Mercurial > repos > iuc > snpfreqplot
diff heatmap_for_variants.R @ 1:e362b3143cde draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snpfreqplot/ commit 1bde09fccd1a5412240ebd5c1f34a45ad73cebe2"
| author | iuc |
|---|---|
| date | Thu, 10 Dec 2020 13:41:29 +0000 |
| parents | 1062d6ad6503 |
| children | dc51db22310c |
line wrap: on
line diff
--- a/heatmap_for_variants.R Wed Dec 02 21:23:06 2020 +0000 +++ b/heatmap_for_variants.R Thu Dec 10 13:41:29 2020 +0000 @@ -18,8 +18,8 @@ extractall_data <- function(id) { variants <- variant_files[[id]] tmp <- variants %>% - mutate(posalt = uni_select) %>% - select(posalt, AF) + mutate(unique_selectors = group_select) %>% + select(unique_selectors, AF) colnames(tmp) <- c("Mutation", id) return(tmp) } @@ -27,9 +27,12 @@ extractall_annots <- function(id) { variants <- variant_files[[id]] tmp <- variants %>% - mutate(posalt = uni_select, + mutate(unique_selectors = group_select, effect = EFF....EFFECT, gene = EFF....GENE) %>% - select(posalt, effect, gene) + select(unique_selectors, effect, gene) + # allow "." as an alternative missing value in EFF.EFFECT and EFF.GENE + tmp$effect <- sub("^\\.$", "", tmp$effect) + tmp$gene <- sub("^\\.$", "", tmp$gene) return(tmp) } @@ -53,10 +56,11 @@ ann_final <- processed_annots %>% reduce(function(x, y) { unique(rbind(x, y))}) %>% - filter(posalt %in% colnames(final)) ## apply frequency filter + ## apply frequency filter + filter(unique_selectors %in% colnames(final)) ann_final <- as_tibble(ann_final[str_order( - ann_final$posalt, numeric = T), ]) %>% - column_to_rownames("posalt") ## sort + ann_final$unique_selectors, numeric = T), ]) %>% + column_to_rownames("unique_selectors") ## sort # rename annotations trans <- function(x, mapping, replace_missing=NULL) { @@ -146,6 +150,41 @@ pheat_number_of_clusters)) } + + # Fix Labels +## Prettify names, check for label parity between final and ann_final +fix_label <- function(name) { + ##' Reduce: 424 AGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT A + ##' to: 424 AGT… > A + cols <- unlist(str_split(name, " ")) + ## first 3 are POS REF ALT, and the rest are optional differences + pos_ref_alt <- cols[1:3] + rest <- "" + if (length(cols) > 3) { + rest <- paste0(" :: ", paste(cols[4:length(cols)], sep = " ")) + } + ## Trim the REF or ALT if too long + if (str_length(pos_ref_alt[2]) > 3) { + pos_ref_alt[2] <- paste0(substring(pos_ref_alt[2], 1, 3), "…") + } + if (str_length(pos_ref_alt[3]) > 3) { + pos_ref_alt[3] <- paste0(substring(pos_ref_alt[3], 1, 3), "…") + } + ## Join required + new_name <- paste0(pos_ref_alt[1], " ", + pos_ref_alt[2], " > ", + pos_ref_alt[3]) + ## Join rest + new_name <- paste0(new_name, " ", paste(rest)) +} + +colnames(final) <- sapply(colnames(final), fix_label) +rownames(ann_final) <- sapply(rownames(ann_final), fix_label) +## sanity test +stopifnot(all(colnames(final) %in% rownames(ann_final))) + + + # Perform Plotting get_plot_dims <- function(heat_map) { ## get the dimensions of a pheatmap object ## useful for plot formats that can't be written to a file directly, but
