <option value="-onlyReg">Only use regulation tracks</option> - <option value="-sequenceOntolgy">Use Sequence Ontolgy terms.</option> + <option value="-classic">Use Classic Effect names and amino acid variant annotations (NON_SYNONYMOUS_CODING vs missense_variant and G180R vs p.Gly180Arg/c.538G>C)</option> + <option value="-hgvs">Override classic and use HGVS annotations for amino acid annotations (p.Gly180Arg/c.538G>C vs G180R)</option> + <option value="-sequenceOntology">Override classic and use Sequence Ontolgy terms for effects (missense_variant vs NON_SYNONYMOUS_CODING)</option> </param> <param name="intervals" format="bed" type="data" optional="true" label="Use custom interval file for annotation"/> <param name="transcripts" format="tabular" type="data" optional="true" label="Only use the transcripts in this file." help="Format is one transcript ID per line."/> @@ -193,7 +226,7 @@ </param> <param name="offset" type="select" display="radio" optional="true" label="Chromosomal position"> - <option value="" selected="true">Use default (based on input type)</option> + <option value="default" selected="true">Use default (based on input type)</option> <option value="-0">Force zero-based positions (both input and output)</option> <option value="-1">Force one-based positions (both input and output)</option> </param> @@ -210,13 +243,12 @@ <outputs> <data format="vcf" name="snpeff_output" > <change_format> - <when input="outputFormat" value="vcf" format="vcf" /> - <when input="outputFormat" value="txt" format="tabular" /> - <when input="outputFormat" value="bed" format="bed" /> - <when input="outputFormat" value="bedAnn" format="bed" /> + <when input="outputConditional.outputFormat" value="txt" format="tabular" /> + <when input="outputConditional.outputFormat" value="bed" format="bed" /> + <when input="outputConditional.outputFormat" value="bedAnn" format="bed" /> </change_format> </data> - <data format="html" name="statsFile"> + <data format="html" name="statsFile" label="${tool.name} on ${on_string} - stats"> <filter>generate_stats == True</filter> </data> </outputs> @@ -280,7 +312,7 @@ <param name="genome_version" value="testCase"/> <param name="udLength" value="0"/> <param name="filterHomHet" value="no_filter"/> - <param name="filterIn" value="del"/> + <param name="filterIn" value="+-del"/> <!-- <param name="filterOut" value=""/> --> @@ -326,5 +358,6 @@ @CITATION_SECTION@ </help> + <expand macro="citations" /> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/snpEff_databases.xml Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,26 @@ +<tool id="snpEff_databases" name="SnpEff Available Databases" version="@WRAPPER_VERSION@.0"> + <description></description> + <expand macro="requirements" /> + <macros> + <import>snpEff_macros.xml</import> + </macros> + <command> +<![CDATA[ + java -jar \$SNPEFF_JAR_PATH/snpEff.jar databases | grep -v '^---' | sed 's/^Genome/#Genome/' | sed 's/ *//g' > $snpeff_dbs +]]> + </command> + <inputs> + </inputs> + <outputs> + <data format="tabular" name="snpeff_dbs" label="${tool.name} @SNPEFF_VERSION@ available databases" /> + </outputs> + <expand macro="stdio" /> + <help> + +@EXTERNAL_DOCUMENTATION@ + +@CITATION_SECTION@ + + </help> +</tool> +
--- a/snpEff_download.xml Wed Dec 11 08:53:32 2013 -0500 +++ b/snpEff_download.xml Thu Jan 22 08:28:37 2015 -0500 @@ -1,23 +1,22 @@ -<tool id="snpEff_download" name="SnpEff Download" version="3.4"> +<tool id="snpEff_download" name="SnpEff Download" version="@WRAPPER_VERSION@.0"> <description>Download a new database</description> <expand macro="requirements" /> <macros> <import>snpEff_macros.xml</import> </macros> <command> - echo $genomeVersion > $snpeff_db; - java -jar \$SNPEFF_JAR_PATH/snpEff.jar download -c \$SNPEFF_JAR_PATH/snpEff.config -dataDir $snpeff_db.extra_files_path -v $genomeVersion > $logfile +<![CDATA[ + java -jar \$SNPEFF_JAR_PATH/snpEff.jar download -c \$SNPEFF_JAR_PATH/snpEff.config -dataDir $snpeff_db.files_path -v $genome_version +]]> </command> <inputs> - <param name="genomeVersion" type="select" label="Select the genome version you want to download"> - <options from_data_table="snpeff_databases"> - <filter type="sort_by" column="0" /> - </options> + <param name="genome_version" type="text" size="40" value="" label="Select the genome version you want to download (e.g. GRCh37.74)"> + <help>@SNPEFF_DATABASE_URL@</help> + <validator type="regex" message="A genome version name is required">\S+</validator> </param> </inputs> <outputs> - <data format="txt" name="logfile" /> - <data format="snpeffdb" name="snpeff_db" label="${genomeVersion}" /> + <data format="snpeffdb" name="snpeff_db" label="${tool.name} @SNPEFF_VERSION@ ${genome_version}" /> </outputs> <expand macro="stdio" /> <help> @@ -27,5 +26,6 @@ @CITATION_SECTION@ </help> + <expand macro="citations" /> </tool>
--- a/snpEff_macros.xml Wed Dec 11 08:53:32 2013 -0500 +++ b/snpEff_macros.xml Thu Jan 22 08:28:37 2015 -0500 @@ -1,7 +1,7 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="3.4">snpEff</requirement> + <requirement type="package" version="4.0">snpEff</requirement> </requirements> </xml> <xml name="stdio"> @@ -10,9 +10,13 @@ <exit_code range="1:" level="fatal" description="Error" /> </stdio> </xml> + <token name="@WRAPPER_VERSION@">4.0</token> + <token name="@SNPEFF_VERSION@">SnpEff4.0</token> + <token name="@SNPEFF_DATABASE_URL@">https://snpeff-data.galaxyproject.org/databases/v4_0/</token> <token name="@EXTERNAL_DOCUMENTATION@"> -For details about this tool, please go to http://snpeff.sourceforge.net/SnpSift.html#intervals +For details about this tool, please go to: + http://snpeff.sourceforge.net/SnpEff_manual.html </token> <token name="@CITATION_SECTION@">------ @@ -22,10 +26,13 @@ For the underlying tool, please cite the following two publications: SnpEff citation: -"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly (Austin). 2012 Apr-Jun;6(2):80-92. PMID: 22728672 [PubMed - in process] - -SnpSift citation: -"Using Drosophila melanogaster as a model for genotoxic chemical mutational studies with a new program, SnpSift", Cingolani, P., et. al., Frontiers in Genetics, 3, 2012. +"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM. Fly 6(2):80-92, 2012 </token> + <xml name="citations"> + <citations> + <citation type="doi">10.4161/fly.19695</citation> + <yield /> + </citations> + </xml> </macros>
--- a/snpSift_annotate.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,99 +0,0 @@ -<tool id="snpSift_annotate" name="SnpSift Annotate" version="3.4"> - <description>SNPs from dbSnp</description> - <!-- - You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory) - --> - <expand macro="requirements" /> - <macros> - <import>snpEff_macros.xml</import> - </macros> - <command> - java -Xmx6G -jar \$SNPEFF_JAR_PATH/SnpSift.jar $annotate_cmd - #if $annotate.id : - -id - #elif $annotate.info_ids.__str__.strip() != '' : - -info "$annotate.info_ids" - #end if - -q $dbSnp $input > $output - </command> - <inputs> - <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/> - <param format="vcf" name="dbSnp" type="data" label="VCF File with ID field annotated (e.g. dnSNP.vcf)" - help="The ID field for a variant in input will be assigned from a matching variant in this file."/> - <conditional name="annotate"> - <param name="id" type="boolean" truevalue="id" falsevalue="info" checked="True" label="Only annotate ID field (do not add INFO field)" help=""/> - <when value="id"/> - <when value="info"> - <param name="info_ids" type="text" value="" size="60" optional="true" label="Limit INFO annotation to these INFO IDs" - help="list is a comma separated list of fields. When blank, all INFO fields are included"> - <validator type="regex" message="IDs separted by commas">^(([a-zA-Z][a-zA-Z0-9_-]*)(,[a-zA-Z][a-zA-Z0-9_-]*)*)?$</validator> - </param> - </when> - </conditional> - <param name="annotate_cmd" type="boolean" truevalue="annMem" falsevalue="annotate" checked="false" label="Allow unsorted VCF files"> - <help> - This option will load the entire 'database' VCF file into memory (which may not be practical for large 'database' VCF files). - Otherwise, both the database and the input VCF files should be sorted by position (Chromosome sort order can differ between files). - </help> - </param> - </inputs> - <expand macro="stdio" /> - <outputs> - <data format="vcf" name="output" /> - </outputs> - <tests> - <test> - <param name="input" ftype="vcf" value="annotate_1.vcf"/> - <param name="dbSnp" ftype="vcf" value="db_test_1.vcf"/> - <param name="annotate_cmd" value="False"/> - <param name="id" value="True"/> - <output name="output"> - <assert_contents> - <has_text text="rs76166080" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -This is typically used to annotate IDs from dbSnp. - -Annotatating only the ID field from dbSnp137.vcf :: - - Input VCF: - CHROM POS ID REF ALT QUAL FILTER INFO - 22 16157571 . T G 0.0 FAIL NS=53 - 22 16346045 . T C 0.0 FAIL NS=244 - 22 16350245 . C A 0.0 FAIL NS=192 - - Annotated Output VCF: - #CHROM POS ID REF ALT QUAL FILTER INFO - 22 16157571 . T G 0.0 FAIL NS=53 - 22 16346045 rs56234788 T C 0.0 FAIL NS=244 - 22 16350245 rs2905295 C A 0.0 FAIL NS=192 - - - -Annotatating both the ID and INFO fields from dbSnp137.vcf :: - - Input VCF: - #CHROM POS ID REF ALT QUAL FILTER INFO - 22 16157571 . T G 0.0 FAIL NS=53 - 22 16346045 . T C 0.0 FAIL NS=244 - 22 16350245 . C A 0.0 FAIL NS=192 - - Annotated Output VCF: - #CHROM POS ID REF ALT QUAL FILTER INFO - 22 16157571 . T G 0.0 FAIL NS=53 - 22 16346045 rs56234788 T C 0.0 FAIL NS=244;RSPOS=16346045;GMAF=0.162248628884826;dbSNPBuildID=129;SSR=0;SAO=0;VP=050100000000000100000100;WGT=0;VC=SNV;SLO;GNO - 22 16350245 rs2905295 C A 0.0 FAIL NS=192;RSPOS=16350245;GMAF=0.230804387568556;dbSNPBuildID=101;SSR=1;SAO=0;VP=050000000000000100000140;WGT=0;VC=SNV;GNO - - -@EXTERNAL_DOCUMENTATION@ - -@CITATION_SECTION@ - - - </help> -</tool> -
--- a/snpSift_caseControl.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,121 +0,0 @@ -<tool id="snpSift_caseControl" name="SnpSift CaseControl" version="3.4"> - <description>Count samples are in 'case' and 'control' groups.</description> - <!-- - You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory) - --> - <expand macro="requirements" /> - <macros> - <import>snpEff_macros.xml</import> - </macros> - <command> - java -Xmx1G -jar \$SNPEFF_JAR_PATH/SnpSift.jar caseControl -q - #if $name.__str__.strip() != '': - -name $name - #end if - #if $ctrl.ctrl_src == 'caseString': - '$ctrl.caseControlStr' - #else - -tfam "$ctrl.tfam" - #end if - $input > $output - </command> - <inputs> - <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/> - <conditional name="ctrl"> - <param name="ctrl_src" type="select" label="Case Control defined in"> - <option value="caseString">Case Control String</option> - <option value="tfam">TFAM file</option> - </param> - <when value="caseString"> - <param name="caseControlStr" type="text" label="Case / Control column designation" size="50"> - <help> - Case and control are defined by a string containing plus and minus symbols {'+', '-', '0'} where '+' is case, '-' is control and '0' is neutral - </help> - <validator type="regex" message="must be only plus(+), minus(-), or zero(0) characters">[+-0]+</validator> - </param> - </when> - <when value="tfam"> - <param format="tabular" name="tfam" type="data" label="PLINK TFAM file" help="Read more about TFAM at http://pngu.mgh.harvard.edu/~purcell/plink/data.shtml#tr"/> - </when> - </conditional> - <param name="name" type="text" optional="true" label="name" help="name to append to the 'Cases' or 'Controls' tags"> - <validator type="regex" message="Use only valid ID characters">[_a-zA-Z0-9]+</validator> - </param> - </inputs> - <outputs> - <data format="vcf" name="output" /> - </outputs> - <expand macro="stdio" /> - <tests> - <test> - <param name="input" ftype="vcf" value="test.private.01.vcf"/> - <param name="ctrl_src" value="caseString"/> - <param name="caseControlStr" value="--"/> - <output name="output"> - <assert_contents> - <has_text text="Cases=0,0,0;" /> - <has_text text="Controls=0,0,0;" /> - </assert_contents> - </output> - </test> - - <test> - <param name="input" ftype="vcf" value="test.private.02.vcf"/> - <param name="ctrl_src" value="caseString"/> - <param name="caseControlStr" value="--"/> - <output name="output"> - <assert_contents> - <has_text text="Cases=0,0,0;" /> - <has_text text="Controls=2,0,4;" /> - </assert_contents> - </output> - </test> - - <test> - <param name="input" ftype="vcf" value="test.private.02.vcf"/> - <param name="name" value=""/> - <param name="ctrl_src" value="caseString"/> - <param name="caseControlStr" value="-+"/> - <output name="output"> - <assert_contents> - <has_text text="Cases=1,0,2;" /> - <has_text text="Controls=1,0,2;" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -**SnpSift CaseControl** - -Allows you to count how many samples are in 'case' group and a 'control' group. You can count 'homozygous', 'heterozygous' or 'any' variants. - -Case and control are defined by a string containing plus and minus symbols {'+', '-', '0'} where '+' is case, '-' is control and '0' is neutral. - -This command adds two annotations to the VCF file: - - - **CaseControl**: Two comma separated numbers numbers representing the number of samples that have the variant in the case and the control group. Example: - - "CaseControl=3,4" *the variant is present in 3 cases and 4 controls.* - - - - **CaseControlP**: A p-value (Fisher exact test) that the number of cases is N or more. Example: - - "CaseControl=4,0;CaseControlP=3.030303e-02" *in this case the pValue of having 4 or more cases and zero controls is 0.03* - - -For example, if we have ten samples (which means ten genotype columns in the VCF file), the first four are 'case' and the last six are 'control', so the description string would be "++++------". Let's say we want to distinguish genotypes that are homozygous in 'case' and either homozygous or heterozygous in 'control'. We would set: - - - Hom/Het case = "hom" - - - Hom/Het control = "any" - - - Case / Control column designation = ""++++------" - - -@EXTERNAL_DOCUMENTATION@ - -@CITATION_SECTION@ - - </help> -</tool>
--- a/snpSift_filter.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,148 +0,0 @@ -<tool id="snpSift_filter" name="SnpSift Filter" version="3.4"> - <options sanitize="False" /> - <description>Filter variants using arbitrary expressions</description> - <expand macro="requirements" /> - <macros> - <import>snpEff_macros.xml</import> - </macros> - <command> - java -Xmx6G -jar \$SNPEFF_JAR_PATH/SnpSift.jar filter -f $input -e $exprFile $inverse - #if $filtering.mode == 'field': - #if $filtering.replace.pass: - --pass - #if $filtering.replace.filterId and len($filtering.replace.filterId.__str__.strip()) > 0: - --filterId "$filtering.replace.filterId" - #end if - #end if - #if $filtering.addFilter and len($filtering.addFilter.__str__.strip()) > 0: - --addFilter "$filtering.addFilter" - #end if - #if $filtering.rmFilter and len($filtering.rmFilter.__str__.strip()) > 0: - --rmFilter "$filtering.rmFilter" - #end if - #end if - > $output - </command> - <inputs> - <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/> - <param name="expr" type="text" label="Filter criteria" size="160" help="Need help? See below a few examples." /> - <param name="inverse" type="boolean" truevalue="--inverse" falsevalue="" checked="false" label="Inverse filter" help="Show lines that do not match filter expression" /> - <conditional name="filtering"> - <param name="mode" type="select" label="Filter mode"> - <option value="entries" selected="true">Retain entries that pass filter, remove other entries</option> - <option value="field">Change the FILTER field, but retain all entries</option> - </param> - <when value="entries"/> - <when value="field"> - <conditional name="replace"> - <param name="pass" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Set matching entry FILTER to 'PASS'" - help="appends an ID tag to non-matching entry FILTER "/> - <when value="no"/> - <when value="yes"> - <param name="filterId" type="text" value="" optional="true" label="ID appended to non-matching (##FILTER tag in header and FILTER VCF field)." size="10" - help="Default ID is 'SnpSift'"/> - </when> - </conditional> - <param name="addFilter" type="text" value="" optional="true" label="Add a string to FILTER VCF field if 'expression' is true." size="10"/> - <param name="rmFilter" type="text" value="" optional="true" label="Remove a string from FILTER VCF field if 'expression' is true (and 'str' is in the field)." size="10"/> - </when> - </conditional> - </inputs> - <configfiles> - <configfile name="exprFile"> - $expr - </configfile> - </configfiles> - - <outputs> - <data format="vcf" name="output" /> - </outputs> - <expand macro="stdio" /> - <tests> - <test> - <param name="input" ftype="vcf" value="test01.vcf"/> - <param name="expr" value="QUAL >= 50"/> - <param name="mode" value="entries"/> - <output name="output"> - <assert_contents> - <has_text text="28837706" /> - <not_has_text text="NT_166464" /> - </assert_contents> - </output> - </test> - - <test> - <param name="input" ftype="vcf" value="test01.vcf"/> - <param name="expr" value="(CHROM = '19')"/> - <param name="mode" value="entries"/> - <output name="output"> - <assert_contents> - <has_text text="3205820" /> - <not_has_text text="NT_16" /> - </assert_contents> - </output> - </test> - - <test> - <param name="input" ftype="vcf" value="test01.vcf"/> - <param name="expr" value="(POS >= 20175) & (POS <= 35549)"/> - <param name="mode" value="entries"/> - <output name="output"> - <assert_contents> - <has_text text="20175" /> - <has_text text="35549" /> - <has_text text="22256" /> - <not_has_text text="18933" /> - <not_has_text text="37567" /> - </assert_contents> - </output> - </test> - - <test> - <param name="input" ftype="vcf" value="test01.vcf"/> - <param name="expr" value="( DP >= 5 )"/> - <param name="mode" value="entries"/> - <output name="output"> - <assert_contents> - <has_text text="DP=5;" /> - <has_text text="DP=6;" /> - <not_has_text text="DP=1;" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -**SnpSift filter** - -You can filter ia vcf file using arbitrary expressions, for instance "(QUAL > 30) | (exists INDEL) | ( countHet() > 2 )". The actual expressions can be quite complex, so it allows for a lot of flexibility. - -Some examples: - - - *I want to filter out samples with quality less than 30*: - - * **( QUAL > 30 )** - - - *...but we also want InDels that have quality 20 or more*: - - * **(( exists INDEL ) & (QUAL >= 20)) | (QUAL >= 30 )** - - - *...or any homozygous variant present in more than 3 samples*: - - * **(countHom() > 3) | (( exists INDEL ) & (QUAL >= 20)) | (QUAL >= 30 )** - - - *...or any heterozygous sample with coverage 25 or more*: - - * **((countHet() > 0) & (DP >= 25)) | (countHom() > 3) | (( exists INDEL ) & (QUAL >= 20)) | (QUAL >= 30 )** - - - *I want to keep samples where the genotype for the first sample is homozygous variant and the genotype for the second sample is reference*: - - * **isHom( GEN[0] ) & isVariant( GEN[0] ) & isRef( GEN[1] )** - - -@EXTERNAL_DOCUMENTATION@ - -@CITATION_SECTION@ - - </help> -</tool>
--- a/snpSift_int.xml Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,56 +0,0 @@ -<tool id="snpSift_int" name="SnpSift Intervals" version="3.4"> - <description>Filter variants using intervals</description> - <!-- - You can change the amount of memory used, just change the -Xmx parameter (e.g. use -Xmx2G for 2Gb of memory) - --> - <expand macro="requirements" /> - <macros> - <import>snpEff_macros.xml</import> - </macros> - <command> - java -Xmx2G -jar \$SNPEFF_JAR_PATH/SnpSift.jar intervals -i $input $exclude $bedFile > $output - </command> - <inputs> - <param format="vcf" name="input" type="data" label="Variant input file in VCF format"/> - <param format="bed" name="bedFile" type="data" label="Intervals (BED file)"/> - <param name="exclude" type="boolean" truevalue="-x" falsevalue="" checked="false" label="Exclude Intervals" - help="Filter out (exclude) VCF entries that match any interval in the BED files"/> - </inputs> - <outputs> - <data format="vcf" name="output" /> - </outputs> - <expand macro="stdio" /> - <tests> - <test> - <param name="input" ftype="vcf" value="annotate_5.vcf"/> - <param name="bedFile" ftype="bed" value="interval.bed"/> - <param name="exclude" value="False"/> - <output name="output"> - <assert_contents> - <has_text text="872687" /> - <not_has_text text="1195966" /> - </assert_contents> - </output> - </test> - <test> - <param name="input" ftype="vcf" value="annotate_5.vcf"/> - <param name="bedFile" ftype="bed" value="interval.bed"/> - <param name="exclude" value="True"/> - <output name="output"> - <assert_contents> - <has_text text="1195966" /> - <not_has_text text="872687" /> - </assert_contents> - </output> - </test> - </tests> - <help> - -You can filter using intervals (BED file). - -@EXTERNAL_DOCUMENTATION@ - -@CITATION_SECTION@ - - </help> -</tool>
--- a/test-data/annotate_1.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -1 872687 . C G . . .
--- a/test-data/annotate_5.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -1 872687 rs76166080 C G . . . -1 970878 . C T . . . -1 979690 rs115413462 G A . . . -1 1160967 . C T . . . -1 1195966 rs114569001 G A . . .
--- a/test-data/db_test_1.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -1 872687 rs76166080 C G 0 . .
--- a/test-data/interval.bed Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,10 +0,0 @@ -chr1 1 100000 -chr1 100000 200000 -chr1 200000 300000 -chr1 300000 400000 -chr1 400000 500000 -chr1 500000 600000 -chr1 600000 700000 -chr1 700000 800000 -chr1 800000 900000 -chr1 900000 1000000
--- a/test-data/test.private.01.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ -##fileformat=VCFv4.0 -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT id1 id2 -1 123456 . A G . . AF=0 GT 0/0 0/0
--- a/test-data/test.private.02.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ -##fileformat=VCFv4.0 -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT id1 id2 -1 123456 . A G . . AF=0 GT 1/1 1/1
--- a/test-data/test01.vcf Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1000 +0,0 @@ -##fileformat=VCFv4.1 -##samtoolsVersion=0.1.16 (r963:234) -##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth"> -##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases"> -##INFO=<ID=MQ,Number=1,Type=Integer,Description="Root-mean-square mapping quality of covering reads"> -##INFO=<ID=FQ,Number=1,Type=Float,Description="Phred probability of all samples being the same"> -##INFO=<ID=AF1,Number=1,Type=Float,Description="Max-likelihood estimate of the site allele frequency of the first ALT allele"> -##INFO=<ID=G3,Number=3,Type=Float,Description="ML estimate of genotype frequencies"> -##INFO=<ID=HWE,Number=1,Type=Float,Description="Chi^2 based HWE test P-value based on G3"> -##INFO=<ID=CI95,Number=2,Type=Float,Description="Equal-tail Bayesian credible interval of the site allele frequency at the 95% level"> -##INFO=<ID=PV4,Number=4,Type=Float,Description="P-values for strand bias, baseQ bias, mapQ bias and tail distance bias"> -##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL."> -##INFO=<ID=PC2,Number=2,Type=Integer,Description="Phred probability of the nonRef allele frequency in group1 samples being larger (,smaller) than in group2."> -##INFO=<ID=PCHI2,Number=1,Type=Float,Description="Posterior weighted chi^2 P-value for testing the association between group1 and group2 samples."> -##INFO=<ID=QCHI2,Number=1,Type=Integer,Description="Phred scaled PCHI2."> -##INFO=<ID=PR,Number=1,Type=Integer,Description="# permutations yielding a smaller PCHI2."> -##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> -##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> -##FORMAT=<ID=GL,Number=3,Type=Float,Description="Likelihoods for RR,RA,AA genotypes (R=ref,A=alt)"> -##FORMAT=<ID=DP,Number=1,Type=Integer,Description="# high-quality bases"> -##FORMAT=<ID=SP,Number=1,Type=Integer,Description="Phred-scaled strand bias P-value"> -##FORMAT=<ID=PL,Number=-1,Type=Integer,Description="List of Phred-scaled genotype likelihoods, number of values is (#ALT+1)*(#ALT+2)/2"> -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT s_1_BcA2.sort.rmdup.Q20.noMh.bam -NT_166464 696 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166464 745 . G C 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_166464 7258 . A C 40 . DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,2,1;MQ=32;FQ=-4.12;PV4=1,0.28,0.21,0.17 GT:PL:GQ 0/1:70,0,25:28 -NT_166464 7268 . A G 8.65 . DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,1,1;MQ=30;FQ=3.32;PV4=1,0.017,0,1 GT:PL:GQ 0/1:38,0,28:32 -NT_166464 7283 . T C 11.3 . DP=3;AF1=0.501;CI95=0.5,0.5;DP4=1,0,1,1;MQ=30;FQ=-4.81;PV4=1,1,0,1 GT:PL:GQ 0/1:41,0,24:28 -NT_166464 7335 . G A 18.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33 GT:PL:GQ 1/1:50,6,0:10 -NT_166464 8030 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166452 8268 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166452 16693 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166480 12474 . G A 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166480 12483 . A G 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166476 578 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166476 22223 . A C 3.01 . DP=4;AF1=0.4998;CI95=0.5,0.5;DP4=0,2,2,0;MQ=32;FQ=4.63;PV4=0.33,0.26,0,0.42 GT:PL:GQ 0/1:30,0,43:28 -NT_166476 22256 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166476 23076 . A T 8.44 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:39,6,0:8 -NT_166476 23487 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166454 64 . T A 8.64 . DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,4,2,0;MQ=29;FQ=11.3;PV4=0.14,1,1,1 GT:PL:GQ 0/1:38,0,91:40 -NT_166454 95 . T A 9.52 . DP=7;AF1=0.5;CI95=0.5,0.5;DP4=2,3,1,1;MQ=29;FQ=12.3;PV4=1,0.19,1,1 GT:PL:GQ 0/1:39,0,101:41 -NT_166454 1580 . T C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166454 7132 . A G 42.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:74,6,0:10 -NT_166454 7142 . T C 42.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:74,6,0:10 -NT_166454 7181 . C A 11.1 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:42,6,0:9 -NT_166454 11670 . C T 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -NT_166454 15049 . A T 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -NT_166454 15052 . TA T 35.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:74,6,0:10 -NT_166454 15373 . C G 30.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:62,6,0:10 -NT_166454 15388 . C G 22.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:54,6,0:10 -NT_166454 15440 . TA T 28.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -NT_166454 18840 . C T 6.79 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33 GT:PL:GQ 1/1:37,6,0:7 -NT_166454 18863 . T C 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -NT_166454 18933 . C T 4.77 . DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,2,0;MQ=30;FQ=-3.1;PV4=1,0.032,0,0.31 GT:PL:GQ 0/1:33,0,28:30 -NT_166454 21433 . G T 6.02 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:36,6,0:6 -NT_166454 21485 . TAAAAA TAAAA 17.5 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:57,9,0:15 -NT_166481 473 . A C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 476 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 558 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 9526 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 10879 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 17878 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 20402 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166481 20413 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166459 13329 . T G 20.1 . DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-5.45;PV4=1,0.48,1,0.33 GT:PL:GQ 0/1:50,0,23:26 -NT_166459 21532 . T C 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_166473 10619 . T A 4.13 . DP=4;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,0,3;MQ=28;FQ=-3.64;PV4=0.25,0.036,0,1 GT:PL:GQ 0/1:32,0,27:29 -NT_166473 10641 . A T 47.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=28;FQ=-39 GT:PL:GQ 1/1:80,12,0:21 -NT_166461 20175 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166462 4505 . A G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166462 4585 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166462 25794 . A C 7.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166462 25801 . T G 22.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:54,6,0:10 -NT_166462 25952 . T C 32.1 . DP=9;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=37;FQ=-45 GT:PL:GQ 1/1:65,18,0:33 -NT_166462 25967 . T C 135 . DP=9;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=37;FQ=-54 GT:PL:GQ 1/1:168,27,0:51 -NT_166462 26035 . T C 82 . DP=9;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=37;FQ=-54 GT:PL:GQ 1/1:115,27,0:51 -NT_166462 26537 . C G 83.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39 GT:PL:GQ 1/1:116,12,0:21 -NT_166462 26577 . A C 29.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39 GT:PL:GQ 1/1:62,12,0:21 -NT_166462 26682 . A G 222 . DP=19;AF1=1;CI95=1,1;DP4=0,0,9,9;MQ=30;FQ=-81 GT:PL:GQ 1/1:255,54,0:99 -NT_166462 26690 . A G 184 . DP=20;AF1=1;CI95=1,1;DP4=0,0,10,10;MQ=31;FQ=-87 GT:PL:GQ 1/1:217,60,0:99 -NT_166462 26717 . A G 207 . DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57 GT:PL:GQ 1/1:240,30,0:57 -NT_166462 26722 . T C 98 . DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57 GT:PL:GQ 1/1:131,30,0:57 -NT_166462 26762 . CAA CAAA 207 . INDEL;DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-64.5 GT:PL:GQ 1/1:248,30,0:57 -NT_166453 185 . A C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166453 198 . T G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166453 264 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166453 312 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166453 321 . C T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166453 20370 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166467 12821 . C T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166338 16706 . C A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166338 16707 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166338 16708 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166338 16774 . G C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166442 37512 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166442 37558 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166442 37567 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166451 487 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166450 27330 . T A 28 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:60,9,0:16 -NT_166450 27339 . T C 51 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:83,9,0:16 -NT_166450 27452 . G A 101 . DP=11;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=37;FQ=-57 GT:PL:GQ 1/1:134,30,0:57 -NT_166450 27483 . T C 67.3 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,3,2;MQ=37;FQ=-42 GT:PL:GQ 1/1:100,15,0:27 -NT_166450 27488 . T G 7.59 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -NT_166450 27538 . A G 12 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:43,6,0:9 -NT_166450 27561 . T C 48.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45 GT:PL:GQ 1/1:81,18,0:33 -NT_166450 27591 . T C 54.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45 GT:PL:GQ 1/1:87,18,0:33 -NT_166450 27618 . T C 77.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45 GT:PL:GQ 1/1:110,18,0:33 -NT_166450 27627 . A G 102 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=27;FQ=-45 GT:PL:GQ 1/1:135,18,0:33 -NT_166450 27651 . G A 10.2 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:41,6,0:8 -NT_166450 27659 . C A 65 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:97,9,0:16 -NT_166450 27664 . T C 31.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39 GT:PL:GQ 1/1:64,12,0:21 -NT_166450 27700 . T C 106 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=37;FQ=-51 GT:PL:GQ 1/1:139,24,0:45 -NT_166450 27798 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166450 27807 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166450 27813 . A C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166447 29896 . A G 4.77 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166468 8984 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166468 8986 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166468 8989 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166477 2080 . T A 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166455 23979 . C A 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_166291 4663 . G A 11.1 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:42,6,0:9 -NT_166291 4684 . C G 32.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:64,6,0:10 -NT_166291 27578 . G A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166291 35549 . C G 117 . DP=10;AF1=1;CI95=1,1;DP4=0,0,6,4;MQ=36;FQ=-57 GT:PL:GQ 1/1:150,30,0:57 -NT_166291 35756 . A G 198 . DP=20;AF1=1;CI95=1,1;DP4=0,0,9,10;MQ=37;FQ=-84 GT:PL:GQ 1/1:231,57,0:99 -NT_166463 6735 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166463 6736 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166309 64876 . A G 25 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-36 GT:PL:GQ 1/1:57,9,0:15 -NT_166309 64910 . A C 30.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42 GT:PL:GQ 1/1:63,15,0:27 -NT_166309 64925 . A G 29.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42 GT:PL:GQ 1/1:62,15,0:27 -NT_166309 64960 . T G 45.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=28;FQ=-39 GT:PL:GQ 1/1:78,12,0:21 -NT_166309 64971 . T G 30 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36 GT:PL:GQ 1/1:62,9,0:16 -NT_166309 64979 . A C 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -NT_166309 69760 . A G 52 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36 GT:PL:GQ 1/1:84,9,0:16 -NT_166309 69765 . T C 42 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36 GT:PL:GQ 1/1:74,9,0:16 -NT_166309 69773 . T C 35 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36 GT:PL:GQ 1/1:67,9,0:16 -NT_166309 69799 . G C 25 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=33;FQ=-36 GT:PL:GQ 1/1:57,9,0:15 -NT_166309 69869 . T C 35.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:67,6,0:10 -NT_166309 103113 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166309 139729 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166282 41545 . C T 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166282 94999 . C T 31.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39 GT:PL:GQ 1/1:64,12,0:21 -NT_166282 95050 . T G 33 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36 GT:PL:GQ 1/1:65,9,0:16 -NT_166314 112573 . C A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166314 118593 . C T 35.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39 GT:PL:GQ 1/1:68,12,0:21 -NT_166314 118608 . C T 73.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39 GT:PL:GQ 1/1:106,12,0:21 -NT_166314 118836 . A C 84.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39 GT:PL:GQ 1/1:117,12,0:21 -NT_166314 118924 . G C 212 . DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=37;FQ=-57 GT:PL:GQ 1/1:245,30,0:57 -NT_166314 144387 . A T 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=-3.07;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,29:29 -NT_166314 155508 . A T 65.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45 GT:PL:GQ 1/1:98,18,0:33 -NT_112000 52371 . G T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_112000 52375 . A C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_110857 19739 . A G 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_166280 4649 . C A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166280 137528 . T C 32.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:64,6,0:10 -NT_166280 137545 . C T 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -NT_166311 1782 . C T 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166311 69821 . G A 65.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=33;FQ=-42 GT:PL:GQ 1/1:98,15,0:27 -NT_166311 69841 . C A 42.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=33;FQ=-42 GT:PL:GQ 1/1:75,15,0:27 -NT_166311 69894 . T G 26 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:58,9,0:16 -NT_166311 69917 . G A 20 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:52,9,0:15 -NT_166310 83175 . C G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -NT_166438 13070 . C A 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_162750 40051 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_162750 40058 . A G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_162750 71153 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_162750 71157 . T G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166387 1835 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166281 28467 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166281 28468 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 178838 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 179067 . C T 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -NT_166313 179084 . T C 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=-3.07;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,29:29 -NT_166313 179560 . A G 97 . DP=6;AF1=0.5032;CI95=0.5,0.5;DP4=1,0,1,4;MQ=35;FQ=-8.63;PV4=0.33,0.019,0.35,1 GT:PL:GQ 0/1:127,0,19:22 -NT_166313 179573 . A T 76.1 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=35;FQ=-45 GT:PL:GQ 1/1:109,18,0:33 -NT_166313 179575 . C T 68 . DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,4;MQ=36;FQ=26;PV4=1,0.0056,0.29,1 GT:PL:GQ 0/1:98,0,53:56 -NT_166313 179587 . A G 42 . DP=8;AF1=0.5;CI95=0.5,0.5;DP4=1,2,1,4;MQ=36;FQ=42.9;PV4=1,0.0032,0.24,1 GT:PL:GQ 0/1:72,0,74:73 -NT_166313 180199 . A G 64 . DP=13;AF1=0.5;CI95=0.5,0.5;DP4=9,0,3,1;MQ=37;FQ=67;PV4=0.31,1,1,1 GT:PL:GQ 0/1:94,0,143:97 -NT_166313 180204 . C T 17.1 . DP=14;AF1=0.5;CI95=0.5,0.5;DP4=9,0,3,1;MQ=37;FQ=20.1;PV4=0.31,5.5e-06,1,1 GT:PL:GQ 0/1:47,0,143:50 -NT_166313 180258 . C G 38 . DP=19;AF1=0.5;CI95=0.5,0.5;DP4=12,2,2,2;MQ=36;FQ=41;PV4=0.2,0.37,0.029,1 GT:PL:GQ 0/1:68,0,212:71 -NT_166313 180274 . A G 45 . DP=14;AF1=0.5;CI95=0.5,0.5;DP4=5,0,3,6;MQ=36;FQ=47.6;PV4=0.031,2.3e-05,0.15,1 GT:PL:GQ 0/1:75,0,85:78 -NT_166313 180300 . A T 11.3 . DP=15;AF1=0.5;CI95=0.5,0.5;DP4=4,6,1,4;MQ=36;FQ=14.2;PV4=0.6,1.7e-08,1,1 GT:PL:GQ 0/1:41,0,208:43 -NT_166313 180331 . C T 189 . DP=17;AF1=0.5;CI95=0.5,0.5;DP4=1,3,6,6;MQ=34;FQ=59;PV4=0.58,0.16,0.068,1 GT:PL:GQ 0/1:219,0,86:89 -NT_166313 180352 . C T 126 . DP=17;AF1=0.5;CI95=0.5,0.5;DP4=5,5,3,4;MQ=34;FQ=129;PV4=1,1,1,1 GT:PL:GQ 0/1:156,0,196:99 -NT_166313 180384 . G A 93 . DP=16;AF1=0.5;CI95=0.5,0.5;DP4=2,4,6,4;MQ=34;FQ=95.9;PV4=0.61,3.3e-10,0.041,1 GT:PL:GQ 0/1:123,0,141:99 -NT_166313 180748 . A C 18.1 . DP=7;AF1=0.5;CI95=0.5,0.5;DP4=4,1,2,0;MQ=37;FQ=21;PV4=1,1,1,0.13 GT:PL:GQ 0/1:48,0,123:51 -NT_166313 180901 . A G 86.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-39 GT:PL:GQ 1/1:119,12,0:21 -NT_166313 182411 . T G 5.46 . DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=3,0,0,3;MQ=35;FQ=7.8;PV4=0.1,0.0036,0.19,1 GT:PL:GQ 0/1:34,0,72:34 -NT_166313 182447 . A G 10.4 . DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,0,0,3;MQ=35;FQ=13;PV4=0.1,0.014,0.25,0.14 GT:PL:GQ 0/1:40,0,53:42 -NT_166313 183242 . C A 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166313 184154 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 184175 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 184807 . T C 15.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:47,6,0:10 -NT_166313 184892 . T G 38.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:70,6,0:10 -NT_166313 184925 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 184960 . T C 11.1 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:42,6,0:9 -NT_166313 184966 . C A 11.1 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:42,6,0:9 -NT_166313 185022 . C T 9.31 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:40,6,0:8 -NT_166313 185114 . G A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166313 185707 . TGGGGGG TGGGG 53.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:93,9,0:16 -NT_166313 186575 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166313 188906 . G C 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166313 189753 . T G 42 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:74,9,0:16 -NT_166313 189763 . G A 38 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:70,9,0:16 -NT_166313 190763 . A C 7.59 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -NT_166313 190780 . T C 5.29 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33 GT:PL:GQ 1/1:35,6,0:6 -NT_166313 191046 . C T 33.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:65,6,0:10 -NT_166313 191075 . C G 32.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:64,6,0:10 -NT_166313 206710 . CGAGAGAGAGAGAGAGAGA CGAGAGAGAGAGAGAGA 8.18 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=4,2,2,0;MQ=37;FQ=10.8;PV4=1,1.5e-06,1,1 GT:PL:GQ 0/1:45,0,159:47 -NT_166313 212911 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166313 242335 . A T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166313 242381 . G C 3.54 . DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166313 243035 . G T 8.44 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33 GT:PL:GQ 1/1:39,6,0:8 -NT_166313 243084 . A T 18.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33 GT:PL:GQ 1/1:50,6,0:10 -NT_166313 243235 . T A 13.9 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -NT_166313 243340 . C G 15.1 . DP=3;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,2,0;MQ=37;FQ=-4.14;PV4=1,0.3,1,0.077 GT:PL:GQ 0/1:45,0,25:28 -NT_161928 42786 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166378 24751 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_166378 24753 . C T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_161926 91391 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161926 91392 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166385 319808 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_165789 268949 . A G 130 . DP=11;AF1=1;CI95=1,1;DP4=0,0,5,5;MQ=33;FQ=-57 GT:PL:GQ 1/1:163,30,0:57 -NT_165789 268956 . T G 133 . DP=11;AF1=1;CI95=1,1;DP4=0,0,5,5;MQ=33;FQ=-57 GT:PL:GQ 1/1:166,30,0:57 -NT_165789 268973 . G A 102 . DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=32;FQ=-51 GT:PL:GQ 1/1:135,24,0:45 -NT_165789 269002 . G A 47.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=25;FQ=-39 GT:PL:GQ 1/1:80,12,0:21 -NT_165789 269016 . C T 38 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=25;FQ=-36 GT:PL:GQ 1/1:70,9,0:16 -NT_165789 269124 . T A 53.2 . DP=9;AF1=0.5263;CI95=0.5,1;DP4=0,1,3,5;MQ=33;FQ=-17.1;PV4=1,5.2e-06,0.26,0.24 GT:PL:GQ 0/1:83,0,10:13 -NT_165789 269148 . A G 9.53 . DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,2,1;MQ=28;FQ=-4.22;PV4=1,0.0014,0,0.27 GT:PL:GQ 0/1:39,0,25:29 -NT_165789 269163 . G T 7.8 . DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=0,1,2,0;MQ=30;FQ=3.27;PV4=0.33,0.071,0,0.13 GT:PL:GQ 0/1:37,0,28:32 -NT_165789 303609 . T G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166361 150408 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166348 244139 . T G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166348 244145 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166369 123725 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166417 80615 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166417 80639 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166383 378092 . T A 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -NT_166362 238907 . T G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166362 238908 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_165754 250017 . A G 190 . DP=22;AF1=1;CI95=1,1;DP4=0,0,11,8;MQ=37;FQ=-84 GT:PL:GQ 1/1:223,57,0:99 -NT_165754 252055 . T A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -NT_165754 293702 . G C 6.79 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:37,6,0:7 -NT_165754 300330 . C A 139 . DP=21;AF1=1;CI95=1,1;DP4=0,0,18,3;MQ=37;FQ=-90 GT:PL:GQ 1/1:172,63,0:99 -NT_165754 300742 . AGG AGGG 3.8 . INDEL;DP=19;AF1=0.5;CI95=0.5,0.5;DP4=2,7,3,0;MQ=37;FQ=5.8;PV4=0.045,0.32,1,1 GT:PL:GQ 0/1:39,0,152:38 -NT_165754 300745 . T G 10.4 . DP=19;AF1=0.5;CI95=0.5,0.5;DP4=0,7,5,0;MQ=35;FQ=13.2;PV4=0.0013,1.1e-06,0.038,1 GT:PL:GQ 0/1:40,0,128:42 -NT_165754 304284 . T TC 12.7 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=15.6;PV4=0.4,1,1,0.41 GT:PL:GQ 0/1:50,0,89:53 -NT_165754 309950 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_165754 311521 . A AT 6.36 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:44,6,0:7 -NT_165754 329690 . N T 7.59 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -NT_165754 329691 . N G 7.59 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -NT_165754 329692 . N A 6.79 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:37,6,0:7 -NT_165754 329693 . N C 26 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-36 GT:PL:GQ 1/1:58,9,0:16 -NT_165754 338325 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161924 260016 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_165795 433385 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166370 455714 . T G 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_166424 307990 . T A 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_161877 518452 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161877 518454 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166351 468564 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166408 488033 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166408 562716 . A G 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_166349 214066 . A G 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_166349 214070 . T G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166391 47103 . C T 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -NT_165790 96824 . T G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_165790 96827 . A T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166344 657504 . A C 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_166371 140475 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_166371 140477 . A C 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -NT_166371 140491 . C A 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -NT_161895 283625 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161895 744483 . C G 38 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:70,9,0:16 -NT_166404 51731 . A T 3.55 . DP=2;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-4.23;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,26:28 -NT_161875 219900 . G A 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_161875 219903 . T C 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -NT_161866 49262 . C G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -NT_161866 49264 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161866 49265 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161872 293963 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161872 616242 . T A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -NT_161872 714587 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161902 401831 . T C 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -NT_161902 923924 . G A 10.2 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33 GT:PL:GQ 1/1:41,6,0:8 -NT_161937 232325 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161937 232331 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161937 310786 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -NT_161937 1343395 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -Y 356986 . A G 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -Y 362133 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -Y 372541 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -Y 385312 . A G 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -Y 385313 . A G 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -Y 472032 . A G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -Y 503298 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -Y 529936 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -Y 534673 . T C 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -Y 601401 . C CAG 24.5 . INDEL;DP=10;AF1=0.5;CI95=0.5,0.5;DP4=5,1,2,1;MQ=37;FQ=27.5;PV4=1,0.061,1,0.00024 GT:PL:GQ 0/1:62,0,144:65 -Y 602418 . T TGC 21.3 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:60,6,0:10 -Y 1448653 . A T 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -Y 2564922 . C G 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -Y 2564933 . A T 5.29 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:35,6,0:6 -Y 2564937 . T C 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -Y 2884117 . T C 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 3205820 . G A 158 . DP=20;AF1=1;CI95=1,1;DP4=0,0,9,9;MQ=36;FQ=-81 GT:PL:GQ 1/1:191,54,0:99 -19 3205836 . A G 220 . DP=36;AF1=1;CI95=1,1;DP4=0,0,20,14;MQ=37;FQ=-129 GT:PL:GQ 1/1:253,102,0:99 -19 3205943 . G C 152 . DP=21;AF1=1;CI95=1,1;DP4=0,0,8,10;MQ=37;FQ=-81 GT:PL:GQ 1/1:185,54,0:99 -19 3205957 . G C 80.1 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=37;FQ=-45 GT:PL:GQ 1/1:113,18,0:33 -19 3205995 . T C 67 . DP=18;AF1=1;CI95=1,1;DP4=0,0,1,13;MQ=32;FQ=-69 GT:PL:GQ 1/1:100,42,0:81 -19 3206052 . A G 120 . DP=12;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=34;FQ=-57 GT:PL:GQ 1/1:153,30,0:57 -19 3206060 . T A 71.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=33;FQ=-45 GT:PL:GQ 1/1:104,18,0:33 -19 3206638 . T G 55.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=25;FQ=-42 GT:PL:GQ 1/1:88,15,0:27 -19 3206671 . T C 53.4 . DP=6;AF1=0.5554;CI95=0.5,1;DP4=1,0,4,1;MQ=25;FQ=-20;PV4=1,0.38,1,1 GT:PL:GQ 0/1:83,0,7:10 -19 3206673 . T C 23 . DP=6;AF1=0.5;CI95=0.5,0.5;DP4=3,0,2,1;MQ=25;FQ=18.3;PV4=1,0.39,1,1 GT:PL:GQ 0/1:53,0,46:48 -19 3206703 . G A 64.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=25;FQ=-42 GT:PL:GQ 1/1:97,15,0:27 -19 3281904 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3352482 . C A 32.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=34;FQ=-39 GT:PL:GQ 1/1:65,12,0:21 -19 3356313 . AC ACC 39.5 . INDEL;DP=4;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,0,3;MQ=37;FQ=-12.8;PV4=0.25,1,1,0.27 GT:PL:GQ 0/1:77,0,22:25 -19 3362225 . A G 23 . DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,4,0;MQ=35;FQ=-6.18;PV4=1,0.014,0.34,0.022 GT:PL:GQ 0/1:53,0,22:25 -19 3365671 . AC A 3.81 . INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.67;PV4=1,0.16,1,0.012 GT:PL:GQ 0/1:39,0,28:33 -19 3369050 . G GA 9.71 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:48,6,0:8 -19 3371339 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3375209 . A AT 54 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:94,12,0:21 -19 3457052 . CT CTTT 4.42 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=2,0,2,0;MQ=34;FQ=6.48;PV4=1,0.051,0.21,0.38 GT:PL:GQ 0/1:40,0,56:40 -19 3462257 . T C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 3490405 . T A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 3490564 . C G 15.1 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:47,9,0:14 -19 3547993 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3582830 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3586482 . T G 58 . DP=12;AF1=0.5;CI95=0.5,0.5;DP4=2,0,7,1;MQ=34;FQ=12.3;PV4=1,0.00069,0.18,1 GT:PL:GQ 0/1:88,0,39:42 -19 3586484 . A C 56 . DP=12;AF1=0.5001;CI95=0.5,0.5;DP4=2,0,7,1;MQ=34;FQ=9.53;PV4=1,0.0044,0.18,1 GT:PL:GQ 0/1:86,0,36:39 -19 3591114 . CTGTG CTG 47.5 . INDEL;DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,4,0;MQ=37;FQ=-12.8;PV4=0.2,0.12,1,0.25 GT:PL:GQ 0/1:85,0,22:25 -19 3591123 . T G 11.3 . DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=3.43;PV4=0.33,0,1,0.17 GT:PL:GQ 0/1:41,0,28:31 -19 3591876 . C G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 3596029 . GACACACACACACACA GACACACACACACA 15.6 . INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=18.5;PV4=1,7.9e-05,1,1 GT:PL:GQ 0/1:53,0,90:56 -19 3596048 . TCACACACACACACACA TCACACACACACACA 35.2 . INDEL;DP=7;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:74,6,0:10 -19 3610237 . CG CGGG 28.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 3612197 . CGG CGGG 12.7 . INDEL;DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=1,0,1,1;MQ=33;FQ=-11.8;PV4=1,0.43,0.33,0.33 GT:PL:GQ 0/1:50,0,23:26 -19 3615652 . C G 7.8 . DP=5;AF1=0.5003;CI95=0.5,0.5;DP4=0,1,0,2;MQ=33;FQ=3.27;PV4=1,0.046,0.33,0.32 GT:PL:GQ 0/1:37,0,28:32 -19 3621243 . A G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 3647660 . C A 3.41 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:32,6,0:4 -19 3649602 . T G 41.5 . DP=9;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39 GT:PL:GQ 1/1:74,12,0:21 -19 3649604 . C A 26 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-36 GT:PL:GQ 1/1:58,9,0:16 -19 3649607 . T G 31.5 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39 GT:PL:GQ 1/1:64,12,0:21 -19 3673470 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3682731 . T G 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -19 3784152 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3817931 . A T 17.1 . DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,6,1,1;MQ=37;FQ=20.1;PV4=0.42,1,1,7.9e-09 GT:PL:GQ 0/1:47,0,150:50 -19 3885854 . TT TTAT 8.18 . INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=10.5;PV4=1,0.26,1,0.36 GT:PL:GQ 0/1:45,0,56:46 -19 3897463 . C CA 23.5 . INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=4,3,0,4;MQ=37;FQ=26.5;PV4=0.19,0.02,1,2.5e-05 GT:PL:GQ 0/1:61,0,178:64 -19 3899540 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 3903173 . C T 3.01 . DP=13;AF1=0.4997;CI95=0.5,0.5;DP4=4,4,3,0;MQ=36;FQ=4.77;PV4=0.24,0.028,0.052,1 GT:PL:GQ 0/1:30,0,163:28 -19 3903429 . CTA C 31.5 . INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=4,2,3,0;MQ=37;FQ=34.5;PV4=0.5,1.4e-09,1,1 GT:PL:GQ 0/1:69,0,157:72 -19 3903506 . G GCC 30.5 . INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,2,0,3;MQ=35;FQ=33.4;PV4=1,1,0.19,1 GT:PL:GQ 0/1:68,0,87:71 -19 3909282 . CTG CTGTG 22.5 . INDEL;DP=6;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.4;PV4=1,0.4,1,0.33 GT:PL:GQ 0/1:60,0,28:31 -19 3909704 . A T 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 3909837 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 3937591 . G A 4.61 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -19 3944020 . TA T 6.55 . INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=33;FQ=-7.51;PV4=1,0.28,0.33,0 GT:PL:GQ 0/1:43,0,28:33 -19 3955855 . T G 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -19 4012679 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 4036683 . C CCAT 16.6 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,1,1;MQ=37;FQ=19.5;PV4=1,0.12,1,0.04 GT:PL:GQ 0/1:54,0,90:57 -19 4097507 . G GCC 45.5 . INDEL;DP=5;AF1=0.5032;CI95=0.5,0.5;DP4=1,0,4,0;MQ=35;FQ=-15.6;PV4=1,1,0.34,0.34 GT:PL:GQ 0/1:83,0,19:22 -19 4097921 . AG A 16.6 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,1;MQ=35;FQ=16;PV4=0.4,0.028,0.25,0.013 GT:PL:GQ 0/1:54,0,53:53 -19 4103486 . GT GTCT 21.5 . INDEL;DP=6;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=-7.4;PV4=0.33,0.41,1,0.016 GT:PL:GQ 0/1:59,0,28:31 -19 4109610 . A G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 4126040 . GCCCCC GCCCC 38.5 . INDEL;DP=9;AF1=1;CI95=1,1;DP4=0,0,7,0;MQ=37;FQ=-55.5 GT:PL:GQ 1/1:79,21,0:39 -19 4128088 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 4150222 . T TG 16.6 . INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=3,3,2,1;MQ=36;FQ=19.5;PV4=1,0.35,0.085,4e-05 GT:PL:GQ 0/1:54,0,140:57 -19 4192878 . T TG 159 . INDEL;DP=17;AF1=1;CI95=0.5,1;DP4=0,1,9,3;MQ=37;FQ=-40.5;PV4=0.31,0.48,1,0.4 GT:PL:GQ 1/1:198,6,0:10 -19 4192885 . T A 8.65 . DP=9;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-4.25;PV4=0.25,0.045,1,0.44 GT:PL:GQ 0/1:38,0,25:29 -19 4193254 . T C 111 . DP=9;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=32;FQ=-48 GT:PL:GQ 1/1:144,21,0:39 -19 4194973 . CT C 114 . INDEL;DP=14;AF1=0.5;CI95=0.5,0.5;DP4=4,2,3,3;MQ=37;FQ=113;PV4=1,2.2e-05,1,0.018 GT:PL:GQ 0/1:152,0,150:99 -19 4218544 . GACACACACACACACACACACAC GACACACACACACACACACAC 20.5 . INDEL;DP=14;AF1=0.5;CI95=0.5,0.5;DP4=0,10,0,3;MQ=37;FQ=23.5;PV4=1,0.28,1,1 GT:PL:GQ 0/1:58,0,144:61 -19 4265650 . A C 15.1 . DP=8;AF1=0.5002;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=5.35;PV4=0.4,1,0.25,1 GT:PL:GQ 0/1:45,0,31:34 -19 4275479 . A G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 4287266 . TG T 11.5 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:50,6,0:9 -19 4288411 . C A 14.2 . DP=13;AF1=0.5;CI95=0.5,0.5;DP4=4,5,1,3;MQ=36;FQ=17.1;PV4=1,0.00097,1,1 GT:PL:GQ 0/1:44,0,185:47 -19 4293399 . G A 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -19 4293435 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 4319284 . G GCCA 39.4 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-43.5 GT:PL:GQ 1/1:79,9,0:16 -19 4320148 . AT A 53.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=33;FQ=-43.5 GT:PL:GQ 1/1:93,9,0:16 -19 4328716 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 4356928 . T C 9.49 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:41,9,0:12 -19 4395270 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 4397535 . G A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 4616344 . A G 31.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:63,6,0:10 -19 4619199 . G GACA 28.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 4746969 . G GA 21.3 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:60,6,0:10 -19 4784161 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 4785570 . G C 7.8 . DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=3.27;PV4=1,0.034,1,0.025 GT:PL:GQ 0/1:37,0,28:32 -19 4799879 . T C 34.8 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:66,6,0:10 -19 4888267 . A T 3.54 . DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 4918151 . CT CTT 17.3 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:56,6,0:10 -19 4923064 . CA C 16.6 . INDEL;DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,1,2;MQ=34;FQ=-9.99;PV4=1,0.11,0.33,0.33 GT:PL:GQ 0/1:54,0,25:28 -19 4964673 . G GGA 7.98 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:46,6,0:8 -19 5045349 . G GT 11.8 . INDEL;DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-10;PV4=1,0.47,1,1 GT:PL:GQ 0/1:49,0,25:29 -19 5046911 . G GA 35.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:74,6,0:10 -19 5048333 . A G 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 5081755 . G A 20 . DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,3,1,1;MQ=37;FQ=23;PV4=1,0.22,1,1 GT:PL:GQ 0/1:50,0,107:53 -19 5111720 . C CAG 28.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 5113937 . TC TCC 21.3 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:60,6,0:10 -19 5116885 . T A 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -19 5140839 . T A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 5142716 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5152822 . T TC 77.5 . INDEL;DP=8;AF1=0.5064;CI95=0.5,0.5;DP4=1,0,6,0;MQ=37;FQ=-18.6;PV4=1,0.48,1,0.0022 GT:PL:GQ 0/1:115,0,16:19 -19 5152825 . A C 3.02 . DP=6;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,2,0;MQ=37;FQ=-3.6;PV4=1,0.057,1,0.052 GT:PL:GQ 0/1:30,0,28:28 -19 5154577 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5226915 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5245293 . G A 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -19 5245305 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5264850 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5274427 . T C 3.01 . DP=54;AF1=0.4997;CI95=0.5,0.5;DP4=22,18,6,5;MQ=37;FQ=4.77;PV4=1,1e-18,1,1 GT:PL:GQ 0/1:30,0,255:28 -19 5274978 . C CG 99.7 . INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=37;FQ=-49.5 GT:PL:GQ 1/1:140,15,0:27 -19 5275059 . C CA 30.2 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:69,6,0:10 -19 5279268 . C CTT 40.5 . INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=37;FQ=-9.98;PV4=1,0.46,1,0.0034 GT:PL:GQ 0/1:78,0,25:28 -19 5279373 . GT GTCT 115 . INDEL;DP=11;AF1=0.5263;CI95=0.5,1;DP4=1,0,7,1;MQ=35;FQ=-24.5;PV4=1,1,0.31,0.44 GT:PL:GQ 0/1:152,0,10:13 -19 5279469 . C CG 12.7 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=13.9;PV4=0.4,0.027,0.25,0.25 GT:PL:GQ 0/1:50,0,53:51 -19 5293078 . A G 3.02 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -19 5293322 . A G 22 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:54,9,0:15 -19 5299338 . T C 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 5324189 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5324197 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5324249 . G C 5.29 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:35,6,0:6 -19 5325094 . T C 12 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33 GT:PL:GQ 1/1:43,6,0:9 -19 5325106 . A G 25.8 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33 GT:PL:GQ 1/1:57,6,0:10 -19 5325161 . T C 75.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=35;FQ=-45 GT:PL:GQ 1/1:108,18,0:33 -19 5334753 . G A 122 . DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=29;FQ=-57 GT:PL:GQ 1/1:155,30,0:57 -19 5334800 . G C 101 . DP=9;AF1=1;CI95=1,1;DP4=0,0,2,7;MQ=28;FQ=-54 GT:PL:GQ 1/1:134,27,0:51 -19 5334810 . T C 29 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=25;FQ=-36 GT:PL:GQ 1/1:61,9,0:16 -19 5371182 . ATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT ATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 28.5 . INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=1,4,0,3;MQ=37;FQ=31.5;PV4=1,0.24,1,0.4 GT:PL:GQ 0/1:66,0,107:69 -19 5415628 . A G 58.2 . DP=5;AF1=0.5207;CI95=0.5,1;DP4=0,1,2,2;MQ=30;FQ=-16.1;PV4=1,1,0.14,1 GT:PL:GQ 0/1:88,0,11:14 -19 5415652 . C G 19.1 . DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=16.7;PV4=1,0.0019,0.11,1 GT:PL:GQ 0/1:49,0,45:47 -19 5415658 . A T 35 . DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=15.1;PV4=1,1,0.11,1 GT:PL:GQ 0/1:65,0,42:45 -19 5415664 . G A 14.2 . DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=33;FQ=16.1;PV4=1,0.0034,0.11,1 GT:PL:GQ 0/1:44,0,50:46 -19 5423558 . A AT 121 . INDEL;DP=15;AF1=1;CI95=1,1;DP4=0,0,0,9;MQ=37;FQ=-61.5 GT:PL:GQ 1/1:162,27,0:51 -19 5424274 . GG GGAG 46.5 . INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=2,3,4,1;MQ=37;FQ=49.5;PV4=0.52,0.014,1,1 GT:PL:GQ 0/1:84,0,134:87 -19 5426086 . A C 14.2 . DP=33;AF1=0.5;CI95=0.5,0.5;DP4=15,2,0,9;MQ=37;FQ=17.1;PV4=1.8e-05,1.7e-09,1,1 GT:PL:GQ 0/1:44,0,212:47 -19 5462528 . A AGG 45.4 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:85,9,0:16 -19 5479300 . C A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 5480150 . G A 7.59 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -19 5533657 . C G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 5535804 . C T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 5580726 . C T 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -19 5640300 . CA C 77.5 . INDEL;DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,3,1,4;MQ=37;FQ=71;PV4=1,0.049,1,0.065 GT:PL:GQ 0/1:115,0,106:99 -19 5642274 . A G 9.52 . DP=10;AF1=0.5;CI95=0.5,0.5;DP4=1,6,0,3;MQ=37;FQ=12.3;PV4=1,0.0039,1,0.22 GT:PL:GQ 0/1:39,0,152:41 -19 5646794 . C CAA 4.42 . INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=5,2,0,4;MQ=36;FQ=6.56;PV4=0.061,0.00082,0.1,4.2e-05 GT:PL:GQ 0/1:40,0,170:40 -19 5652568 . T TTC 47.5 . INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=5,1,4,0;MQ=37;FQ=50.5;PV4=1,0.33,1,0.035 GT:PL:GQ 0/1:85,0,142:88 -19 5652874 . CT CTT 45.5 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=0,3,4,0;MQ=36;FQ=34.3;PV4=0.029,0.31,0.22,1 GT:PL:GQ 0/1:83,0,69:72 -19 5655793 . T TTTG 15.6 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=18.5;PV4=1,0.031,1,0.0029 GT:PL:GQ 0/1:53,0,90:56 -19 5671522 . C CT 8.18 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=3,1,0,2;MQ=37;FQ=10.8;PV4=0.4,0.24,1,0.028 GT:PL:GQ 0/1:45,0,113:47 -19 5673355 . C G 16.1 . DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,1;MQ=37;FQ=18.7;PV4=1,0.012,1,0.00027 GT:PL:GQ 0/1:46,0,56:48 -19 5673587 . AGCT AGCTTGCT 15.6 . INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=0,3,2,0;MQ=37;FQ=18.5;PV4=0.1,0.4,1,0.18 GT:PL:GQ 0/1:53,0,79:56 -19 5700971 . GT G 13.7 . INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=2,0,0,2;MQ=37;FQ=15.4;PV4=0.33,0.057,1,0.00094 GT:PL:GQ 0/1:51,0,56:53 -19 5722189 . A T 15.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:47,6,0:10 -19 5747411 . A ATT 28.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 5751303 . G GAC 36.5 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=3,1,3,0;MQ=37;FQ=39.5;PV4=1,1,1,0.0091 GT:PL:GQ 0/1:74,0,110:77 -19 5765309 . C T 3.02 . DP=3;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,2;MQ=37;FQ=-3.6;PV4=0.33,0.14,1,1 GT:PL:GQ 0/1:30,0,28:28 -19 5766155 . T TCCC 5.8 . INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,0,2;MQ=37;FQ=-7.54;PV4=0.33,0.044,1,1 GT:PL:GQ 0/1:42,0,28:33 -19 5802669 . CCT CCTCT 23.5 . INDEL;DP=11;AF1=0.5001;CI95=0.5,0.5;DP4=1,1,3,0;MQ=33;FQ=-3.84;PV4=0.4,1,0.11,1 GT:PL:GQ 0/1:61,0,33:36 -19 5837235 . G A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 5853932 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5894371 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 5899740 . A G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 5902359 . GT G 20.5 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-43.5 GT:PL:GQ 1/1:60,9,0:15 -19 5905108 . G C 3.54 . DP=2;AF1=0.5002;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-3.4;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,28:29 -19 5951787 . C T 18 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:50,9,0:15 -19 5956115 . CT CTT 20.5 . INDEL;DP=4;AF1=0.501;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-10.9;PV4=1,1,1,0.33 GT:PL:GQ 0/1:58,0,24:27 -19 5956116 . TA T 20.5 . INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-7.4;PV4=1,0.24,1,0.31 GT:PL:GQ 0/1:58,0,28:31 -19 5988978 . AGG AGGGG 95 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:135,12,0:21 -19 5990457 . G GC 48.5 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=2,0,2,1;MQ=37;FQ=18.5;PV4=1,1,1,0.11 GT:PL:GQ 0/1:86,0,53:56 -19 5992164 . A T 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 6011296 . CTT CTTT 89 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:129,12,0:21 -19 6047971 . C T 141 . DP=14;AF1=0.5;CI95=0.5,0.5;DP4=3,3,2,6;MQ=37;FQ=114;PV4=0.58,0.44,1,1 GT:PL:GQ 0/1:171,0,141:99 -19 6071701 . A T 8.64 . DP=10;AF1=0.5;CI95=0.5,0.5;DP4=3,1,3,0;MQ=36;FQ=11.3;PV4=1,0.12,1,1 GT:PL:GQ 0/1:38,0,89:40 -19 6084061 . CT CTT 14.6 . INDEL;DP=7;AF1=0.5;CI95=0.5,0.5;DP4=1,1,2,0;MQ=37;FQ=16.4;PV4=1,1,1,0.21 GT:PL:GQ 0/1:52,0,57:54 -19 6116433 . G T 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -19 6152712 . A G 34 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36 GT:PL:GQ 1/1:66,9,0:16 -19 6152741 . T C 191 . DP=12;AF1=1;CI95=1,1;DP4=0,0,8,3;MQ=34;FQ=-60 GT:PL:GQ 1/1:224,33,0:63 -19 6152749 . T C 167 . DP=17;AF1=1;CI95=1,1;DP4=0,0,11,5;MQ=35;FQ=-75 GT:PL:GQ 1/1:200,48,0:93 -19 6152890 . T C 100 . DP=7;AF1=1;CI95=1,1;DP4=0,0,3,4;MQ=37;FQ=-48 GT:PL:GQ 1/1:133,21,0:39 -19 6152982 . G A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 6153036 . C T 55.5 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-39 GT:PL:GQ 1/1:88,12,0:21 -19 6153077 . C T 222 . DP=20;AF1=1;CI95=1,1;DP4=0,0,9,11;MQ=37;FQ=-87 GT:PL:GQ 1/1:255,60,0:99 -19 6153163 . T C 194 . DP=9;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54 GT:PL:GQ 1/1:227,27,0:51 -19 6175510 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 6228939 . CA C 78 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=34;FQ=-46.5 GT:PL:GQ 1/1:118,12,0:21 -19 6230906 . C G 15.1 . DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,0,3;MQ=37;FQ=-4.14;PV4=0.25,0.0037,1,0.1 GT:PL:GQ 0/1:45,0,25:28 -19 6249082 . T C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 6251864 . G GA 28.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 6280998 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 6288939 . C A 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 6289471 . A G 18.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:50,6,0:10 -19 6293530 . C T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 6294628 . T TCC 70 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:110,12,0:21 -19 6313685 . A G 4.77 . DP=5;AF1=0.4999;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=6.98;PV4=1,0.00041,1,0.0011 GT:PL:GQ 0/1:33,0,62:33 -19 6314781 . G C 44.1 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=32;FQ=-45 GT:PL:GQ 1/1:77,18,0:33 -19 6316439 . G GA 11.7 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=33;FQ=-43.5 GT:PL:GQ 1/1:51,9,0:13 -19 6322372 . G GC 10.6 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:49,6,0:9 -19 6355840 . C CAG 11.8 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=2,1,2,0;MQ=37;FQ=14.6;PV4=1,1,1,0.45 GT:PL:GQ 0/1:49,0,85:51 -19 6363411 . G A 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 6365792 . G GT 47.5 . INDEL;DP=16;AF1=0.5;CI95=0.5,0.5;DP4=6,3,4,1;MQ=37;FQ=50.5;PV4=1,0.08,1,0.055 GT:PL:GQ 0/1:85,0,201:88 -19 6365797 . A C 4.13 . DP=14;AF1=0.4998;CI95=0.5,0.5;DP4=6,3,4,0;MQ=37;FQ=6.2;PV4=0.5,5.7e-06,1,0.1 GT:PL:GQ 0/1:32,0,196:31 -19 6372298 . T C 18 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:50,9,0:15 -19 6372626 . G GCC 16.6 . INDEL;DP=8;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=37;FQ=-9.99;PV4=1,0.061,1,0.0096 GT:PL:GQ 0/1:54,0,25:28 -19 6374284 . G A 13.2 . DP=7;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,3,1;MQ=33;FQ=-6.21;PV4=0.4,0.012,0.25,1 GT:PL:GQ 0/1:43,0,22:25 -19 6374286 . A C 4.13 . DP=7;AF1=0.5006;CI95=0.5,0.5;DP4=0,1,3,0;MQ=34;FQ=-4.62;PV4=0.25,0.031,0.33,1 GT:PL:GQ 0/1:32,0,25:29 -19 6386021 . T TGGC 11.8 . INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,0,2;MQ=33;FQ=-7.43;PV4=0.33,0.44,0.33,0.33 GT:PL:GQ 0/1:49,0,28:32 -19 6390455 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 6502037 . T G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 6592212 . A G 6.02 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33 GT:PL:GQ 1/1:36,6,0:6 -19 6642108 . C T 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 6905075 . A AGC 7.98 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:46,6,0:8 -19 6909201 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 6915048 . T G 5.29 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:35,6,0:6 -19 6981442 . CT CTT 56.7 . INDEL;DP=13;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-49.5 GT:PL:GQ 1/1:97,15,0:27 -19 6986843 . A AG 12.7 . INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,1,2;MQ=37;FQ=-10;PV4=1,0.13,1,0.33 GT:PL:GQ 0/1:50,0,25:28 -19 6992893 . T C 26 . DP=6;AF1=0.5;CI95=0.5,0.5;DP4=2,2,1,1;MQ=37;FQ=29;PV4=1,0.27,1,0.42 GT:PL:GQ 0/1:56,0,118:59 -19 7032496 . G A 20.8 . DP=6;AF1=0.6243;CI95=0.5,1;DP4=0,1,4,0;MQ=30;FQ=-23;PV4=0.2,1,0.14,0.037 GT:PL:GQ 0/1:50,0,4:7 -19 7032498 . T C 19.1 . DP=5;AF1=0.501;CI95=0.5,0.5;DP4=0,1,3,0;MQ=28;FQ=-4.76;PV4=0.25,0.1,0,0.0026 GT:PL:GQ 0/1:49,0,24:27 -19 7039010 . CT C 30.2 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:69,6,0:10 -19 7052925 . TCC TCCCC 11.8 . INDEL;DP=3;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,2,0;MQ=33;FQ=-7.43;PV4=1,0.4,0.33,1 GT:PL:GQ 0/1:49,0,28:32 -19 7053458 . CTT CTTT 10.8 . INDEL;DP=3;AF1=0.501;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-10.9;PV4=1,0.17,1,0.024 GT:PL:GQ 0/1:48,0,24:28 -19 7074272 . TA T 4.42 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=6.56;PV4=0.4,1,1,0.099 GT:PL:GQ 0/1:40,0,90:40 -19 7096313 . CT CTT 28.5 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,2,1;MQ=37;FQ=20.2;PV4=1,0.26,1,0.06 GT:PL:GQ 0/1:66,0,55:58 -19 7108797 . GT G 24.2 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:63,6,0:10 -19 7109279 . CT CTT 63 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=34;FQ=-46.5 GT:PL:GQ 1/1:103,12,0:21 -19 7273732 . G GC 50.5 . INDEL;DP=7;AF1=0.504;CI95=0.5,0.5;DP4=0,1,0,4;MQ=37;FQ=-16.6;PV4=1,1,1,0.0018 GT:PL:GQ 0/1:88,0,18:21 -19 7273860 . ACCT ACCTCCT 33.5 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=35;FQ=24.2;PV4=0.4,1,0.25,0.021 GT:PL:GQ 0/1:71,0,59:62 -19 7322919 . G C 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -19 7351944 . T A 4.77 . DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=1,1,2,0;MQ=37;FQ=6.98;PV4=1,0.1,1,0.18 GT:PL:GQ 0/1:33,0,61:33 -19 7359479 . CT CTT 41.4 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:81,9,0:16 -19 7361488 . T TC 8.83 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:47,6,0:8 -19 7401873 . A T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 7435993 . G A 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -19 7446286 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 7450404 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 7451189 . G C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 7459826 . T C 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,30:29 -19 7473416 . T C 212 . DP=12;AF1=1;CI95=1,1;DP4=0,0,4,6;MQ=37;FQ=-57 GT:PL:GQ 1/1:245,30,0:57 -19 7533049 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 7559363 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 7596698 . G A 24 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:56,9,0:15 -19 7609641 . G T 49 . DP=25;AF1=0.5;CI95=0.5,0.5;DP4=7,3,0,10;MQ=37;FQ=52;PV4=0.0031,5.7e-05,1,0.46 GT:PL:GQ 0/1:79,0,183:82 -19 7609735 . A G 60 . DP=28;AF1=0.5;CI95=0.5,0.5;DP4=11,5,5,6;MQ=37;FQ=63;PV4=0.26,2.6e-15,1,0.22 GT:PL:GQ 0/1:90,0,255:93 -19 7609740 . A G 141 . DP=27;AF1=0.5;CI95=0.5,0.5;DP4=7,2,9,9;MQ=37;FQ=130;PV4=0.23,6.6e-13,1,1 GT:PL:GQ 0/1:171,0,157:99 -19 7610022 . A G 68 . DP=22;AF1=0.5;CI95=0.5,0.5;DP4=6,8,3,5;MQ=37;FQ=71;PV4=1,0.013,1,1 GT:PL:GQ 0/1:98,0,225:99 -19 7612605 . A G 79 . DP=43;AF1=0.5;CI95=0.5,0.5;DP4=9,19,6,7;MQ=37;FQ=82;PV4=0.49,5e-12,0.072,0.43 GT:PL:GQ 0/1:109,0,255:99 -19 7672449 . T C 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,30:29 -19 7742879 . T C 155 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=37;FQ=-66 GT:PL:GQ 1/1:188,39,0:75 -19 7742923 . T C 222 . DP=29;AF1=1;CI95=1,1;DP4=0,0,10,16;MQ=37;FQ=-105 GT:PL:GQ 1/1:255,78,0:99 -19 7742993 . A G 222 . DP=39;AF1=1;CI95=1,1;DP4=0,0,24,14;MQ=37;FQ=-141 GT:PL:GQ 1/1:255,114,0:99 -19 7743097 . G A 222 . DP=36;AF1=1;CI95=1,1;DP4=0,0,12,24;MQ=37;FQ=-135 GT:PL:GQ 1/1:255,108,0:99 -19 7743265 . A G 143 . DP=17;AF1=1;CI95=1,1;DP4=0,0,8,6;MQ=37;FQ=-69 GT:PL:GQ 1/1:176,42,0:81 -19 7743284 . A G 102 . DP=7;AF1=1;CI95=1,1;DP4=0,0,4,3;MQ=37;FQ=-48 GT:PL:GQ 1/1:135,21,0:39 -19 8034536 . A G 42.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:74,6,0:10 -19 8050872 . T G 87.1 . DP=7;AF1=1;CI95=1,1;DP4=0,0,2,5;MQ=25;FQ=-48 GT:PL:GQ 1/1:120,21,0:39 -19 8050884 . T C 104 . DP=8;AF1=1;CI95=1,1;DP4=0,0,2,6;MQ=25;FQ=-51 GT:PL:GQ 1/1:137,24,0:45 -19 8050914 . A G 70 . DP=11;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=29;FQ=-60 GT:PL:GQ 1/1:103,33,0:63 -19 8050917 . G A 103 . DP=12;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=29;FQ=-60 GT:PL:GQ 1/1:136,33,0:63 -19 8050932 . A G 110 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=30;FQ=-66 GT:PL:GQ 1/1:143,39,0:75 -19 8050976 . G T 182 . DP=19;AF1=1;CI95=1,1;DP4=0,0,4,15;MQ=36;FQ=-84 GT:PL:GQ 1/1:215,57,0:99 -19 8050985 . T TA 214 . INDEL;DP=20;AF1=1;CI95=1,1;DP4=0,0,4,16;MQ=37;FQ=-94.5 GT:PL:GQ 1/1:255,60,0:99 -19 8050996 . T C 169 . DP=19;AF1=1;CI95=1,1;DP4=0,0,4,15;MQ=36;FQ=-84 GT:PL:GQ 1/1:202,57,0:99 -19 8051050 . G A 103 . DP=19;AF1=1;CI95=1,1;DP4=0,0,6,12;MQ=35;FQ=-81 GT:PL:GQ 1/1:136,54,0:99 -19 8051066 . G A 122 . DP=10;AF1=1;CI95=1,1;DP4=0,0,3,7;MQ=34;FQ=-57 GT:PL:GQ 1/1:155,30,0:57 -19 8051084 . T C 46.5 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39 GT:PL:GQ 1/1:79,12,0:21 -19 8051096 . A G 19 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=30;FQ=-36 GT:PL:GQ 1/1:51,9,0:15 -19 8051106 . T G 13 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33 GT:PL:GQ 1/1:44,6,0:9 -19 8051236 . G A 93.1 . DP=7;AF1=1;CI95=1,1;DP4=0,0,4,3;MQ=27;FQ=-48 GT:PL:GQ 1/1:126,21,0:39 -19 8051264 . G A 52.1 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45 GT:PL:GQ 1/1:85,18,0:33 -19 8051283 . T A 87.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45 GT:PL:GQ 1/1:120,18,0:33 -19 8051315 . A G 80.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=25;FQ=-45 GT:PL:GQ 1/1:113,18,0:33 -19 8051323 . C G 28 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=25;FQ=-36 GT:PL:GQ 1/1:60,9,0:16 -19 8051467 . G A 13 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33 GT:PL:GQ 1/1:44,6,0:9 -19 8051469 . C T 9.31 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=25;FQ=-33 GT:PL:GQ 1/1:40,6,0:8 -19 8051498 . T A 147 . DP=11;AF1=1;CI95=1,1;DP4=0,0,4,7;MQ=26;FQ=-60 GT:PL:GQ 1/1:180,33,0:63 -19 8051502 . C T 113 . DP=12;AF1=1;CI95=1,1;DP4=0,0,4,5;MQ=25;FQ=-54 GT:PL:GQ 1/1:146,27,0:51 -19 8051544 . G A 112 . DP=14;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66 GT:PL:GQ 1/1:145,39,0:75 -19 8051546 . T C 104 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66 GT:PL:GQ 1/1:137,39,0:75 -19 8051574 . T C 192 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=29;FQ=-66 GT:PL:GQ 1/1:225,39,0:75 -19 8051593 . T C 45.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=35;FQ=-42 GT:PL:GQ 1/1:78,15,0:27 -19 8100673 . C G 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,30:29 -19 8326732 . GA G 45 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,4;MQ=32;FQ=-46.5 GT:PL:GQ 1/1:85,12,0:21 -19 8326738 . T A 12.3 . DP=10;AF1=0.5012;CI95=0.5,0.5;DP4=1,0,0,3;MQ=32;FQ=-5.48;PV4=0.25,0.09,0.21,1 GT:PL:GQ 0/1:42,0,23:26 -19 8326742 . A C 77.1 . DP=16;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=32;FQ=-45 GT:PL:GQ 1/1:110,18,0:33 -19 8347286 . A G 25 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36 GT:PL:GQ 1/1:57,9,0:15 -19 8347289 . A C 41.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=32;FQ=-39 GT:PL:GQ 1/1:74,12,0:21 -19 8347296 . T C 118 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=33;FQ=-45 GT:PL:GQ 1/1:151,18,0:33 -19 8347384 . G GA 214 . INDEL;DP=29;AF1=1;CI95=1,1;DP4=0,0,23,6;MQ=37;FQ=-122 GT:PL:GQ 1/1:255,87,0:99 -19 8347394 . T A 222 . DP=28;AF1=1;CI95=1,1;DP4=0,0,22,5;MQ=37;FQ=-108 GT:PL:GQ 1/1:255,81,0:99 -19 8347399 . C G 167 . DP=27;AF1=1;CI95=1,1;DP4=0,0,20,5;MQ=37;FQ=-102 GT:PL:GQ 1/1:200,75,0:99 -19 8347408 . C G 222 . DP=23;AF1=1;CI95=1,1;DP4=0,0,17,5;MQ=37;FQ=-93 GT:PL:GQ 1/1:255,66,0:99 -19 8347594 . A G 78.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=25;FQ=-45 GT:PL:GQ 1/1:111,18,0:33 -19 8347628 . A G 108 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51 GT:PL:GQ 1/1:141,24,0:45 -19 8347638 . G T 99 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51 GT:PL:GQ 1/1:132,24,0:45 -19 8347649 . T C 107 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51 GT:PL:GQ 1/1:140,24,0:45 -19 8347659 . T C 106 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,3;MQ=28;FQ=-51 GT:PL:GQ 1/1:139,24,0:45 -19 8347769 . T G 26 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=25;FQ=-36 GT:PL:GQ 1/1:58,9,0:16 -19 8347801 . A G 150 . DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51 GT:PL:GQ 1/1:183,24,0:45 -19 8347804 . A G 106 . DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51 GT:PL:GQ 1/1:139,24,0:45 -19 8347809 . T C 79 . DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51 GT:PL:GQ 1/1:112,24,0:45 -19 8347870 . T C 149 . DP=9;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=30;FQ=-51 GT:PL:GQ 1/1:182,24,0:45 -19 8347993 . A C 78 . DP=13;AF1=1;CI95=1,1;DP4=0,0,0,10;MQ=25;FQ=-57 GT:PL:GQ 1/1:111,30,0:57 -19 8348001 . T G 86 . DP=18;AF1=1;CI95=1,1;DP4=0,0,0,16;MQ=27;FQ=-75 GT:PL:GQ 1/1:119,48,0:93 -19 8348026 . G A 121 . DP=26;AF1=1;CI95=1,1;DP4=0,0,2,24;MQ=31;FQ=-105 GT:PL:GQ 1/1:154,78,0:99 -19 8348048 . A G 222 . DP=41;AF1=1;CI95=1,1;DP4=0,0,9,30;MQ=34;FQ=-144 GT:PL:GQ 1/1:255,117,0:99 -19 8348080 . C T 167 . DP=46;AF1=1;CI95=1,1;DP4=0,0,20,26;MQ=35;FQ=-165 GT:PL:GQ 1/1:200,138,0:99 -19 8348129 . G A 222 . DP=36;AF1=1;CI95=1,1;DP4=0,0,21,14;MQ=35;FQ=-132 GT:PL:GQ 1/1:255,105,0:99 -19 8348158 . C A 138 . DP=18;AF1=1;CI95=1,1;DP4=0,0,12,3;MQ=32;FQ=-72 GT:PL:GQ 1/1:171,45,0:87 -19 8348160 . T A 179 . DP=15;AF1=1;CI95=1,1;DP4=0,0,11,3;MQ=32;FQ=-69 GT:PL:GQ 1/1:212,42,0:81 -19 8348441 . T A 62.3 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42 GT:PL:GQ 1/1:95,15,0:27 -19 8348471 . C T 222 . DP=32;AF1=1;CI95=1,1;DP4=0,0,16,16;MQ=33;FQ=-123 GT:PL:GQ 1/1:255,96,0:99 -19 8348485 . G A 102 . DP=40;AF1=1;CI95=1,1;DP4=0,0,21,18;MQ=34;FQ=-144 GT:PL:GQ 1/1:135,117,0:99 -19 8348498 . G A 217 . DP=52;AF1=1;CI95=1,1;DP4=0,0,29,22;MQ=35;FQ=-181 GT:PL:GQ 1/1:250,154,0:99 -19 8348514 . T C 212 . DP=59;AF1=1;CI95=1,1;DP4=0,0,35,24;MQ=35;FQ=-205 GT:PL:GQ 1/1:245,178,0:99 -19 8348590 . A G 172 . DP=20;AF1=1;CI95=1,1;DP4=0,0,14,5;MQ=36;FQ=-84 GT:PL:GQ 1/1:205,57,0:99 -19 8348635 . T C 146 . DP=12;AF1=1;CI95=1,1;DP4=0,0,2,9;MQ=37;FQ=-60 GT:PL:GQ 1/1:179,33,0:63 -19 8348642 . T C 222 . DP=16;AF1=1;CI95=1,1;DP4=0,0,3,13;MQ=37;FQ=-75 GT:PL:GQ 1/1:255,48,0:93 -19 8348695 . T TA 214 . INDEL;DP=18;AF1=1;CI95=1,1;DP4=0,0,4,13;MQ=37;FQ=-85.5 GT:PL:GQ 1/1:255,51,0:99 -19 8348701 . C T 155 . DP=18;AF1=1;CI95=1,1;DP4=0,0,4,14;MQ=37;FQ=-81 GT:PL:GQ 1/1:188,54,0:99 -19 8348922 . T C 222 . DP=13;AF1=1;CI95=1,1;DP4=0,0,7,5;MQ=37;FQ=-63 GT:PL:GQ 1/1:255,36,0:69 -19 8348969 . T C 161 . DP=15;AF1=1;CI95=1,1;DP4=0,0,8,7;MQ=37;FQ=-72 GT:PL:GQ 1/1:194,45,0:87 -19 8349035 . G A 50.1 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=33;FQ=-45 GT:PL:GQ 1/1:83,18,0:33 -19 8349037 . G A 56.1 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=33;FQ=-45 GT:PL:GQ 1/1:89,18,0:33 -19 8349080 . A G 33.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42 GT:PL:GQ 1/1:66,15,0:27 -19 8349101 . C G 83.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42 GT:PL:GQ 1/1:116,15,0:27 -19 8549054 . T G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 8553877 . G C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 8555072 . A C 4.13 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:32,3,0:3 -19 8741092 . G T 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -19 8783635 . C CA 147 . INDEL;DP=23;AF1=0.5;CI95=0.5,0.5;DP4=2,6,10,2;MQ=36;FQ=126;PV4=0.019,1,0.12,0.01 GT:PL:GQ 0/1:185,0,161:99 -19 8783903 . G GTC 21.3 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:60,6,0:10 -19 8812489 . GT G 34.5 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,1;MQ=35;FQ=18.5;PV4=0.4,0.047,0.25,0.0021 GT:PL:GQ 0/1:72,0,53:56 -19 8817010 . C T 3.01 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.01;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,30:28 -19 8838292 . G A 23 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-36 GT:PL:GQ 1/1:55,9,0:15 -19 8838395 . C A 3.55 . DP=2;AF1=0.5014;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-6.58;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,22:26 -19 8841856 . G GCA 36.5 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=2,1,0,4;MQ=36;FQ=38.3;PV4=0.14,0.19,0.22,0.058 GT:PL:GQ 0/1:74,0,79:76 -19 8850152 . G C 5.46 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:34,3,0:3 -19 8895305 . T A 7.8 . DP=20;AF1=0.5;CI95=0.5,0.5;DP4=3,5,3,1;MQ=37;FQ=10.4;PV4=0.55,0.0027,1,1.9e-09 GT:PL:GQ 0/1:37,0,157:39 -19 8899002 . T G 16.1 . DP=39;AF1=0.5;CI95=0.5,0.5;DP4=2,3,7,0;MQ=36;FQ=19.1;PV4=0.045,0.00068,1,1 GT:PL:GQ 0/1:46,0,85:49 -19 8900459 . C G 7.8 . DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,0,3;MQ=37;FQ=10.4;PV4=0.4,0.0097,1,0.0075 GT:PL:GQ 0/1:37,0,59:39 -19 8900460 . AG AGG 24.5 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=21.3;PV4=1,1,1,0.012 GT:PL:GQ 0/1:62,0,57:59 -19 8900589 . AGG AG 16.6 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=17.4;PV4=1,0.31,1,0.03 GT:PL:GQ 0/1:54,0,56:55 -19 8901128 . T TG 15.6 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,3;MQ=37;FQ=6.39;PV4=1,0.37,1,0.00012 GT:PL:GQ 0/1:53,0,40:43 -19 8904439 . TGG TG 75.5 . INDEL;DP=15;AF1=0.5;CI95=0.5,0.5;DP4=2,1,3,3;MQ=35;FQ=43.5;PV4=1,0.004,0.16,0.034 GT:PL:GQ 0/1:113,0,78:81 -19 8904440 . G GT 66.5 . INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=2,1,4,2;MQ=35;FQ=43.5;PV4=1,0.044,0.16,0.036 GT:PL:GQ 0/1:104,0,78:81 -19 8905828 . T A 4.77 . DP=7;AF1=0.4999;CI95=0.5,0.5;DP4=2,0,3,0;MQ=37;FQ=6.95;PV4=1,0.007,1,0.11 GT:PL:GQ 0/1:33,0,53:33 -19 8920813 . CGG CG 10.8 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=0,2,0,2;MQ=37;FQ=13.1;PV4=1,0.0022,1,0.012 GT:PL:GQ 0/1:48,0,56:50 -19 8927995 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 8948001 . C G 23 . DP=9;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,2;MQ=37;FQ=22.5;PV4=1,0.0043,1,0.27 GT:PL:GQ 0/1:53,0,52:52 -19 8966507 . A G 5.46 . DP=6;AF1=0.4999;CI95=0.5,0.5;DP4=1,3,2,0;MQ=37;FQ=7.8;PV4=0.4,0.16,1,0.22 GT:PL:GQ 0/1:34,0,99:34 -19 8977007 . GA G 22.2 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:61,6,0:10 -19 8977011 . G A 79.1 . DP=10;AF1=1;CI95=1,1;DP4=0,0,2,5;MQ=37;FQ=-48 GT:PL:GQ 1/1:112,21,0:39 -19 8979553 . G GC 41.5 . INDEL;DP=4;AF1=0.501;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-10.9;PV4=0.25,1,1,1 GT:PL:GQ 0/1:79,0,24:27 -19 8981699 . C CA 22.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:61,6,0:10 -19 8989644 . A C 3.41 . DP=11;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:32,6,0:4 -19 8989891 . C T 8.65 . DP=5;AF1=0.5005;CI95=0.5,0.5;DP4=0,1,1,1;MQ=37;FQ=-3.17;PV4=1,0.18,1,0.16 GT:PL:GQ 0/1:38,0,27:31 -19 8990112 . C A 7.59 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:38,6,0:7 -19 8999131 . A G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 9010575 . T G 3.56 . DP=2;AF1=0.503;CI95=0.5,0.5;DP4=1,0,1,0;MQ=32;FQ=-8.86;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,19:25 -19 9010791 . C A 7.8 . DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,2,0,3;MQ=37;FQ=10.4;PV4=1,0.0042,1,0.093 GT:PL:GQ 0/1:37,0,84:39 -19 9020243 . TA T 18.5 . INDEL;DP=8;AF1=0.5;CI95=0.5,0.5;DP4=0,4,1,2;MQ=36;FQ=21.5;PV4=0.43,0.00079,0.14,0.18 GT:PL:GQ 0/1:56,0,93:59 -19 9066341 . G T 3.01 . DP=2;AF1=0.4999;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:30,0,31:28 -19 9096827 . A G 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 9097851 . C A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 9100285 . G T 3.59 . DP=2;AF1=0.51;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=-13.3;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,14:21 -19 9126825 . A T 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 9148172 . T C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 9216844 . T A 4.13 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:32,3,0:3 -19 9358012 . G A 164 . DP=11;AF1=1;CI95=1,1;DP4=0,0,10,1;MQ=37;FQ=-60 GT:PL:GQ 1/1:197,33,0:63 -19 9358045 . C A 191 . DP=22;AF1=1;CI95=1,1;DP4=0,0,15,6;MQ=37;FQ=-90 GT:PL:GQ 1/1:224,63,0:99 -19 9358292 . A G 167 . DP=58;AF1=1;CI95=1,1;DP4=0,0,27,24;MQ=37;FQ=-181 GT:PL:GQ 1/1:200,154,0:99 -19 9358454 . G A 222 . DP=78;AF1=1;CI95=1,1;DP4=0,0,42,36;MQ=37;FQ=-262 GT:PL:GQ 1/1:255,235,0:99 -19 9358486 . T G 158 . DP=62;AF1=1;CI95=1,1;DP4=0,0,25,32;MQ=37;FQ=-199 GT:PL:GQ 1/1:191,172,0:99 -19 9358567 . A G 222 . DP=50;AF1=1;CI95=1,1;DP4=0,0,11,39;MQ=37;FQ=-178 GT:PL:GQ 1/1:255,151,0:99 -19 9632540 . A G 222 . DP=19;AF1=1;CI95=1,1;DP4=0,0,11,7;MQ=37;FQ=-81 GT:PL:GQ 1/1:255,54,0:99 -19 9632576 . A G 222 . DP=27;AF1=1;CI95=1,1;DP4=0,0,16,10;MQ=37;FQ=-105 GT:PL:GQ 1/1:255,78,0:99 -19 9632798 . A G 140 . DP=29;AF1=1;CI95=1,1;DP4=0,0,14,14;MQ=37;FQ=-111 GT:PL:GQ 1/1:173,84,0:99 -19 9633610 . T C 30.8 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33 GT:PL:GQ 1/1:62,6,0:10 -19 9633663 . T G 40 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36 GT:PL:GQ 1/1:72,9,0:16 -19 9633666 . A G 39 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-36 GT:PL:GQ 1/1:71,9,0:16 -19 9681721 . G A 148 . DP=11;AF1=0.5;CI95=0.5,0.5;DP4=3,0,5,3;MQ=35;FQ=36;PV4=0.49,0.19,0.19,1 GT:PL:GQ 0/1:178,0,63:66 -19 9681741 . A T 81 . DP=8;AF1=1;CI95=1,1;DP4=0,0,6,2;MQ=34;FQ=-51 GT:PL:GQ 1/1:114,24,0:45 -19 9681750 . T A 61.1 . DP=7;AF1=1;CI95=1,1;DP4=0,0,6,1;MQ=34;FQ=-48 GT:PL:GQ 1/1:94,21,0:39 -19 9681756 . G A 45.3 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-42 GT:PL:GQ 1/1:78,15,0:27 -19 9681764 . A T 39.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=32;FQ=-39 GT:PL:GQ 1/1:72,12,0:21 -19 9684345 . A G 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 9952338 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 10057473 . G GTC 75.5 . INDEL;DP=29;AF1=0.5;CI95=0.5,0.5;DP4=1,4,10,0;MQ=33;FQ=73;PV4=0.0037,0.17,0.012,1 GT:PL:GQ 0/1:113,0,109:99 -19 10059270 . G C 21 . DP=35;AF1=0.5;CI95=0.5,0.5;DP4=4,11,0,9;MQ=36;FQ=24;PV4=0.26,3e-14,0.0078,3.5e-05 GT:PL:GQ 0/1:51,0,255:54 -19 10060151 . CAAA CAA 27.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:66,6,0:10 -19 10126690 . A AC 14.6 . INDEL;DP=4;AF1=0.5;CI95=0.5,0.5;DP4=0,2,2,0;MQ=37;FQ=16.1;PV4=0.33,1,1,0.0011 GT:PL:GQ 0/1:52,0,56:53 -19 10130185 . GT G 33.4 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=30;FQ=-43.5 GT:PL:GQ 1/1:73,9,0:16 -19 10133086 . A G 170 . DP=27;AF1=0.5;CI95=0.5,0.5;DP4=10,6,7,4;MQ=37;FQ=173;PV4=1,0.5,1,1 GT:PL:GQ 0/1:200,0,255:99 -19 10153682 . A C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 10157183 . G T 35 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:67,9,0:16 -19 10163595 . A AG 27.2 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:66,6,0:10 -19 10250372 . G A 32 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:64,9,0:16 -19 10250380 . A G 72.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,4;MQ=35;FQ=-42 GT:PL:GQ 1/1:105,15,0:27 -19 10250405 . A G 159 . DP=9;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=32;FQ=-51 GT:PL:GQ 1/1:192,24,0:45 -19 10250417 . T C 222 . DP=13;AF1=1;CI95=1,1;DP4=0,0,9,4;MQ=33;FQ=-66 GT:PL:GQ 1/1:255,39,0:75 -19 10250483 . A T 110 . DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51 GT:PL:GQ 1/1:143,24,0:45 -19 10250497 . C G 55 . DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51 GT:PL:GQ 1/1:88,24,0:45 -19 10250501 . C T 74 . DP=8;AF1=1;CI95=1,1;DP4=0,0,8,0;MQ=32;FQ=-51 GT:PL:GQ 1/1:107,24,0:45 -19 10262515 . A T 3.58 . DP=2;AF1=0.5078;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-12.4;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,15:21 -19 10268290 . T TTC 56.5 . INDEL;DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,4,0;MQ=37;FQ=-12.8;PV4=0.2,0.49,1,0.13 GT:PL:GQ 0/1:94,0,22:25 -19 10281024 . G T 7.8 . DP=5;AF1=0.5007;CI95=0.5,0.5;DP4=0,1,3,0;MQ=37;FQ=-4.28;PV4=0.25,0.023,1,0.14 GT:PL:GQ 0/1:37,0,25:29 -19 10297732 . TGG TGGGG 50.4 . INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:90,9,0:16 -19 10498385 . A T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 10502388 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 10525511 . A C 13.2 . DP=9;AF1=0.5;CI95=0.5,0.5;DP4=4,1,0,4;MQ=33;FQ=16.1;PV4=0.048,0.019,0.0056,1 GT:PL:GQ 0/1:43,0,107:46 -19 10590412 . G C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 10607212 . A G 4.13 . DP=7;AF1=0.4998;CI95=0.5,0.5;DP4=1,2,2,0;MQ=37;FQ=6.2;PV4=0.4,0.00041,1,1 GT:PL:GQ 0/1:32,0,89:31 -19 10656785 . TA TAAA 37.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:77,9,0:16 -19 10663128 . A G 121 . DP=22;AF1=0.5;CI95=0.5,0.5;DP4=5,5,7,5;MQ=37;FQ=124;PV4=1,0.0086,1,1 GT:PL:GQ 0/1:151,0,173:99 -19 10669900 . TC TCC 21.5 . INDEL;DP=3;AF1=0.5013;CI95=0.5,0.5;DP4=0,1,2,0;MQ=37;FQ=-11.8;PV4=0.33,1,1,0.027 GT:PL:GQ 0/1:59,0,23:26 -19 10681183 . G C 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 10689339 . TA TAAA 82.7 . INDEL;DP=7;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-49.5 GT:PL:GQ 1/1:123,15,0:27 -19 10690081 . GT GTTT 23.2 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:62,6,0:10 -19 10698013 . G C 4.61 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:34,6,0:5 -19 10699336 . AGG AG 73.5 . INDEL;DP=7;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,2,2;MQ=37;FQ=-12.8;PV4=1,1,1,0.14 GT:PL:GQ 0/1:111,0,22:25 -19 10700484 . A C 122 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,4,2;MQ=37;FQ=-45 GT:PL:GQ 1/1:155,18,0:33 -19 10700486 . G GC 95 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:135,12,0:21 -19 10701724 . AGG AG 19.5 . INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=1,4,2,1;MQ=37;FQ=22.5;PV4=0.46,0.32,1,0.0032 GT:PL:GQ 0/1:57,0,130:60 -19 10702354 . T TCTGG 73 . INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:113,12,0:21 -19 10773851 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 10788446 . T C 13.2 . DP=32;AF1=0.5;CI95=0.5,0.5;DP4=12,1,0,7;MQ=37;FQ=16.1;PV4=0.0001,0.00062,1,1 GT:PL:GQ 0/1:43,0,165:46 -19 10924486 . T C 3.55 . DP=2;AF1=0.5006;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=-4.74;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,25:28 -19 10927766 . G GAT 11.8 . INDEL;DP=5;AF1=0.5;CI95=0.5,0.5;DP4=0,3,1,1;MQ=37;FQ=14.6;PV4=0.4,0.22,1,0.0014 GT:PL:GQ 0/1:49,0,79:51 -19 10947182 . G C 41.8 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:73,6,0:10 -19 10948976 . TC TCC 64.9 . INDEL;DP=7;AF1=0.5554;CI95=0.5,1;DP4=1,0,3,2;MQ=35;FQ=-27.5;PV4=1,0.27,1,0.35 GT:PL:GQ 0/1:102,0,7:10 -19 10972143 . G T 8.44 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:39,6,0:8 -19 10975413 . C CA 12.5 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:51,6,0:9 -19 11017779 . TC TCAC 16.3 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:55,6,0:10 -19 11122585 . T TC 53.7 . INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=33;FQ=-49.5 GT:PL:GQ 1/1:94,15,0:27 -19 11165572 . A G 222 . DP=16;AF1=1;CI95=1,1;DP4=0,0,10,6;MQ=37;FQ=-75 GT:PL:GQ 1/1:255,48,0:93 -19 11165677 . G A 49.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45 GT:PL:GQ 1/1:82,18,0:33 -19 11165689 . T A 85.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45 GT:PL:GQ 1/1:118,18,0:33 -19 11165712 . A G 57.3 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,2;MQ=37;FQ=-42 GT:PL:GQ 1/1:90,15,0:27 -19 11196378 . CTTT CTTTT 214 . INDEL;DP=34;AF1=1;CI95=1,1;DP4=0,0,18,15;MQ=37;FQ=-134 GT:PL:GQ 1/1:255,99,0:99 -19 11196544 . C T 141 . DP=19;AF1=1;CI95=1,1;DP4=0,0,7,11;MQ=37;FQ=-81 GT:PL:GQ 1/1:174,54,0:99 -19 11196769 . A G 174 . DP=23;AF1=1;CI95=1,1;DP4=0,0,6,15;MQ=37;FQ=-90 GT:PL:GQ 1/1:207,63,0:99 -19 11402540 . TC T 32.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:72,9,0:16 -19 11465876 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 11467556 . ATGTGTGTGTGTGTGT ATGTGTGTGTGTGT 216 . INDEL;DP=92;AF1=0.5;CI95=0.5,0.5;DP4=19,27,6,22;MQ=37;FQ=217;PV4=0.13,0.00092,0.36,1 GT:PL:GQ 0/1:254,0,255:99 -19 11472871 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 11489280 . A T 13 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=32;FQ=-33 GT:PL:GQ 1/1:44,6,0:9 -19 11537444 . C CG 48.5 . INDEL;DP=6;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,0,4;MQ=37;FQ=-12.8;PV4=0.2,0.18,1,1 GT:PL:GQ 0/1:86,0,22:25 -19 11544046 . G GCT 74.5 . INDEL;DP=28;AF1=1;CI95=1,1;DP4=0,0,9,0;MQ=35;FQ=-61.5 GT:PL:GQ 1/1:115,27,0:51 -19 11546250 . A G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 11583902 . A C 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-3.07;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,29:29 -19 11593164 . G GCC 121 . INDEL;DP=16;AF1=1;CI95=0.5,1;DP4=1,0,15,0;MQ=36;FQ=-45.5;PV4=1,1,0.36,0.34 GT:PL:GQ 1/1:161,11,0:19 -19 11593167 . A G 32 . DP=16;AF1=1;CI95=0.5,1;DP4=1,0,10,0;MQ=37;FQ=-30;PV4=1,0.0089,1,1 GT:PL:GQ 1/1:62,3,0:6 -19 11632363 . A AGT 45.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:85,9,0:16 -19 11660704 . GAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG GAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG 8.83 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:47,6,0:8 -19 11661671 . TC TCC 29.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:68,6,0:10 -19 11676455 . CT C 14.6 . INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=0,2,1,1;MQ=37;FQ=14.1;PV4=1,0.25,1,0.23 GT:PL:GQ 0/1:52,0,51:51 -19 11677634 . A G 15.1 . DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=30;FQ=-36 GT:PL:GQ 1/1:47,9,0:14 -19 11777860 . A G 49.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39 GT:PL:GQ 1/1:82,12,0:21 -19 11777864 . C G 51.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39 GT:PL:GQ 1/1:84,12,0:21 -19 11777878 . C G 58.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39 GT:PL:GQ 1/1:91,12,0:21 -19 11777923 . T C 47.5 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39 GT:PL:GQ 1/1:80,12,0:21 -19 11777948 . C G 43.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=28;FQ=-39 GT:PL:GQ 1/1:76,12,0:21 -19 11839957 . A G 38.1 . DP=10;AF1=0.5064;CI95=0.5,0.5;DP4=0,1,4,2;MQ=34;FQ=-11.3;PV4=0.43,0.0041,0.29,0.17 GT:PL:GQ 0/1:68,0,16:19 -19 11839959 . A G 32.1 . DP=11;AF1=0.508;CI95=0.5,0.5;DP4=0,1,4,2;MQ=34;FQ=-12.3;PV4=0.43,0.0011,0.29,0.17 GT:PL:GQ 0/1:62,0,15:18 -19 11839992 . A G 106 . DP=18;AF1=1;CI95=0.5,1;DP4=0,1,13,3;MQ=35;FQ=-41;PV4=0.24,3.8e-07,0.33,0.34 GT:PL:GQ 1/1:139,14,0:25 -19 11840001 . T C 112 . DP=20;AF1=1;CI95=1,1;DP4=0,1,15,3;MQ=35;FQ=-47;PV4=0.21,7.2e-06,0.34,0.37 GT:PL:GQ 1/1:145,20,0:37 -19 11840069 . T C 86.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=37;FQ=-45 GT:PL:GQ 1/1:119,18,0:33 -19 11840074 . GATCATCA GATCA 60.4 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:100,9,0:16 -19 11840087 . A G 19.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:51,6,0:10 -19 11840209 . A G 76.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42 GT:PL:GQ 1/1:109,15,0:27 -19 11840219 . C G 66.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42 GT:PL:GQ 1/1:99,15,0:27 -19 11840229 . T G 65.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42 GT:PL:GQ 1/1:98,15,0:27 -19 11840237 . A T 42.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,2,3;MQ=25;FQ=-42 GT:PL:GQ 1/1:75,15,0:27 -19 11840260 . G C 35.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,2,2;MQ=25;FQ=-39 GT:PL:GQ 1/1:68,12,0:21 -19 11904739 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 11952270 . A G 222 . DP=34;AF1=1;CI95=1,1;DP4=0,1,13,20;MQ=35;FQ=-92;PV4=1,0.16,0.29,1 GT:PL:GQ 1/1:255,65,0:99 -19 11952283 . T C 165 . DP=38;AF1=1;CI95=1,1;DP4=0,0,14,21;MQ=35;FQ=-132 GT:PL:GQ 1/1:198,105,0:99 -19 11952293 . A G 222 . DP=45;AF1=1;CI95=1,1;DP4=0,0,19,25;MQ=34;FQ=-159 GT:PL:GQ 1/1:255,132,0:99 -19 11952355 . G C 21.3 . DP=14;AF1=1;CI95=0.5,1;DP4=0,0,5,0;MQ=30;FQ=-42 GT:PL:GQ 1/1:54,15,0:26 -19 11952357 . T C 39.1 . DP=14;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=32;FQ=-45 GT:PL:GQ 1/1:72,18,0:33 -19 11952381 . C T 82.1 . DP=8;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=36;FQ=-48 GT:PL:GQ 1/1:115,21,0:39 -19 11952422 . CTC CTCGTC 88.7 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-49.5 GT:PL:GQ 1/1:129,15,0:27 -19 11952453 . T C 88.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,5;MQ=37;FQ=-42 GT:PL:GQ 1/1:121,15,0:27 -19 11952566 . C G 112 . DP=9;AF1=1;CI95=1,1;DP4=0,0,5,4;MQ=37;FQ=-54 GT:PL:GQ 1/1:145,27,0:51 -19 11952602 . C T 186 . DP=21;AF1=1;CI95=1,1;DP4=0,0,12,9;MQ=37;FQ=-90 GT:PL:GQ 1/1:219,63,0:99 -19 11952628 . CTCTTCT CTCT 15.6 . INDEL;DP=28;AF1=0.5;CI95=0.5,0.5;DP4=10,13,3,1;MQ=37;FQ=18.5;PV4=0.33,1,1,1 GT:PL:GQ 0/1:53,0,255:56 -19 11952659 . A C 172 . DP=21;AF1=1;CI95=1,1;DP4=0,0,9,12;MQ=37;FQ=-90 GT:PL:GQ 1/1:205,63,0:99 -19 11952675 . T C 178 . DP=17;AF1=1;CI95=1,1;DP4=0,0,8,8;MQ=37;FQ=-75 GT:PL:GQ 1/1:211,48,0:93 -19 11952711 . TA T 31.5 . INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=0,4,1,2;MQ=37;FQ=34.4;PV4=0.43,1,1,0.0096 GT:PL:GQ 0/1:69,0,86:72 -19 11952712 . AGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGC 99.6 . INDEL;DP=9;AF1=1;CI95=0.5,1;DP4=0,0,0,6;MQ=37;FQ=-52.5 GT:PL:GQ 1/1:140,18,0:33 -19 11952805 . A G 198 . DP=21;AF1=1;CI95=1,1;DP4=0,0,8,12;MQ=37;FQ=-87 GT:PL:GQ 1/1:231,60,0:99 -19 11952841 . T G 191 . DP=24;AF1=1;CI95=1,1;DP4=0,0,16,7;MQ=36;FQ=-96 GT:PL:GQ 1/1:224,69,0:99 -19 11952882 . A C 140 . DP=28;AF1=1;CI95=1,1;DP4=0,0,22,6;MQ=34;FQ=-111 GT:PL:GQ 1/1:173,84,0:99 -19 11952895 . A G 104 . DP=25;AF1=1;CI95=1,1;DP4=0,0,21,1;MQ=34;FQ=-93 GT:PL:GQ 1/1:137,66,0:99 -19 11997967 . G C 6.98 . DP=3;AF1=0.5003;CI95=0.5,0.5;DP4=1,0,2,0;MQ=33;FQ=3.2;PV4=1,0.019,0.33,1 GT:PL:GQ 0/1:36,0,28:31 -19 12033202 . G A 27 . DP=4;AF1=0.5008;CI95=0.5,0.5;DP4=0,1,1,2;MQ=28;FQ=-4.12;PV4=1,0.048,0,0.22 GT:PL:GQ 0/1:57,0,25:28 -19 12033225 . T G 178 . DP=15;AF1=1;CI95=0.5,1;DP4=0,1,5,7;MQ=34;FQ=-29;PV4=1,0.23,0.26,0.1 GT:PL:GQ 1/1:207,2,0:5 -19 12033238 . T C 222 . DP=23;AF1=1;CI95=1,1;DP4=0,1,10,9;MQ=35;FQ=-50;PV4=1,0.39,0.32,0.24 GT:PL:GQ 1/1:255,23,0:43 -19 12033263 . A G 222 . DP=32;AF1=1;CI95=1,1;DP4=0,0,15,15;MQ=36;FQ=-117 GT:PL:GQ 1/1:255,90,0:99 -19 12033304 . A G 222 . DP=41;AF1=1;CI95=1,1;DP4=0,0,18,23;MQ=36;FQ=-150 GT:PL:GQ 1/1:255,123,0:99 -19 12033367 . A C 152 . DP=32;AF1=1;CI95=1,1;DP4=0,0,11,19;MQ=37;FQ=-117 GT:PL:GQ 1/1:185,90,0:99 -19 12033372 . TC TCC 214 . INDEL;DP=30;AF1=1;CI95=1,1;DP4=0,0,11,18;MQ=37;FQ=-122 GT:PL:GQ 1/1:255,87,0:99 -19 12033396 . T C 192 . DP=21;AF1=1;CI95=1,1;DP4=0,0,9,11;MQ=37;FQ=-87 GT:PL:GQ 1/1:225,60,0:99 -19 12033437 . A G 181 . DP=8;AF1=1;CI95=1,1;DP4=0,0,4,4;MQ=37;FQ=-51 GT:PL:GQ 1/1:214,24,0:45 -19 12052486 . T C 3.55 . DP=2;AF1=0.5011;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=-5.91;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,23:27 -19 12063068 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12075788 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12596319 . G C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12761248 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12761275 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12845038 . AT ATT 11.5 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:50,6,0:9 -19 12873388 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12979639 . A T 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 12979730 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 12979796 . G A 25.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33 GT:PL:GQ 1/1:57,6,0:10 -19 12980273 . G A 29 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36 GT:PL:GQ 1/1:61,9,0:16 -19 12980707 . A G 86 . DP=10;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54 GT:PL:GQ 1/1:119,27,0:51 -19 12980733 . G A 124 . DP=13;AF1=1;CI95=1,1;DP4=0,0,4,9;MQ=37;FQ=-66 GT:PL:GQ 1/1:157,39,0:75 -19 12980760 . C G 222 . DP=15;AF1=1;CI95=1,1;DP4=0,0,3,12;MQ=37;FQ=-72 GT:PL:GQ 1/1:255,45,0:87 -19 12980967 . G A 104 . DP=10;AF1=1;CI95=1,1;DP4=0,0,3,6;MQ=37;FQ=-54 GT:PL:GQ 1/1:137,27,0:51 -19 12981016 . T C 222 . DP=15;AF1=1;CI95=1,1;DP4=0,0,9,6;MQ=37;FQ=-72 GT:PL:GQ 1/1:255,45,0:87 -19 13670070 . C T 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=25;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -19 13670140 . C T 28 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36 GT:PL:GQ 1/1:60,9,0:16 -19 13670153 . A G 30 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36 GT:PL:GQ 1/1:62,9,0:16 -19 13670161 . G A 27 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36 GT:PL:GQ 1/1:59,9,0:16 -19 14007582 . C A 3.98 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:33,6,0:5 -19 14007612 . AAGAGAG AAGAG 28.2 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:67,6,0:10 -19 14070075 . T A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 14524333 . TAG T 14.6 . INDEL;DP=4;AF1=0.5004;CI95=0.5,0.5;DP4=1,0,1,1;MQ=37;FQ=-7.41;PV4=1,1,1,0.39 GT:PL:GQ 0/1:52,0,28:31 -19 14527043 . T A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 14580308 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 14592466 . GC GCCC 22.2 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:61,6,0:10 -19 14607703 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 15533970 . T C 51 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=30;FQ=-36 GT:PL:GQ 1/1:83,9,0:16 -19 15533994 . A G 45.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=32;FQ=-39 GT:PL:GQ 1/1:78,12,0:21 -19 15534018 . A G 42.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=32;FQ=-39 GT:PL:GQ 1/1:75,12,0:21 -19 15647552 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16143433 . T G 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 16143436 . A C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16213914 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16296200 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16298173 . C A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 16304596 . G C 3.54 . DP=2;AF1=0.5001;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.25;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,30:29 -19 16471631 . T C 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 16548752 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16631177 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 16735479 . G T 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 16737011 . C G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 16751327 . G A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 16800107 . T C 3.54 . DP=3;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 17419010 . C T 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 17752449 . T C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 17767368 . C T 152 . DP=13;AF1=1;CI95=1,1;DP4=0,0,6,7;MQ=36;FQ=-66 GT:PL:GQ 1/1:185,39,0:75 -19 17767372 . G A 161 . DP=13;AF1=1;CI95=1,1;DP4=0,0,6,7;MQ=36;FQ=-66 GT:PL:GQ 1/1:194,39,0:75 -19 18001132 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 18001229 . G C 13.9 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:45,6,0:10 -19 18001743 . A G 3.02 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:30,3,0:4 -19 18001767 . T C 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 18195972 . C T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 18484588 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 18664889 . A ATG 27.5 . INDEL;DP=11;AF1=0.5016;CI95=0.5,0.5;DP4=0,1,0,4;MQ=35;FQ=-12.8;PV4=1,0.18,0.34,0.42 GT:PL:GQ 0/1:65,0,22:25 -19 18671826 . T C 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 18703713 . T G 4.13 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:32,3,0:3 -19 20260046 . C A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 20449580 . A T 4.13 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:32,3,0:3 -19 20452978 . GCC GCCC 102 . INDEL;DP=13;AF1=0.5;CI95=0.5,0.5;DP4=2,1,1,5;MQ=37;FQ=32.5;PV4=0.23,1,1,2.4e-05 GT:PL:GQ 0/1:140,0,67:70 -19 20454525 . C G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 20697944 . G GC 106 . INDEL;DP=13;AF1=0.6243;CI95=0.5,1;DP4=0,1,9,1;MQ=36;FQ=-30.5;PV4=0.18,0.19,0.38,0.11 GT:PL:GQ 0/1:143,0,4:7 -19 20699318 . A T 34.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=34;FQ=-39 GT:PL:GQ 1/1:67,12,0:21 -19 20705340 . G GATT 28.5 . INDEL;DP=5;AF1=0.5008;CI95=0.5,0.5;DP4=1,0,3,0;MQ=34;FQ=-9.98;PV4=1,0.13,0.33,0.0037 GT:PL:GQ 0/1:66,0,25:28 -19 20705889 . A C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 20711314 . TGG TGGGG 17.5 . INDEL;DP=10;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=33;FQ=-43.5 GT:PL:GQ 1/1:57,9,0:15 -19 20711316 . G GGT 89.6 . INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,6,0;MQ=35;FQ=-52.5 GT:PL:GQ 1/1:130,18,0:33 -19 20711320 . G C 32.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,4,0;MQ=37;FQ=-39 GT:PL:GQ 1/1:65,12,0:21 -19 20715519 . G A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 20717383 . G GAACT 25.5 . INDEL;DP=12;AF1=0.5;CI95=0.5,0.5;DP4=1,4,0,3;MQ=36;FQ=28.5;PV4=1,0.48,0.11,0.0065 GT:PL:GQ 0/1:63,0,130:66 -19 21354909 . G A 12.2 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-36 GT:PL:GQ 1/1:44,9,0:14 -19 21467193 . ACCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTC ACCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTC 63 . INDEL;DP=52;AF1=1;CI95=0.5,1;DP4=0,0,1,3;MQ=37;FQ=-46.5 GT:PL:GQ 1/1:103,12,0:21 -19 21470903 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21470906 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21486985 . T C 28 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-36 GT:PL:GQ 1/1:60,9,0:16 -19 21486986 . A AG 65.4 . INDEL;DP=4;AF1=1;CI95=0.5,1;DP4=0,0,1,2;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:105,9,0:16 -19 21736204 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21744637 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21764018 . T A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21789476 . G T 12 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:43,6,0:9 -19 21798928 . C A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 21897216 . A G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 21917388 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 21919108 . AGG AGGG 14.8 . INDEL;DP=6;AF1=0.5263;CI95=0.5,1;DP4=1,0,1,1;MQ=37;FQ=-24.5;PV4=1,1,1,0 GT:PL:GQ 0/1:52,0,10:13 -19 21936202 . A T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 22011899 . A G 96.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39 GT:PL:GQ 1/1:129,12,0:21 -19 22011902 . A C 48.5 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39 GT:PL:GQ 1/1:81,12,0:21 -19 22011911 . A T 67.3 . DP=5;AF1=1;CI95=0.5,1;DP4=0,0,4,1;MQ=37;FQ=-42 GT:PL:GQ 1/1:100,15,0:27 -19 22011974 . G A 222 . DP=37;AF1=1;CI95=1,1;DP4=0,0,17,18;MQ=37;FQ=-132 GT:PL:GQ 1/1:255,105,0:99 -19 22012019 . T C 201 . DP=44;AF1=1;CI95=1,1;DP4=0,0,23,21;MQ=37;FQ=-159 GT:PL:GQ 1/1:234,132,0:99 -19 22012051 . A G 165 . DP=35;AF1=1;CI95=1,1;DP4=0,0,15,19;MQ=37;FQ=-129 GT:PL:GQ 1/1:198,102,0:99 -19 22012155 . T A 193 . DP=24;AF1=1;CI95=1,1;DP4=0,0,16,8;MQ=36;FQ=-99 GT:PL:GQ 1/1:226,72,0:99 -19 22012157 . C G 158 . DP=24;AF1=1;CI95=1,1;DP4=0,0,16,7;MQ=36;FQ=-96 GT:PL:GQ 1/1:191,69,0:99 -19 22012166 . G C 146 . DP=11;AF1=1;CI95=1,1;DP4=0,0,6,5;MQ=35;FQ=-60 GT:PL:GQ 1/1:179,33,0:63 -19 22012217 . T C 222 . DP=17;AF1=1;CI95=1,1;DP4=0,0,7,8;MQ=36;FQ=-72 GT:PL:GQ 1/1:255,45,0:87 -19 22012250 . A G 179 . DP=25;AF1=1;CI95=1,1;DP4=0,0,8,16;MQ=36;FQ=-99 GT:PL:GQ 1/1:212,72,0:99 -19 22012307 . T C 222 . DP=22;AF1=1;CI95=1,1;DP4=0,0,6,16;MQ=36;FQ=-93 GT:PL:GQ 1/1:255,66,0:99 -19 22012325 . A C 217 . DP=12;AF1=1;CI95=1,1;DP4=0,0,4,7;MQ=36;FQ=-60 GT:PL:GQ 1/1:250,33,0:63 -19 22012430 . T C 222 . DP=24;AF1=1;CI95=1,1;DP4=0,0,6,17;MQ=37;FQ=-96 GT:PL:GQ 1/1:255,69,0:99 -19 22012579 . T A 222 . DP=42;AF1=1;CI95=1,1;DP4=0,0,26,15;MQ=37;FQ=-150 GT:PL:GQ 1/1:255,123,0:99 -19 22012727 . C T 222 . DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90 GT:PL:GQ 1/1:255,63,0:99 -19 22012748 . A G 30.5 . DP=18;AF1=1;CI95=0.5,1;DP4=0,0,3,1;MQ=37;FQ=-39 GT:PL:GQ 1/1:63,12,0:21 -19 22012751 . T C 24 . DP=17;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-36 GT:PL:GQ 1/1:56,9,0:15 -19 22012760 . C T 222 . DP=16;AF1=1;CI95=1,1;DP4=0,0,5,10;MQ=36;FQ=-72 GT:PL:GQ 1/1:255,45,0:87 -19 22128042 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 22376925 . G A 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 22516053 . A G 54 . DP=9;AF1=1;CI95=1,1;DP4=0,0,3,5;MQ=36;FQ=-51 GT:PL:GQ 1/1:87,24,0:45 -19 23130188 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 23216070 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 23216752 . T G 6.02 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33 GT:PL:GQ 1/1:36,6,0:6 -19 23216754 . G A 13 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=32;FQ=-33 GT:PL:GQ 1/1:44,6,0:9 -19 23225184 . C T 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 23239936 . C A 5.46 . DP=19;AF1=0.4999;CI95=0.5,0.5;DP4=5,1,0,6;MQ=35;FQ=7.8;PV4=0.015,0.00042,0.072,1 GT:PL:GQ 0/1:34,0,116:34 -19 23281456 . A G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 23309145 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 23309152 . T C 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 23383229 . C G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=0,1,0,1;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 23399342 . T C 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 23418245 . G T 40 . DP=5;AF1=0.5016;CI95=0.5,0.5;DP4=1,0,1,3;MQ=37;FQ=-6.18;PV4=0.4,0.014,1,0.043 GT:PL:GQ 0/1:70,0,22:25 -19 23418278 . T A 88.1 . DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,3;MQ=37;FQ=-45 GT:PL:GQ 1/1:121,18,0:33 -19 23418327 . A G 43.1 . DP=7;AF1=1;CI95=0.5,1;DP4=0,0,2,4;MQ=37;FQ=-45 GT:PL:GQ 1/1:76,18,0:33 -19 23418353 . G C 68 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:100,9,0:16 -19 23418485 . T C 50.1 . DP=7;AF1=1;CI95=1,1;DP4=0,0,5,2;MQ=36;FQ=-48 GT:PL:GQ 1/1:83,21,0:39 -19 23418549 . G A 17.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:49,6,0:10 -19 23418558 . G A 12 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:43,6,0:9 -19 23476446 . G A 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 23750472 . TGCAG TG 112 . INDEL;DP=41;AF1=0.5;CI95=0.5,0.5;DP4=17,13,4,5;MQ=37;FQ=115;PV4=0.71,0.16,1,1 GT:PL:GQ 0/1:150,0,255:99 -19 23750625 . A G 139 . DP=52;AF1=1;CI95=1,1;DP4=0,0,29,22;MQ=37;FQ=-181 GT:PL:GQ 1/1:172,154,0:99 -19 23800889 . TA T 7.35 . INDEL;DP=11;AF1=0.5;CI95=0.5,0.5;DP4=5,3,1,1;MQ=37;FQ=9.94;PV4=1,0.075,1,1 GT:PL:GQ 0/1:44,0,193:45 -19 24001511 . A C 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 24021577 . A G 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 24054562 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 24069383 . T A 27.8 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:59,6,0:10 -19 24125925 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 24191462 . G A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 24196752 . C G 8.44 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-33 GT:PL:GQ 1/1:39,6,0:8 -19 24199057 . C T 6.02 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=25;FQ=-33 GT:PL:GQ 1/1:36,6,0:6 -19 24199212 . CT CTT 18.5 . INDEL;DP=9;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=18.5;PV4=1,1,1,0.027 GT:PL:GQ 0/1:56,0,56:56 -19 24205962 . ACC AC 14.4 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:53,6,0:10 -19 24209339 . CT CTT 11.5 . INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:50,6,0:9 -19 24276126 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 24297919 . C A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 24409006 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 24434846 . C G 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 24439851 . C G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 25085208 . C T 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 25088621 . A C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 25152568 . AG A 13.4 . INDEL;DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:52,6,0:9 -19 25176862 . C T 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 25202314 . G T 3.57 . DP=2;AF1=0.5048;CI95=0.5,0.5;DP4=0,1,1,0;MQ=37;FQ=-10.6;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,17:23 -19 25264826 . T A 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 25568427 . A G 28 . DP=4;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=25;FQ=-36 GT:PL:GQ 1/1:60,9,0:16 -19 25568441 . G A 89 . DP=10;AF1=1;CI95=1,1;DP4=0,0,7,3;MQ=29;FQ=-57 GT:PL:GQ 1/1:122,30,0:57 -19 25568480 . A G 169 . DP=11;AF1=1;CI95=1,1;DP4=0,0,8,3;MQ=30;FQ=-60 GT:PL:GQ 1/1:202,33,0:63 -19 25568513 . T A 124 . DP=9;AF1=1;CI95=1,1;DP4=0,0,6,3;MQ=28;FQ=-54 GT:PL:GQ 1/1:157,27,0:51 -19 25568527 . A G 109 . DP=9;AF1=1;CI95=1,1;DP4=0,0,6,3;MQ=28;FQ=-54 GT:PL:GQ 1/1:142,27,0:51 -19 25568536 . A G 13.2 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=25;FQ=-36 GT:PL:GQ 1/1:45,9,0:14 -19 25581569 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 26697796 . T A 6.2 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:35,3,0:4 -19 26728829 . AGG ATGG,AG 8.83 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,0,3;MQ=33;FQ=-40.5 GT:PL:GQ 1/1:71,30,24,46,0,43:8 -19 26747187 . AGG AG 14.4 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:53,6,0:10 -19 26751288 . G GAC 116 . INDEL;DP=8;AF1=1;CI95=0.5,1;DP4=0,0,5,1;MQ=35;FQ=-52.5 GT:PL:GQ 1/1:156,18,0:33 -19 26756358 . CA CAAA 11.8 . INDEL;DP=6;AF1=0.5;CI95=0.5,0.5;DP4=1,1,1,1;MQ=37;FQ=14.4;PV4=1,0.41,1,0.0024 GT:PL:GQ 0/1:49,0,62:51 -19 26758413 . GT GTT 52.4 . INDEL;DP=6;AF1=1;CI95=0.5,1;DP4=0,0,3,0;MQ=37;FQ=-43.5 GT:PL:GQ 1/1:92,9,0:16 -19 26764380 . C T 13 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-33 GT:PL:GQ 1/1:44,6,0:9 -19 26765941 . AGG AGGGG 24.2 . INDEL;DP=5;AF1=1;CI95=0.5,1;DP4=0,0,1,1;MQ=37;FQ=-40.5 GT:PL:GQ 1/1:63,6,0:10 -19 26780556 . A AC 18.3 . INDEL;DP=3;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=32;FQ=-40.5 GT:PL:GQ 1/1:57,6,0:10 -19 26787476 . G A 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 26803166 . A G 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 26803281 . G T 7.8 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 1/1:37,3,0:4 -19 26827257 . G A 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 26847473 . A C 10.2 . DP=2;AF1=1;CI95=0.5,1;DP4=0,0,0,2;MQ=37;FQ=-33 GT:PL:GQ 1/1:41,6,0:8 -19 26852064 . TACACACACACACACACACACACACACACACACACACACA TACACACACACACACACACACACACACACACACACACA 118 . INDEL;DP=55;AF1=0.5;CI95=0.5,0.5;DP4=8,10,4,6;MQ=37;FQ=121;PV4=1,1,1,1 GT:PL:GQ 0/1:156,0,255:99 -19 27313337 . G A 3.41 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,0;MQ=37;FQ=-33 GT:PL:GQ 1/1:32,6,0:4 -19 27314462 . T C 40 . DP=3;AF1=1;CI95=0.5,1;DP4=0,0,2,1;MQ=37;FQ=-36 GT:PL:GQ 1/1:72,9,0:16 -19 27466173 . C G 3.54 . DP=2;AF1=0.5;CI95=0.5,0.5;DP4=1,0,1,0;MQ=37;FQ=3.54;PV4=1,1,1,1 GT:PL:GQ 0/1:31,0,31:29 -19 28220602 . T G 222 . DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90 GT:PL:GQ 1/1:255,63,0:99 -19 28220622 . C T 222 . DP=21;AF1=1;CI95=1,1;DP4=0,0,8,13;MQ=37;FQ=-90 GT:PL:GQ 1/1:255,63,0:99 -19 28220668 . G A 222 . DP=13;AF1=1;CI95=1,1;DP4=0,0,5,6;MQ=36;FQ=-60 GT:PL:GQ 1/1:255,33,0:63 -19 28220691 . T C 148 . DP=7;AF1=1;CI95=1,1;DP4=0,0,3,4;MQ=36;FQ=-48 GT:PL:GQ 1/1:181,21,0:39 -19 28486996 . T C 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 28643319 . C T 3.55 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:31,3,0:4 -19 28643329 . C T 4.77 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,1,0;MQ=37;FQ=-30 GT:PL:GQ 0/1:33,3,0:3 -19 28714335 . C A 6.98 . DP=1;AF1=1;CI95=0.5,1;DP4=0,0,0,1;MQ=37;FQ=-30 GT:PL:GQ 1/1:36,3,0:4 -19 28837706 . A T 154 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=25;FQ=-66 GT:PL:GQ 1/1:187,39,0:75 -19 28837717 . G A 154 . DP=13;AF1=1;CI95=1,1;DP4=0,0,3,10;MQ=25;FQ=-66 GT:PL:GQ 1/1:187,39,0:75 -19 28837735 . A G 154 . DP=24;AF1=1;CI95=1,1;DP4=0,0,7,14;MQ=25;FQ=-90 GT:PL:GQ 1/1:187,63,0:99 -19 28837767 . A G,T 177 . DP=53;AF1=1;CI95=1,1;DP4=0,0,21,29;MQ=30;FQ=-175 GT:PL:GQ 1/1:210,148,0,204,125,201:99 -19 28837787 . C T 161 . DP=66;AF1=1;CI95=1,1;DP4=0,1,30,35;MQ=31;FQ=-206;PV4=1,1,1,1 GT:PL:GQ 1/1:194,179,0:99 -19 28837805 . A G 222 . DP=54;AF1=1;CI95=1,1;DP4=0,0,26,26;MQ=32;FQ=-184 GT:PL:GQ 1/1:255,157,0:99
--- a/tool-data/snpeff_annotations.loc.sample Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -## Regulation Databases for SnpEff -## These are from the list on: http://snpeff.sourceforge.net/download.html -#genome annotation_name description -#GRCh37.71 nextprot nextprot -#GRCh37.71 motif motif
--- a/tool-data/snpeff_databases.loc.sample Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -## Available Databases for SnpEff -## These are from the list on: http://snpeff.sourceforge.net/download.html -## the Description field in this sample is "Genome : Version" -#Version Description -#GRCh37.68 Homo sapiens : GRCh37.68
--- a/tool-data/snpeff_genomedb.loc.sample Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -## Downloaded Databases for SnpEff -## These are from the list on: http://snpeff.sourceforge.net/download.html -## the Description field in this sample is "Genome : Version" -#Version Description data_dir path -#GRCh37.68 Homo sapiens : GRCh37.68 /home/galaxy/snpEff/data
--- a/tool-data/snpeff_regulationdb.loc.sample Wed Dec 11 08:53:32 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -## Regulation Databases for SnpEff -## These are from the list on: http://snpeff.sourceforge.net/download.html -#genome regulation_name description -#GRCh37.70 CD4 CD4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/snpeffv_annotations.loc.sample Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,5 @@ +## Regulation Databases for SnpEff +## These are from the list on: http://snpeff.sourceforge.net/download.html +#key snpeff_version genome annotation_name description +#SnpEff4.0_GRCh37.75 SnpEff4.0 GRCh37.75 nextprot nextprot +#SnpEff4.0_GRCh38.76 SnpEff4.1 GRCh38.76 motif motif
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/snpeffv_databases.loc.sample Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,5 @@ +## Available Databases for SnpEff +## These are from the list on: http://snpeff.sourceforge.net/download.html +## the Description field in this sample is "Genome : Version" +#key snpeff_version Version Description +#SnpEff4.0_GRCh37.75 SnpEff4.0 GRCh37.75 Homo sapiens : GRCh37.75
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/snpeffv_genomedb.loc.sample Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,6 @@ +## Downloaded Databases for SnpEff +## These are from the list on: http://snpeff.sourceforge.net/download.html +## the Description field in this sample is "Genome : Version" +#Key snpeff_version Version Description data_dir path +#SnpEff4.0_GRCh37.74 SnpEff4.0 GRCh37.74 Homo sapiens : GRCh37.74 /home/galaxy/snpEff/v4_0/data +#SnpEff4.1_GRCh38.76 SnpEff4.1 GRCh38.76 Homo sapiens : GRCh38.76 /home/galaxy/snpEff/v4_1/data
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/snpeffv_regulationdb.loc.sample Thu Jan 22 08:28:37 2015 -0500 @@ -0,0 +1,5 @@ +## Regulation Databases for SnpEff +## These are from the list on: http://snpeff.sourceforge.net/download.html +#Key snpeff_version genome regulation_name description +#SnpEff4.0_GRCh37.74 SnpEff4.0 GRCh37.74 CD4 CD4 +#SnpEff4.1_GRCh38.76 SnpEff4.1 GRCh38.76 CD4 CD4
--- a/tool_data_table_conf.xml.sample Wed Dec 11 08:53:32 2013 -0500 +++ b/tool_data_table_conf.xml.sample Thu Jan 22 08:28:37 2015 -0500 @@ -1,19 +1,19 @@ <tables> - <table name="snpeff_databases" comment_char="#"> - <columns>value, name</columns> - <file path="tool-data/snpeff_databases.loc" /> + <table name="snpeffv_genomedb" comment_char="#"> + <columns>key, version, value, name, path</columns> + <file path="tool-data/snpeffv_genomedb.loc" /> </table> - <table name="snpeff_genomedb" comment_char="#"> - <columns>value, name, path</columns> - <file path="tool-data/snpeff_genomedb.loc" /> + <table name="snpeffv_regulationdb" comment_char="#"> + <columns>key, version, genome, value, name</columns> + <file path="tool-data/snpeffv_regulationdb.loc" /> </table> - <table name="snpeff_regulationdb" comment_char="#"> - <columns>genome, value, name</columns> - <file path="tool-data/snpeff_regulationdb.loc" /> + <table name="snpeffv_annotations" comment_char="#"> + <columns>key, version, genome, value, name</columns> + <file path="tool-data/snpeffv_annotations.loc" /> </table> - <table name="snpeff_annotations" comment_char="#"> - <columns>genome, value, name</columns> - <file path="tool-data/snpeff_annotations.loc" /> + <table name="snpeffv_databases" comment_char="#"> + <columns>key, version, value, name</columns> + <file path="tool-data/snpeffv_databases.loc" /> </table> </tables>
--- a/tool_dependencies.xml Wed Dec 11 08:53:32 2013 -0500 +++ b/tool_dependencies.xml Thu Jan 22 08:28:37 2015 -0500 @@ -1,7 +1,7 @@ <?xml version="1.0"?> <tool_dependency> - <package name="snpEff" version="3.4"> - <repository toolshed="http://toolshed.g2.bx.psu.edu" name="package_snpeff_3_4" owner="iuc" changeset_revision="af7ff8187d09" /> + <package name="snpEff" version="4.0"> + <repository name="package_snpeff_4_0" owner="iuc" changeset_revision="6bc55957927b" toolshed="http://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency>