Mercurial > repos > iuc > stacks_assembleperead

comparison stacks_assembleperead.xml @ 3:ee52d9cfaffc draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit e1c1550e0bd61c88ffead2b1c4f6ab7393052393
author iuc
date Sat, 25 Jun 2016 17:27:42 -0400
parents e3ca198820a8
children ae705d244e28
comparison
equal deleted inserted replaced
2:fea78fd36a05 3:ee52d9cfaffc
1 <tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.0"> 1 <tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.1">
2 <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description> 2 <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description>
3 <macros> 3 <macros>
4 <import>macros.xml</import> 4 <import>macros.xml</import>
5 </macros> 5 </macros>
6 <expand macro="requirements"/> 6 <expand macro="requirements"/>
11 11
12 && 12 &&
13 13
14 #for $input_file in $stacks_col: 14 #for $input_file in $stacks_col:
15 #set $ext = "" 15 #set $ext = ""
16 #if not str($input_file.name).endswith('.tsv'): 16 #if not str($input_file.element_identifier).endswith('.tsv'):
17 #set $ext = ".tsv" 17 #set $ext = ".tsv"
18 #end if 18 #end if
19 ln -s "${input_file}" "stacks_inputs/${input_file.name}${ext}" && 19 ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" &&
20 #end for 20 #end for
21 21
22 #for $input_file in $reads: 22 #for $input_file in $reads:
23 #set $name = str($input_file.name) 23 #set $name = str($input_file.element_identifier)
24 #if $name.endswith('.2.fq'): 24 ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
25 ## sort_read_pairs is expecting strange fastq names... 25 #if $name.endswith('.1.fq'):
26 ## handle a common case
27 #set $name = $name[:-5]+".fq_1"
28 #else if $name.endswith('.2.fq'):
29 ## handle a common case
26 #set $name = $name[:-5]+".fq_2" 30 #set $name = $name[:-5]+".fq_2"
31 #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'):
32 ## no extension, consider it's a fq_2 file
33 #set $name = $name + ".fq_2"
27 #end if 34 #end if
28 ln -s "${input_file}" "reads/${name}" && 35 ln -s "${input_file}" "reads/${name}" &&
29 #end for 36 #end for
30 37
31 sort_read_pairs.pl 38 sort_read_pairs.pl
55 #end if 62 #end if
56 63
57 ]]></command> 64 ]]></command>
58 <inputs> 65 <inputs>
59 <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" /> 66 <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" />
60 <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing sequences" help="Files containing parent sequences from a mapping cross" /> 67 <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing reads to assemble" help="only R2 reads" />
61 68
62 <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" /> 69 <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
63 <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/> 70 <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>
64 71
65 <conditional name="velvet"> 72 <conditional name="velvet">
70 </when> 77 </when>
71 </conditional> 78 </conditional>
72 </inputs> 79 </inputs>
73 <outputs> 80 <outputs>
74 <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}"> 81 <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
75 <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?" ext="fasta" directory="stacks_outputs" /> 82 <filter>not velvet['use_velvet']</filter>
83 <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
76 </collection> 84 </collection>
77 85
78 <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa"> 86 <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
79 <filter>velvet['use_velvet']</filter> 87 <filter>velvet['use_velvet']</filter>
80 </data> 88 </data>
125 </param> 133 </param>
126 <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" /> 134 <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
127 <param name="velvet|use_velvet" value="true" /> 135 <param name="velvet|use_velvet" value="true" />
128 <param name="velvet|contig_length" value="20" /> 136 <param name="velvet|contig_length" value="20" />
129 137
130 <output_collection name="collated">
131 <element name="1">
132 <assert_contents>
133 <has_text text="CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG" />
134 </assert_contents>
135 </element>
136 </output_collection>
137
138 <output name="contigs"> 138 <output name="contigs">
139 <assert_contents> 139 <assert_contents>
140 <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" /> 140 <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />
141 </assert_contents> 141 </assert_contents>
142 </output> 142 </output>