--- a/stacks_assembleperead.xml	Wed Jun 15 06:23:24 2016 -0400
+++ b/stacks_assembleperead.xml	Sat Jun 25 17:27:42 2016 -0400
@@ -1,4 +1,4 @@
-<tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.0">
+<tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.1">
     <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description>
     <macros>
         <import>macros.xml</import>
@@ -13,17 +13,24 @@
 
         #for $input_file in $stacks_col:
             #set $ext = ""
-            #if not str($input_file.name).endswith('.tsv'):
+            #if not str($input_file.element_identifier).endswith('.tsv'):
                 #set $ext = ".tsv"
             #end if
-            ln -s "${input_file}" "stacks_inputs/${input_file.name}${ext}" &&
+            ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" &&
         #end for
 
         #for $input_file in $reads:
-            #set $name = str($input_file.name)
-            #if $name.endswith('.2.fq'):
-                ## sort_read_pairs is expecting strange fastq names...
+            #set $name = str($input_file.element_identifier)
+            ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
+            #if $name.endswith('.1.fq'):
+                ## handle a common case
+                #set $name = $name[:-5]+".fq_1"
+            #else if $name.endswith('.2.fq'):
+                ## handle a common case
                 #set $name = $name[:-5]+".fq_2"
+            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'):
+                ## no extension, consider it's a fq_2 file
+                #set $name = $name + ".fq_2"
             #end if
             ln -s "${input_file}" "reads/${name}" &&
         #end for
@@ -57,7 +64,7 @@
     ]]></command>
     <inputs>
         <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" />
-        <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing sequences" help="Files containing parent sequences from a mapping cross" />
+        <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing reads to assemble" help="only R2 reads" />
 
         <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
         <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>
@@ -72,7 +79,8 @@
     </inputs>
     <outputs>
         <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
-            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?" ext="fasta" directory="stacks_outputs" />
+            <filter>not velvet['use_velvet']</filter>
+            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
         </collection>
 
         <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
@@ -127,14 +135,6 @@
             <param name="velvet|use_velvet" value="true" />
             <param name="velvet|contig_length" value="20" />
 
-            <output_collection name="collated">
-                <element name="1">
-                    <assert_contents>
-                        <has_text text="CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG" />
-                    </assert_contents>
-                </element>
-            </output_collection>
-
             <output name="contigs">
                 <assert_contents>
                     <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />