Mercurial > repos > iuc > unicycler

comparison unicycler.xml @ 8:9e3e80cc4ad4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit d7f4eb848136b02ae1cf121a5cfb2e6175d35406"
author iuc
date Wed, 18 Nov 2020 20:26:04 +0000
parents 88c240872a65
children 6e26c9afd301
comparison
equal deleted inserted replaced
7:88c240872a65 8:9e3e80cc4ad4
1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> 1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0" profile="20.09">
2 <macros> 2 <macros>
3 <token name="@VERSION@">0.4.8</token> 3 <token name="@VERSION@">0.4.8</token>
4 </macros> 4 </macros>
5 <edam_topics> 5 <edam_topics>
6 <edam_topic>topic_0196</edam_topic> 6 <edam_topic>topic_0196</edam_topic>
202 <param argument="--low_score" optional="true" type="integer" value="" 202 <param argument="--low_score" optional="true" type="integer" value=""
203 label="Score threshold - alignments below this are considered poor" help="default = set automatically"/> 203 label="Score threshold - alignments below this are considered poor" help="default = set automatically"/>
204 </section> 204 </section>
205 </inputs> 205 </inputs>
206 <outputs> 206 <outputs>
207 <data name="assembly_graph" format="tabular" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> 207 <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" />
208 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> 208 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/>
209 </outputs> 209 </outputs>
210 <tests> 210 <tests>
211 <test> 211 <test>
212 <conditional name="paired_unpaired"> 212 <conditional name="paired_unpaired">
238 <param name="min_dead_end_size" value="1000"/> 238 <param name="min_dead_end_size" value="1000"/>
239 </section> 239 </section>
240 <section name="lr_align"> 240 <section name="lr_align">
241 <param name="scores" value="3,-6,-5,-2"/> 241 <param name="scores" value="3,-6,-5,-2"/>
242 </section> 242 </section>
243 <output name="assembly_graph" ftype="tabular"> 243 <output name="assembly_graph" ftype="gfa1">
244 <assert_contents> 244 <assert_contents>
245 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> 245 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
246 </assert_contents> 246 </assert_contents>
247 </output> 247 </output>
248 <output name="assembly" ftype="fasta"> 248 <output name="assembly" ftype="fasta">
249 <assert_contents> 249 <assert_contents>
250 <has_text text="length=5386" /> 250 <has_text text="length=5386" />
293 <param name="min_dead_end_size" value="1000"/> 293 <param name="min_dead_end_size" value="1000"/>
294 </section> 294 </section>
295 <section name="lr_align"> 295 <section name="lr_align">
296 <param name="scores" value="3,-6,-5,-2"/> 296 <param name="scores" value="3,-6,-5,-2"/>
297 </section> 297 </section>
298 <output name="assembly_graph" ftype="tabular"> 298 <output name="assembly_graph" ftype="gfa1">
299 <assert_contents> 299 <assert_contents>
300 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> 300 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
301 </assert_contents> 301 </assert_contents>
302 </output> 302 </output>
303 <output name="assembly" ftype="fasta"> 303 <output name="assembly" ftype="fasta">
304 <assert_contents> 304 <assert_contents>
305 <has_text text="length=5386" /> 305 <has_text text="length=5386" />
340 <param name="min_dead_end_size" value="1000"/> 340 <param name="min_dead_end_size" value="1000"/>
341 </section> 341 </section>
342 <section name="lr_align"> 342 <section name="lr_align">
343 <param name="scores" value="3,-6,-5,-2"/> 343 <param name="scores" value="3,-6,-5,-2"/>
344 </section> 344 </section>
345 <output name="assembly_graph" ftype="tabular"> 345 <output name="assembly_graph" ftype="gfa1">
346 <assert_contents> 346 <assert_contents>
347 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> 347 <has_line_matching expression="S\t1\t[ATCG]{5386,5386}\tLN:i:5386\tdp:f:1.0"/>
348 </assert_contents> 348 </assert_contents>
349 </output> 349 </output>
350 <output name="assembly" ftype="fasta"> 350 <output name="assembly" ftype="fasta">
351 <assert_contents> 351 <assert_contents>
352 <has_text text="length=5386" /> 352 <has_text text="length=5386" />
360 <param name="min_anchor_seg_len" value="10"/> 360 <param name="min_anchor_seg_len" value="10"/>
361 <section name="spades"> 361 <section name="spades">
362 <param name="kmers" value="21,23"/> 362 <param name="kmers" value="21,23"/>
363 </section> 363 </section>
364 <param name="long" value="only_long.fasta" ftype="fasta" /> 364 <param name="long" value="only_long.fasta" ftype="fasta" />
365 <output name="assembly_graph" ftype="tabular"> 365 <output name="assembly_graph" ftype="gfa1">
366 <assert_contents> 366 <assert_contents>
367 <has_text text="S" /> 367 <has_text text="S" />
368 </assert_contents> 368 </assert_contents>
369 </output> 369 </output>
370 <output name="assembly" ftype="fasta"> 370 <output name="assembly" ftype="fasta">