--- a/unicycler.xml	Sat Feb 09 17:02:48 2019 -0500
+++ b/unicycler.xml	Tue Oct 08 02:47:44 2019 -0400
@@ -1,7 +1,13 @@
 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0">
     <macros>
-        <token name="@VERSION@">0.4.7</token>
+        <token name="@VERSION@">0.4.8</token>
     </macros>
+    <edam_topics>
+        <edam_topic>topic_0196</edam_topic>
+    </edam_topics>
+    <edam_operations>
+        <edam_operation>operation_0525</edam_operation>
+    </edam_operations>
     <requirements>
         <requirement type="package" version="@VERSION@">unicycler</requirement>
     </requirements>
@@ -88,6 +94,9 @@
 #end if
 --kmer_count '$spades.kmer_count'
 --depth_filter '$spades.depth_filter'
+#if $spades.largest_component
+    --largest_component
+#end if
 ## Rotation Options section
 ## ----------------------------------------------------------
 $rotation.no_rotate
@@ -163,6 +172,8 @@
             <param argument="--kmer_count" type="integer" min="0" value="10" label="Number of k-mer steps to use in SPAdes assembly"/>
             <param argument="--depth_filter" type="float" min="0" max="1" value="0.25"
                 label="Filter out contigs lower than this fraction of the chromosomal depth" help="It is done if does not result in graph dead ends"/>
+            <param argument="--largest_component" type="boolean" checked="false"
+                label="Only keep the largest connected component of the assembly graph"/>
         </section>
         <section name="rotation" expanded="false" title="Rotation options"
             help="These options control the rotation of completed circular sequence near the end of the Unicycler pipeline. Use this ONLY if you know what you are doing!">
@@ -231,7 +242,7 @@
             </section>
             <output name="assembly_graph" ftype="tabular">
                 <assert_contents>
-                    <has_text text="TACGGGGAAGGACGTC"/>
+                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/>
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -286,7 +297,7 @@
             </section>
             <output name="assembly_graph" ftype="tabular">
                 <assert_contents>
-                    <has_text text="TACGGGGAAGGACGTC" />
+                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">
@@ -333,7 +344,7 @@
             </section>
             <output name="assembly_graph" ftype="tabular">
                 <assert_contents>
-                    <has_text text="TACGGGGAAGGACGTC" />
+                    <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" />
                 </assert_contents>
             </output>
             <output name="assembly" ftype="fasta">