Mercurial > repos > iuc > stacks_populations
comparison stacks_populations.xml @ 4:d0b325dfe508 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit 643293a896a2ccfac10fe995f48c7f01c1a89a7f
author | iuc |
---|---|
date | Mon, 26 Sep 2016 11:44:41 -0400 |
parents | 2ac5c9616748 |
children | f5115df39480 |
comparison
equal
deleted
inserted
replaced
3:2ac5c9616748 | 4:d0b325dfe508 |
---|---|
1 <tool id="stacks_populations" name="Stacks: populations" version="@WRAPPER_VERSION@.1"> | 1 <tool id="stacks_populations" name="Stacks: populations" version="@WRAPPER_VERSION@.0"> |
2 <description>analyze a population of individual samples ('populations' program)</description> | 2 <description>analyze a population of individual samples ('populations' program)</description> |
3 <macros> | 3 <macros> |
4 <import>macros.xml</import> | 4 <import>macros.xml</import> |
5 </macros> | 5 </macros> |
6 <expand macro="requirements"/> | 6 <expand macro="requirements"/> |
10 | 10 |
11 mkdir stacks_outputs | 11 mkdir stacks_outputs |
12 | 12 |
13 && | 13 && |
14 | 14 |
15 #for $input_file in $options_usage.input_col: | 15 #if str($options_usage.input_type) == 'stacks': |
16 #set $filename = str($input_file.element_identifier) | 16 #for $input_file in $options_usage.input_col: |
17 #if not $filename.endswith('.tsv'): | 17 #set $filename = str($input_file.element_identifier) |
18 #set $filename = $filename + ".tsv" | 18 #if not $filename.endswith('.tsv'): |
19 #end if | 19 #set $filename = $filename + ".tsv" |
20 #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename): | 20 #end if |
21 ln -s "${input_file}" "stacks_outputs/${filename}" && | 21 #if re.search('\.(tags|snps|alleles|matches)(\.tsv)?$', $filename): |
22 #end if | 22 ln -s "${input_file}" "stacks_outputs/${filename}" && |
23 #end for | 23 #end if |
24 #end for | |
25 #end if | |
24 | 26 |
25 populations | 27 populations |
26 | 28 |
27 -t \${GALAXY_SLOTS:-1} | 29 -t \${GALAXY_SLOTS:-1} |
28 | 30 |
29 -P stacks_outputs | 31 #if str($options_usage.input_type) == 'vcf': |
32 -V "$options_usage.input_vcf" | |
33 #else: | |
34 -P stacks_outputs | |
35 -b $advanced_options.batchid | |
36 #end if | |
37 | |
30 -M "$options_usage.popmap" | 38 -M "$options_usage.popmap" |
31 | 39 |
32 ## Data filtering | 40 ## Data filtering |
33 $options_filtering.write_single_snp | 41 $options_filtering.write_single_snp |
34 $options_filtering.write_random_snp | 42 $options_filtering.write_random_snp |
109 -B "$advanced_options.blacklist" | 117 -B "$advanced_options.blacklist" |
110 #end if | 118 #end if |
111 #if $advanced_options.whitelist: | 119 #if $advanced_options.whitelist: |
112 -W "$advanced_options.whitelist" | 120 -W "$advanced_options.whitelist" |
113 #end if | 121 #end if |
114 -b $advanced_options.batchid | |
115 ]]></command> | 122 ]]></command> |
116 | 123 |
117 <inputs> | 124 <inputs> |
118 <section name="options_usage" title="Input" expanded="true"> | 125 <conditional name="options_usage"> |
119 <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" /> | 126 <param name="input_type" type="select" label="Input type" help="select input file type" > |
120 <param name="popmap" type="data" format="tabular,txt" label="Specify a population map" argument="-M" /> | 127 <option value="stacks">Stacks output</option> |
121 </section> | 128 <!--option value="vcf">VCF file</option--> <!-- broken in 1.42 --> |
129 </param> | |
130 <when value="stacks"> | |
131 <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" argument="-P" /> | |
132 <param name="popmap" type="data" format="tabular,txt" label="Specify a population map" argument="-M" /> | |
133 </when> | |
134 <when value="vcf"> | |
135 <param name="input_vcf" format="vcf" type="data" label="VCF file" argument="-V" /> | |
136 <param name="popmap" type="data" format="tabular,txt" label="Specify a population map" argument="-M" /> | |
137 </when> | |
138 </conditional> | |
122 | 139 |
123 <section name="options_filtering" title="Data filtering options" expanded="true"> | 140 <section name="options_filtering" title="Data filtering options" expanded="true"> |
124 | 141 |
125 <param name="minperc" argument="-r" type="float" value="0.5" min="0" max="1" label="Minimum percentage of individuals in a population required to process a locus for that population" /> | 142 <param name="minperc" argument="-r" type="float" value="0.5" min="0" max="1" label="Minimum percentage of individuals in a population required to process a locus for that population" /> |
126 <param name="minpop" argument="-p" type="integer" value="2" label="Minimum number of populations a locus must be present in to process a locus" /> | 143 <param name="minpop" argument="-p" type="integer" value="2" label="Minimum number of populations a locus must be present in to process a locus" /> |
223 <expand macro="populations_output_full"/> | 240 <expand macro="populations_output_full"/> |
224 </outputs> | 241 </outputs> |
225 | 242 |
226 <tests> | 243 <tests> |
227 <test> | 244 <test> |
245 <param name="options_usage|input_type" value="stacks" /> | |
228 <param name="options_usage|input_col"> | 246 <param name="options_usage|input_col"> |
229 <collection type="list"> | 247 <collection type="list"> |
230 <element name="batch_1.catalog.alleles.tsv" ftype="tabular" value="genotypes/batch_1.catalog.alleles.tsv" /> | 248 <element name="batch_1.catalog.alleles.tsv" ftype="tabular" value="genotypes/batch_1.catalog.alleles.tsv" /> |
231 <element name="batch_1.catalog.snps.tsv" ftype="tabular" value="genotypes/batch_1.catalog.snps.tsv" /> | 249 <element name="batch_1.catalog.snps.tsv" ftype="tabular" value="genotypes/batch_1.catalog.snps.tsv" /> |
232 <element name="batch_1.catalog.tags.tsv" ftype="tabular" value="genotypes/batch_1.catalog.tags.tsv" /> | 250 <element name="batch_1.catalog.tags.tsv" ftype="tabular" value="genotypes/batch_1.catalog.tags.tsv" /> |
290 <has_text text="Smoothed Pi" /> | 308 <has_text text="Smoothed Pi" /> |
291 </assert_contents> | 309 </assert_contents> |
292 </output> | 310 </output> |
293 <output name="out_vcf"> | 311 <output name="out_vcf"> |
294 <assert_contents> | 312 <assert_contents> |
295 <has_text text="fileformat=VCFv4.0" /> | 313 <has_text text="fileformat=VCFv4.2" /> |
296 </assert_contents> | 314 </assert_contents> |
297 </output> | 315 </output> |
298 <output name="out_treemix_pop"> | 316 <output name="out_treemix_pop"> |
299 <assert_contents> | 317 <assert_contents> |
300 <has_text text="TreeMix v1.1;" /> | 318 <has_text text="TreeMix v1.1;" /> |
304 <assert_contents> | 322 <assert_contents> |
305 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> | 323 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> |
306 </assert_contents> | 324 </assert_contents> |
307 </output> | 325 </output> |
308 </test> | 326 </test> |
327 <!--test> | |
328 <param name="options_usage|input_type" value="vcf" /> | |
329 <param name="options_usage|input_vcf" value="populations/batch_1.vcf" /> | |
330 <param name="options_usage|popmap" ftype="tabular" value="denovo_map/popmap.tsv" /> | |
331 <param name="options_filtering|correction_select|correction" value="p_value" /> | |
332 | |
333 <param name="populations_output|ordered_export" value="true" /> | |
334 <param name="populations_output|vcf" value="true" /> | |
335 <param name="populations_output|vcf_haplotypes" value="true" /> | |
336 <param name="populations_output|genepop" value="true" /> | |
337 <param name="populations_output|structure" value="true" /> | |
338 <param name="populations_output|fasta" value="true" /> | |
339 <param name="populations_output|fasta_strict" value="true" /> | |
340 <param name="populations_output|hzar" value="true" /> | |
341 <param name="populations_output|phase" value="true" /> | |
342 <param name="populations_output|fastphase" value="true" /> | |
343 <param name="populations_output|beagle" value="true" /> | |
344 <param name="populations_output|beagle_phased" value="true" /> | |
345 <param name="populations_output|plink" value="true" /> | |
346 <param name="populations_output|phylip" value="true" /> | |
347 <param name="populations_output|phylip_var" value="true" /> | |
348 <param name="populations_output|phylip_var_all" value="true" /> | |
349 <param name="populations_output|treemix" value="true" /> | |
350 | |
351 <param name="populations_output|options_genomic|genomic" value="true" /> | |
352 <param name="populations_output|options_genomic|enzyme" value="ecoRI" /--> | |
353 | |
354 <!-- populations --> | |
355 <!--output name="out_haplotypes"> | |
356 <assert_contents> | |
357 <has_text text="PopA_01" /> | |
358 </assert_contents> | |
359 </output> | |
360 <output name="out_hapstats"> | |
361 <assert_contents> | |
362 <has_text text="Smoothed Gene Diversity" /> | |
363 </assert_contents> | |
364 </output> | |
365 <output name="out_populations_log"> | |
366 <assert_contents> | |
367 <has_text text="populations version" /> | |
368 </assert_contents> | |
369 </output> | |
370 <output name="out_sumstats_sum"> | |
371 <assert_contents> | |
372 <has_text text="Polymorphic Sites" /> | |
373 </assert_contents> | |
374 </output> | |
375 <output name="out_sumstats"> | |
376 <assert_contents> | |
377 <has_text text="Smoothed Pi" /> | |
378 </assert_contents> | |
379 </output> | |
380 <output name="out_vcf"> | |
381 <assert_contents> | |
382 <has_text text="fileformat=VCFv4.2" /> | |
383 </assert_contents> | |
384 </output> | |
385 <output name="out_treemix_pop"> | |
386 <assert_contents> | |
387 <has_text text="TreeMix v1.1;" /> | |
388 </assert_contents> | |
389 </output> | |
390 <output name="out_fasta"> | |
391 <assert_contents> | |
392 <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" /> | |
393 </assert_contents> | |
394 </output> | |
395 </test--> <!-- broken in 1.42 --> | |
309 </tests> | 396 </tests> |
310 <help> | 397 <help> |
311 <![CDATA[ | 398 <![CDATA[ |
312 .. class:: infomark | 399 .. class:: infomark |
313 | 400 |