Mercurial > repos > iuc > vg_deconstruct
changeset 0:a347dad1f305 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/vg commit fc3deb5bce07a12b7f9bbd380118a7d2230a1003"
| author | iuc |
|---|---|
| date | Thu, 09 Apr 2020 04:36:41 -0400 |
| parents | |
| children | 76d18b1e970b |
| files | deconstruct.xml macros.xml test-data/hla.vg test-data/hla.xg test-data/hla_variants.vcf test-data/snarls.pb test-data/x.gfa test-data/x.json test-data/x.vg |
| diffstat | 9 files changed, 631 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/deconstruct.xml Thu Apr 09 04:36:41 2020 -0400 @@ -0,0 +1,82 @@ +<tool id="vg_deconstruct" name="vg deconstruct" version="@TOOL_VERSION@"> + <description>construct a dynamic succinct variation graph</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ +ln -s '$infile' ./infile.${infile.ext} && + +vg deconstruct +#if $path: + --path '${','.join([$p for $p in $path])}' +#end if +#if $path_prefix + --path-prefix '${','.join([$p for $p in $path_prefix])}' +#end if +#if $alt_prefix + --alt-prefix '${','.join([$p for $p in $alt_prefix])}' +#end if +#if $snarls: + --snarls '$snarls' +#end if +$path_traversals ## -e +--threads=\${GALAXY_SLOTS:-1} +./infile.${infile.ext} + +> '$output' + + ]]></command> + <inputs> + <param name="infile" type="data" format="xg,odgi" label="Graph files" /> + <param argument="--path" type="text" value="" label="A reference path to deconstruct against" + help="comma-separated list accepted"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + <param argument="--path-prefix" type="text" value="" label="All paths beginning with this value used as reference" + help="comma-separated list accepted"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + <param argument="--alt-prefix" type="text" value="" label="Non-reference paths beginning with with this value get lumped together to same sample in VCF" + help="comma-separated list accepted"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + <param argument="--snarls" type="data" format="xg,odgi" label="Snarls files" optional="true" + help="from `vg snarls` to avoid recomputing" /> + + <param argument="--path-traversals" type="boolean" truevalue="--path-traversals" falsevalue="" checked="false" + label="Only consider traversals that correspond to paths in the grpah" /> + </inputs> + <outputs> + <data name="output" format="vcf" /> + </outputs> + <tests> + <test> + <param name="infile" value="hla.xg" /> + <param name="path" value="gi|568815592:29791752-29792749" /> + <param name="path_traversals" value="true" /> + <output name="output" file="hla_variants.vcf" /> + </test> + </tests> + <help><![CDATA[ +variation graph (vg) deconstruct module +----------------------------------- + +Creates VCF records for Snarls present in a graph (relative to a chosen reference path). + + ]]></help> + <expand macro="citations"> + </expand> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Thu Apr 09 04:36:41 2020 -0400 @@ -0,0 +1,14 @@ +<?xml version="1.0"?> +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">vg</requirement> + </requirements> + </xml> + <token name="@TOOL_VERSION@">1.23.0</token> + <xml name="citations"> + <citations> + <yield /> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/hla_variants.vcf Thu Apr 09 04:36:41 2020 -0400 @@ -0,0 +1,21 @@ +##fileformat=VCFv4.2 +##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> +##contig=<ID=gi|568815592:29791752-29792749,length=998> +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT gi|157734152:29563108-29564082 gi|528476637:29761569-29762543 gi|568815454:1057585-1058559 gi|568815529:1275535-1276509 gi|568815551:1054737-1055734 gi|568815561:1054328-1055325 gi|568815564:1054403-1055400 gi|568815567:1054737-1055711 gi|568815569:1097903-1098900 +gi|568815592:29791752-29792749 92 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 105 . C T 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 151 . CAG C 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 160 . A G 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 222 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 283 . C G 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 295 . TT CC 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 348 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 357 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 395 . T C 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 468 . T C 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 583 . G C 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 621 . G T 23 . . GT 0 1 0 0 0 0 0 1 0 +gi|568815592:29791752-29792749 660 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 824 . CGCGGGCGCCGTGGATGGAGCA C 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 982 . G A 23 . . GT 1 1 1 1 0 0 0 1 0 +gi|568815592:29791752-29792749 995 . C T 23 . . GT 1 1 1 1 0 0 0 1 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/x.gfa Thu Apr 09 04:36:41 2020 -0400 @@ -0,0 +1,513 @@ +H VN:Z:1.0 +S 56 ATTAGCCATGTGACTTTGAACAAGTTAGTTAA +S 35 A +S 110 TCATTGTCAAC +S 60 T +S 30 ACGTTTGACAATCTATCAC +S 6 TTG +S 67 T +S 215 A +S 73 A +S 182 CTGCTCTCTT +S 164 G +S 115 ACATTAGGA +S 153 T +S 112 ACAGTCAACGCTCAATACAAGG +S 185 TTGTCAGATC +S 64 A +S 186 G +S 90 GAGGAAAGCCTCTGACAACTGGT +S 139 GGGCAC +S 4 T +S 13 A +S 86 C +S 168 A +S 207 CAAA +S 104 TCCTTG +S 183 A +S 52 A +S 177 T +S 12 ATAT +S 179 TGTCCAGGAATGAACC +S 75 A +S 23 T +S 111 A +S 41 TGGAGCCA +S 43 G +S 11 T +S 68 GGAGAT +S 171 G +S 69 C +S 82 G +S 85 G +S 130 TTGTGT +S 119 G +S 125 T +S 39 C +S 77 A +S 126 G +S 108 C +S 71 AT +S 66 C +S 103 C +S 156 C +S 59 G +S 172 CTGCTCTTTCCCTCAATTGTTCATTTGTCT +S 208 T +S 2 A +S 10 A +S 27 CTTTGATTTATTTGAAGT +S 26 T +S 211 GG +S 124 TAAGACCCAGAGGGCTCACCCAGAGTCGAG +S 144 T +S 127 CTCAAGGACAGCTCTCC +S 116 A +S 100 T +S 79 TTTGCTGTGAAGATTAAATTAGGTGATGCTTG +S 200 C +S 20 TGCTATGTGTAACTAGTAATGGTAATGGATAT +S 81 T +S 195 A +S 141 T +S 187 A +S 213 A +S 135 T +S 9 AAATTTTCTGGAGTTCTAT +S 189 A +S 138 T +S 109 T +S 161 T +S 107 GGCTCTTCTGGCTT +S 46 T +S 57 TCTCTCTGAACTTCAGTT +S 152 GCTCTCCTTGTCCCTCC +S 170 C +S 88 C +S 129 T +S 209 G +S 120 CTCTGCTCACCG +S 78 G +S 133 CAGAGTGTATACGA +S 72 G +S 24 TT +S 8 G +S 184 C +S 37 A +S 1 CAAATAAG +S 137 TAACTCTGTTC +S 22 C +S 83 A +S 154 C +S 190 C +S 201 T +S 99 C +S 121 C +S 206 C +S 14 T +S 33 AGGGGTAATGTGGGGAA +S 40 T +S 113 A +S 174 T +S 165 A +S 142 GGTGAAAGA +S 5 C +S 55 T +S 114 G +S 123 GATCTTCAAGTTTGAAAATTGCATCTCAAATC +S 32 T +S 136 G +S 117 T +S 45 C +S 145 AACAGAGGAAATGCC +S 197 T +S 196 AGGGC +S 210 CTACCCAGGCCATTTTAAGTTTCCTGT +S 151 A +S 54 G +S 63 C +S 191 TTCTCATCCCTCCT +S 91 G +S 62 ATT +S 205 TACTCCACAT +S 158 GATCTCTTCACT +S 150 T +S 176 C +S 122 T +S 58 C +S 199 T +S 28 A +S 173 C +S 148 GGCTTTTTATCAGAACATGTTTCCAAGCTTAT +S 188 G +S 92 A +S 36 TGGAAAGAATAC +S 98 TA +S 204 C +S 118 TGGCAGTAGCTCAGAGATCT +S 162 C +S 84 AAGCT +S 7 A +S 25 C +S 203 G +S 95 TTACTG +S 76 G +S 34 G +S 50 TCCTCACTTTGCC +S 93 A +S 18 TCCTGG +S 194 G +S 147 T +S 42 T +S 87 AGGGAATAGTGCCTGGCAT +S 132 C +S 140 C +S 157 A +S 167 G +S 169 GAA +S 202 TAA +S 16 G +S 180 G +S 160 GCCT +S 19 T +S 49 A +S 44 ACAAATCTGGGT +S 31 C +S 146 G +S 74 CTACTGACAGCAGA +S 106 A +S 61 A +S 29 G +S 94 G +S 212 ACTAAGGACAAAGGTGCGGGGAGAT +S 102 GAAACATTTGGCTATTGACCTCTTTC +S 128 C +S 159 G +S 70 G +S 21 GTTGGGCTT +S 193 C +S 38 AAGAT +S 163 TTATCTTTACTGTTACC +S 131 T +S 192 T +S 101 TTACTATGAATCCTCACCTTCCTTGACTTCTT +S 105 G +S 17 T +S 53 CA +S 47 CAA +S 175 A +S 166 AATCTTTCC +S 89 A +S 214 G +S 198 C +S 3 G +S 80 TGA +S 96 C +S 51 G +S 178 A +S 149 CCCTTTTCCC +S 155 A +S 181 A +S 143 A +S 48 G +S 15 CCAACTCTCTGG +S 65 TCTCTAATA +S 97 T +S 134 A +P x 1+,3+,5+,6+,8+,9+,11+,12+,14+,15+,17+,18+,20+,21+,23+,24+,26+,27+,29+,30+,32+,33+,35+,36+,38+,40+,41+,43+,44+,46+,47+,49+,50+,52+,53+,55+,56+,57+,60+,61+,62+,64+,65+,67+,68+,70+,71+,73+,74+,76+,78+,79+,81+,83+,84+,86+,87+,89+,90+,92+,94+,95+,97+,98+,100+,101+,102+,103+,104+,106+,107+,109+,110+,112+,114+,115+,117+,118+,120+,122+,123+,124+,126+,127+,129+,130+,132+,133+,135+,136+,137+,139+,141+,142+,144+,145+,147+,148+,149+,151+,152+,154+,155+,157+,158+,159+,160+,162+,163+,165+,166+,168+,169+,171+,172+,174+,176+,177+,179+,181+,182+,184+,185+,187+,188+,190+,191+,193+,195+,196+,198+,199+,201+,202+,204+,205+,206+,207+,209+,210+,211+,212+,214+,215+ 8M,1M,1M,3M,1M,19M,1M,4M,1M,12M,1M,6M,32M,9M,1M,2M,1M,18M,1M,19M,1M,17M,1M,12M,5M,1M,8M,1M,12M,1M,3M,1M,13M,1M,2M,1M,32M,18M,1M,1M,3M,1M,9M,1M,6M,1M,2M,1M,14M,1M,1M,32M,1M,1M,5M,1M,19M,1M,23M,1M,1M,6M,1M,2M,1M,32M,26M,1M,6M,1M,14M,1M,11M,22M,1M,9M,1M,20M,12M,1M,32M,30M,1M,17M,1M,6M,1M,14M,1M,1M,11M,6M,1M,9M,1M,15M,1M,32M,10M,1M,17M,1M,1M,1M,12M,1M,4M,1M,17M,1M,9M,1M,3M,1M,30M,1M,1M,1M,16M,1M,10M,1M,10M,1M,1M,1M,14M,1M,1M,5M,1M,1M,1M,3M,1M,10M,1M,4M,1M,27M,2M,25M,1M,1M +L 56 + 57 + 0M +L 35 + 36 + 0M +L 110 + 111 + 0M +L 110 + 112 + 0M +L 60 + 61 + 0M +L 30 + 31 + 0M +L 30 + 32 + 0M +L 6 + 7 + 0M +L 6 + 8 + 0M +L 67 + 68 + 0M +L 73 + 74 + 0M +L 182 + 183 + 0M +L 182 + 184 + 0M +L 164 + 166 + 0M +L 115 + 116 + 0M +L 115 + 117 + 0M +L 153 + 155 + 0M +L 112 + 113 + 0M +L 112 + 114 + 0M +L 185 + 186 + 0M +L 185 + 187 + 0M +L 64 + 65 + 0M +L 186 + 188 + 0M +L 90 + 91 + 0M +L 90 + 92 + 0M +L 139 + 140 + 0M +L 139 + 141 + 0M +L 4 + 6 + 0M +L 13 + 15 + 0M +L 86 + 87 + 0M +L 168 + 169 + 0M +L 207 + 208 + 0M +L 207 + 209 + 0M +L 104 + 105 + 0M +L 104 + 106 + 0M +L 183 + 185 + 0M +L 52 + 53 + 0M +L 177 + 178 + 0M +L 177 + 179 + 0M +L 12 + 13 + 0M +L 12 + 14 + 0M +L 179 + 180 + 0M +L 179 + 181 + 0M +L 75 + 77 + 0M +L 75 + 78 + 0M +L 23 + 24 + 0M +L 111 + 112 + 0M +L 41 + 42 + 0M +L 41 + 43 + 0M +L 43 + 44 + 0M +L 11 + 12 + 0M +L 68 + 69 + 0M +L 68 + 70 + 0M +L 171 + 172 + 0M +L 69 + 71 + 0M +L 82 + 84 + 0M +L 85 + 87 + 0M +L 130 + 131 + 0M +L 130 + 132 + 0M +L 119 + 120 + 0M +L 125 + 127 + 0M +L 39 + 41 + 0M +L 77 + 79 + 0M +L 126 + 127 + 0M +L 108 + 110 + 0M +L 71 + 72 + 0M +L 71 + 73 + 0M +L 66 + 68 + 0M +L 103 + 104 + 0M +L 156 + 158 + 0M +L 59 + 62 + 0M +L 60 + 59 + 0M +L 172 + 173 + 0M +L 172 + 174 + 0M +L 208 + 210 + 0M +L 2 + 4 + 0M +L 2 + 5 + 0M +L 10 + 12 + 0M +L 27 + 28 + 0M +L 27 + 29 + 0M +L 26 + 27 + 0M +L 211 + 212 + 0M +L 124 + 125 + 0M +L 124 + 126 + 0M +L 144 + 145 + 0M +L 127 + 128 + 0M +L 127 + 129 + 0M +L 116 + 118 + 0M +L 100 + 101 + 0M +L 79 + 80 + 0M +L 79 + 81 + 0M +L 200 + 202 + 0M +L 20 + 21 + 0M +L 81 + 82 + 0M +L 81 + 83 + 0M +L 195 + 196 + 0M +L 141 + 142 + 0M +L 187 + 188 + 0M +L 213 + 215 + 0M +L 135 + 136 + 0M +L 135 + 137 + 0M +L 9 + 10 + 0M +L 9 + 11 + 0M +L 189 + 191 + 0M +L 138 + 139 + 0M +L 109 + 110 + 0M +L 161 + 163 + 0M +L 107 + 108 + 0M +L 107 + 109 + 0M +L 46 + 47 + 0M +L 57 + 58 + 0M +L 57 + 60 + 0M +L 152 + 153 + 0M +L 152 + 154 + 0M +L 170 + 172 + 0M +L 88 + 90 + 0M +L 129 + 130 + 0M +L 209 + 210 + 0M +L 120 + 121 + 0M +L 120 + 122 + 0M +L 78 + 79 + 0M +L 133 + 134 + 0M +L 133 + 135 + 0M +L 72 + 74 + 0M +L 24 + 25 + 0M +L 24 + 26 + 0M +L 8 + 9 + 0M +L 184 + 185 + 0M +L 37 + 38 + 0M +L 1 + 2 + 0M +L 1 + 3 + 0M +L 137 + 138 + 0M +L 137 + 139 + 0M +L 22 + 24 + 0M +L 83 + 84 + 0M +L 154 + 155 + 0M +L 190 + 191 + 0M +L 201 + 202 + 0M +L 99 + 101 + 0M +L 121 + 123 + 0M +L 206 + 207 + 0M +L 14 + 15 + 0M +L 33 + 34 + 0M +L 33 + 35 + 0M +L 40 + 41 + 0M +L 113 + 115 + 0M +L 174 + 175 + 0M +L 174 + 176 + 0M +L 165 + 166 + 0M +L 142 + 143 + 0M +L 142 + 144 + 0M +L 5 + 6 + 0M +L 55 + 56 + 0M +L 114 + 115 + 0M +L 123 + 124 + 0M +L 32 + 33 + 0M +L 136 + 137 + 0M +L 117 + 118 + 0M +L 45 + 47 + 0M +L 145 + 146 + 0M +L 145 + 147 + 0M +L 197 + 199 + 0M +L 196 + 197 + 0M +L 196 + 198 + 0M +L 210 + 211 + 0M +L 210 + 212 + 0M +L 151 + 152 + 0M +L 54 + 56 + 0M +L 63 + 65 + 0M +L 191 + 192 + 0M +L 191 + 193 + 0M +L 91 + 93 + 0M +L 91 + 94 + 0M +L 62 + 63 + 0M +L 62 + 64 + 0M +L 205 + 206 + 0M +L 205 + 207 + 0M +L 158 + 159 + 0M +L 158 + 160 + 0M +L 150 + 152 + 0M +L 176 + 177 + 0M +L 122 + 123 + 0M +L 58 + 59 + 0M +L 58 + 61 + 0M +L 199 + 200 + 0M +L 199 + 201 + 0M +L 28 + 30 + 0M +L 173 + 175 + 0M +L 173 + 176 + 0M +L 148 + 149 + 0M +L 188 + 189 + 0M +L 188 + 190 + 0M +L 92 + 93 + 0M +L 92 + 94 + 0M +L 36 + 37 + 0M +L 36 + 38 + 0M +L 98 + 99 + 0M +L 98 + 100 + 0M +L 204 + 205 + 0M +L 118 + 119 + 0M +L 118 + 120 + 0M +L 162 + 163 + 0M +L 84 + 85 + 0M +L 84 + 86 + 0M +L 7 + 9 + 0M +L 25 + 27 + 0M +L 203 + 205 + 0M +L 95 + 96 + 0M +L 95 + 97 + 0M +L 76 + 77 + 0M +L 76 + 78 + 0M +L 34 + 36 + 0M +L 50 + 51 + 0M +L 50 + 52 + 0M +L 93 + 95 + 0M +L 18 + 19 + 0M +L 18 + 20 + 0M +L 194 + 196 + 0M +L 147 + 148 + 0M +L 42 + 44 + 0M +L 87 + 88 + 0M +L 87 + 89 + 0M +L 132 + 133 + 0M +L 140 + 142 + 0M +L 157 + 158 + 0M +L 167 + 169 + 0M +L 169 + 170 + 0M +L 169 + 171 + 0M +L 202 + 203 + 0M +L 202 + 204 + 0M +L 16 + 18 + 0M +L 180 + 182 + 0M +L 160 + 161 + 0M +L 160 + 162 + 0M +L 19 + 20 + 0M +L 49 + 50 + 0M +L 44 + 45 + 0M +L 44 + 46 + 0M +L 31 + 33 + 0M +L 146 + 148 + 0M +L 74 + 75 + 0M +L 74 + 76 + 0M +L 106 + 107 + 0M +L 61 + 62 + 0M +L 29 + 30 + 0M +L 94 + 95 + 0M +L 212 + 213 + 0M +L 212 + 214 + 0M +L 102 + 103 + 0M +L 102 + 104 + 0M +L 128 + 130 + 0M +L 159 + 160 + 0M +L 70 + 71 + 0M +L 21 + 22 + 0M +L 21 + 23 + 0M +L 193 + 194 + 0M +L 193 + 195 + 0M +L 38 + 39 + 0M +L 38 + 40 + 0M +L 163 + 164 + 0M +L 163 + 165 + 0M +L 131 + 133 + 0M +L 192 + 194 + 0M +L 192 + 195 + 0M +L 101 + 102 + 0M +L 105 + 107 + 0M +L 17 + 18 + 0M +L 53 + 54 + 0M +L 53 + 55 + 0M +L 47 + 48 + 0M +L 47 + 49 + 0M +L 175 + 177 + 0M +L 166 + 167 + 0M +L 166 + 168 + 0M +L 89 + 90 + 0M +L 214 + 215 + 0M +L 198 + 199 + 0M +L 3 + 4 + 0M +L 3 + 5 + 0M +L 80 + 81 + 0M +L 96 + 98 + 0M +L 51 + 53 + 0M +L 178 + 179 + 0M +L 149 + 150 + 0M +L 149 + 151 + 0M +L 155 + 156 + 0M +L 155 + 157 + 0M +L 181 + 182 + 0M +L 143 + 145 + 0M +L 48 + 50 + 0M +L 15 + 16 + 0M +L 15 + 17 + 0M +L 65 + 66 + 0M +L 65 + 67 + 0M +L 97 + 98 + 0M +L 134 + 135 + 0M
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/x.json Thu Apr 09 04:36:41 2020 -0400 @@ -0,0 +1,1 @@ +{"edge": [{"from": "1", "to": "2"}, {"from": "1", "to": "3"}, {"from": "2", "to": "4"}, {"from": "2", "to": "5"}, {"from": "3", "to": "4"}, {"from": "3", "to": "5"}, {"from": "4", "to": "6"}, {"from": "5", "to": "6"}, {"from": "6", "to": "7"}, {"from": "6", "to": "8"}, {"from": "7", "to": "9"}, {"from": "8", "to": "9"}, {"from": "9", "to": "10"}, {"from": "9", "to": "11"}, {"from": "10", "to": "12"}, {"from": "11", "to": "12"}, {"from": "12", "to": "13"}, {"from": "12", "to": "14"}, {"from": "13", "to": "15"}, {"from": "14", "to": "15"}, {"from": "15", "to": "16"}, {"from": "15", "to": "17"}, {"from": "16", "to": "18"}, {"from": "17", "to": "18"}, {"from": "18", "to": "19"}, {"from": "18", "to": "20"}, {"from": "19", "to": "20"}, {"from": "20", "to": "21"}, {"from": "21", "to": "22"}, {"from": "21", "to": "23"}, {"from": "22", "to": "24"}, {"from": "23", "to": "24"}, {"from": "24", "to": "25"}, {"from": "24", "to": "26"}, {"from": "25", "to": "27"}, {"from": "26", "to": "27"}, {"from": "27", "to": "28"}, {"from": "27", "to": "29"}, {"from": "28", "to": "30"}, {"from": "29", "to": "30"}, {"from": "30", "to": "31"}, {"from": "30", "to": "32"}, {"from": "31", "to": "33"}, {"from": "32", "to": "33"}, {"from": "33", "to": "34"}, {"from": "33", "to": "35"}, {"from": "34", "to": "36"}, {"from": "35", "to": "36"}, {"from": "36", "to": "37"}, {"from": "36", "to": "38"}, {"from": "37", "to": "38"}, {"from": "38", "to": "39"}, {"from": "38", "to": "40"}, {"from": "39", "to": "41"}, {"from": "40", "to": "41"}, {"from": "41", "to": "42"}, {"from": "41", "to": "43"}, {"from": "42", "to": "44"}, {"from": "43", "to": "44"}, {"from": "44", "to": "45"}, {"from": "44", "to": "46"}, {"from": "45", "to": "47"}, {"from": "46", "to": "47"}, {"from": "47", "to": "48"}, {"from": "47", "to": "49"}, {"from": "48", "to": "50"}, {"from": "49", "to": "50"}, {"from": "50", "to": "51"}, {"from": "50", "to": "52"}, {"from": "51", "to": "53"}, {"from": "52", "to": "53"}, {"from": "53", "to": "54"}, {"from": "53", "to": "55"}, {"from": "54", "to": "56"}, {"from": "55", "to": "56"}, {"from": "56", "to": "57"}, {"from": "57", "to": "58"}, {"from": "57", "to": "60"}, {"from": "58", "to": "59"}, {"from": "58", "to": "61"}, {"from": "60", "to": "59"}, {"from": "59", "to": "62"}, {"from": "60", "to": "61"}, {"from": "61", "to": "62"}, {"from": "62", "to": "63"}, {"from": "62", "to": "64"}, {"from": "63", "to": "65"}, {"from": "64", "to": "65"}, {"from": "65", "to": "66"}, {"from": "65", "to": "67"}, {"from": "66", "to": "68"}, {"from": "67", "to": "68"}, {"from": "68", "to": "69"}, {"from": "68", "to": "70"}, {"from": "69", "to": "71"}, {"from": "70", "to": "71"}, {"from": "71", "to": "72"}, {"from": "71", "to": "73"}, {"from": "72", "to": "74"}, {"from": "73", "to": "74"}, {"from": "74", "to": "75"}, {"from": "74", "to": "76"}, {"from": "75", "to": "77"}, {"from": "75", "to": "78"}, {"from": "76", "to": "77"}, {"from": "76", "to": "78"}, {"from": "77", "to": "79"}, {"from": "78", "to": "79"}, {"from": "79", "to": "80"}, {"from": "79", "to": "81"}, {"from": "80", "to": "81"}, {"from": "81", "to": "82"}, {"from": "81", "to": "83"}, {"from": "82", "to": "84"}, {"from": "83", "to": "84"}, {"from": "84", "to": "85"}, {"from": "84", "to": "86"}, {"from": "85", "to": "87"}, {"from": "86", "to": "87"}, {"from": "87", "to": "88"}, {"from": "87", "to": "89"}, {"from": "88", "to": "90"}, {"from": "89", "to": "90"}, {"from": "90", "to": "91"}, {"from": "90", "to": "92"}, {"from": "91", "to": "93"}, {"from": "91", "to": "94"}, {"from": "92", "to": "93"}, {"from": "92", "to": "94"}, {"from": "93", "to": "95"}, {"from": "94", "to": "95"}, {"from": "95", "to": "96"}, {"from": "95", "to": "97"}, {"from": "96", "to": "98"}, {"from": "97", "to": "98"}, {"from": "98", "to": "99"}, {"from": "98", "to": "100"}, {"from": "99", "to": "101"}, {"from": "100", "to": "101"}, {"from": "101", "to": "102"}, {"from": "102", "to": "103"}, {"from": "102", "to": "104"}, {"from": "103", "to": "104"}, {"from": "104", "to": "105"}, {"from": "104", "to": "106"}, {"from": "105", "to": "107"}, {"from": "106", "to": "107"}, {"from": "107", "to": "108"}, {"from": "107", "to": "109"}, {"from": "108", "to": "110"}, {"from": "109", "to": "110"}, {"from": "110", "to": "111"}, {"from": "110", "to": "112"}, {"from": "111", "to": "112"}, {"from": "112", "to": "113"}, {"from": "112", "to": "114"}, {"from": "113", "to": "115"}, {"from": "114", "to": "115"}, {"from": "115", "to": "116"}, {"from": "115", "to": "117"}, {"from": "116", "to": "118"}, {"from": "117", "to": "118"}, {"from": "118", "to": "119"}, {"from": "118", "to": "120"}, {"from": "119", "to": "120"}, {"from": "120", "to": "121"}, {"from": "120", "to": "122"}, {"from": "121", "to": "123"}, {"from": "122", "to": "123"}, {"from": "123", "to": "124"}, {"from": "124", "to": "125"}, {"from": "124", "to": "126"}, {"from": "125", "to": "127"}, {"from": "126", "to": "127"}, {"from": "127", "to": "128"}, {"from": "127", "to": "129"}, {"from": "128", "to": "130"}, {"from": "129", "to": "130"}, {"from": "130", "to": "131"}, {"from": "130", "to": "132"}, {"from": "131", "to": "133"}, {"from": "132", "to": "133"}, {"from": "133", "to": "134"}, {"from": "133", "to": "135"}, {"from": "134", "to": "135"}, {"from": "135", "to": "136"}, {"from": "135", "to": "137"}, {"from": "136", "to": "137"}, {"from": "137", "to": "138"}, {"from": "137", "to": "139"}, {"from": "138", "to": "139"}, {"from": "139", "to": "140"}, {"from": "139", "to": "141"}, {"from": "140", "to": "142"}, {"from": "141", "to": "142"}, {"from": "142", "to": "143"}, {"from": "142", "to": "144"}, {"from": "143", "to": "145"}, {"from": "144", "to": "145"}, {"from": "145", "to": "146"}, {"from": "145", "to": "147"}, {"from": "146", "to": "148"}, {"from": "147", "to": "148"}, {"from": "148", "to": "149"}, {"from": "149", "to": "150"}, {"from": "149", "to": "151"}, {"from": "150", "to": "152"}, {"from": "151", "to": "152"}, {"from": "152", "to": "153"}, {"from": "152", "to": "154"}, {"from": "153", "to": "155"}, {"from": "154", "to": "155"}, {"from": "155", "to": "156"}, {"from": "155", "to": "157"}, {"from": "156", "to": "158"}, {"from": "157", "to": "158"}, {"from": "158", "to": "159"}, {"from": "158", "to": "160"}, {"from": "159", "to": "160"}, {"from": "160", "to": "161"}, {"from": "160", "to": "162"}, {"from": "161", "to": "163"}, {"from": "162", "to": "163"}, {"from": "163", "to": "164"}, {"from": "163", "to": "165"}, {"from": "164", "to": "166"}, {"from": "165", "to": "166"}, {"from": "166", "to": "167"}, {"from": "166", "to": "168"}, {"from": "167", "to": "169"}, {"from": "168", "to": "169"}, {"from": "169", "to": "170"}, {"from": "169", "to": "171"}, {"from": "170", "to": "172"}, {"from": "171", "to": "172"}, {"from": "172", "to": "173"}, {"from": "172", "to": "174"}, {"from": "173", "to": "175"}, {"from": "173", "to": "176"}, {"from": "174", "to": "175"}, {"from": "174", "to": "176"}, {"from": "175", "to": "177"}, {"from": "176", "to": "177"}, {"from": "177", "to": "178"}, {"from": "177", "to": "179"}, {"from": "178", "to": "179"}, {"from": "179", "to": "180"}, {"from": "179", "to": "181"}, {"from": "180", "to": "182"}, {"from": "181", "to": "182"}, {"from": "182", "to": "183"}, {"from": "182", "to": "184"}, {"from": "183", "to": "185"}, {"from": "184", "to": "185"}, {"from": "185", "to": "186"}, {"from": "185", "to": "187"}, {"from": "186", "to": "188"}, {"from": "187", "to": "188"}, {"from": "188", "to": "189"}, {"from": "188", "to": "190"}, {"from": "189", "to": "191"}, {"from": "190", "to": "191"}, {"from": "191", "to": "192"}, {"from": "191", "to": "193"}, {"from": "192", "to": "194"}, {"from": "192", "to": "195"}, {"from": "193", "to": "194"}, {"from": "193", "to": "195"}, {"from": "194", "to": "196"}, {"from": "195", "to": "196"}, {"from": "196", "to": "197"}, {"from": "196", "to": "198"}, {"from": "197", "to": "199"}, {"from": "198", "to": "199"}, {"from": "199", "to": "200"}, {"from": "199", "to": "201"}, {"from": "200", "to": "202"}, {"from": "201", "to": "202"}, {"from": "202", "to": "203"}, {"from": "202", "to": "204"}, {"from": "203", "to": "205"}, {"from": "204", "to": "205"}, {"from": "205", "to": "206"}, {"from": "205", "to": "207"}, {"from": "206", "to": "207"}, {"from": "207", "to": "208"}, {"from": "207", "to": "209"}, {"from": "208", "to": "210"}, {"from": "209", "to": "210"}, {"from": "210", "to": "211"}, {"from": "210", "to": "212"}, {"from": "211", "to": "212"}, {"from": "212", "to": "213"}, {"from": "212", "to": "214"}, {"from": "213", "to": "215"}, {"from": "214", "to": "215"}], "node": [{"id": "1", "sequence": "CAAATAAG"}, {"id": "2", "sequence": "A"}, {"id": "3", "sequence": "G"}, {"id": "4", "sequence": "T"}, {"id": "5", "sequence": "C"}, {"id": "6", "sequence": "TTG"}, {"id": "7", "sequence": "A"}, {"id": "8", "sequence": "G"}, {"id": "9", "sequence": "AAATTTTCTGGAGTTCTAT"}, {"id": "10", "sequence": "A"}, {"id": "11", "sequence": "T"}, {"id": "12", "sequence": "ATAT"}, {"id": "13", "sequence": "A"}, {"id": "14", "sequence": "T"}, {"id": "15", "sequence": "CCAACTCTCTGG"}, {"id": "16", "sequence": "G"}, {"id": "17", "sequence": "T"}, {"id": "18", "sequence": "TCCTGG"}, {"id": "19", "sequence": "T"}, {"id": "20", "sequence": "TGCTATGTGTAACTAGTAATGGTAATGGATAT"}, {"id": "21", "sequence": "GTTGGGCTT"}, {"id": "22", "sequence": "C"}, {"id": "23", "sequence": "T"}, {"id": "24", "sequence": "TT"}, {"id": "25", "sequence": "C"}, {"id": "26", "sequence": "T"}, {"id": "27", "sequence": "CTTTGATTTATTTGAAGT"}, {"id": "28", "sequence": "A"}, {"id": "29", "sequence": "G"}, {"id": "30", "sequence": "ACGTTTGACAATCTATCAC"}, {"id": "31", "sequence": "C"}, {"id": "32", "sequence": "T"}, {"id": "33", "sequence": "AGGGGTAATGTGGGGAA"}, {"id": "34", "sequence": "G"}, {"id": "35", "sequence": "A"}, {"id": "36", "sequence": "TGGAAAGAATAC"}, {"id": "37", "sequence": "A"}, {"id": "38", "sequence": "AAGAT"}, {"id": "39", "sequence": "C"}, {"id": "40", "sequence": "T"}, {"id": "41", "sequence": "TGGAGCCA"}, {"id": "42", "sequence": "T"}, {"id": "43", "sequence": "G"}, {"id": "44", "sequence": "ACAAATCTGGGT"}, {"id": "45", "sequence": "C"}, {"id": "46", "sequence": "T"}, {"id": "47", "sequence": "CAA"}, {"id": "48", "sequence": "G"}, {"id": "49", "sequence": "A"}, {"id": "50", "sequence": "TCCTCACTTTGCC"}, {"id": "51", "sequence": "G"}, {"id": "52", "sequence": "A"}, {"id": "53", "sequence": "CA"}, {"id": "54", "sequence": "G"}, {"id": "55", "sequence": "T"}, {"id": "56", "sequence": "ATTAGCCATGTGACTTTGAACAAGTTAGTTAA"}, {"id": "57", "sequence": "TCTCTCTGAACTTCAGTT"}, {"id": "58", "sequence": "C"}, {"id": "59", "sequence": "G"}, {"id": "60", "sequence": "T"}, {"id": "61", "sequence": "A"}, {"id": "62", "sequence": "ATT"}, {"id": "63", "sequence": "C"}, {"id": "64", "sequence": "A"}, {"id": "65", "sequence": "TCTCTAATA"}, {"id": "66", "sequence": "C"}, {"id": "67", "sequence": "T"}, {"id": "68", "sequence": "GGAGAT"}, {"id": "69", "sequence": "C"}, {"id": "70", "sequence": "G"}, {"id": "71", "sequence": "AT"}, {"id": "72", "sequence": "G"}, {"id": "73", "sequence": "A"}, {"id": "74", "sequence": "CTACTGACAGCAGA"}, {"id": "75", "sequence": "A"}, {"id": "76", "sequence": "G"}, {"id": "77", "sequence": "A"}, {"id": "78", "sequence": "G"}, {"id": "79", "sequence": "TTTGCTGTGAAGATTAAATTAGGTGATGCTTG"}, {"id": "80", "sequence": "TGA"}, {"id": "81", "sequence": "T"}, {"id": "82", "sequence": "G"}, {"id": "83", "sequence": "A"}, {"id": "84", "sequence": "AAGCT"}, {"id": "85", "sequence": "G"}, {"id": "86", "sequence": "C"}, {"id": "87", "sequence": "AGGGAATAGTGCCTGGCAT"}, {"id": "88", "sequence": "C"}, {"id": "89", "sequence": "A"}, {"id": "90", "sequence": "GAGGAAAGCCTCTGACAACTGGT"}, {"id": "91", "sequence": "G"}, {"id": "92", "sequence": "A"}, {"id": "93", "sequence": "A"}, {"id": "94", "sequence": "G"}, {"id": "95", "sequence": "TTACTG"}, {"id": "96", "sequence": "C"}, {"id": "97", "sequence": "T"}, {"id": "98", "sequence": "TA"}, {"id": "99", "sequence": "C"}, {"id": "100", "sequence": "T"}, {"id": "101", "sequence": "TTACTATGAATCCTCACCTTCCTTGACTTCTT"}, {"id": "102", "sequence": "GAAACATTTGGCTATTGACCTCTTTC"}, {"id": "103", "sequence": "C"}, {"id": "104", "sequence": "TCCTTG"}, {"id": "105", "sequence": "G"}, {"id": "106", "sequence": "A"}, {"id": "107", "sequence": "GGCTCTTCTGGCTT"}, {"id": "108", "sequence": "C"}, {"id": "109", "sequence": "T"}, {"id": "110", "sequence": "TCATTGTCAAC"}, {"id": "111", "sequence": "A"}, {"id": "112", "sequence": "ACAGTCAACGCTCAATACAAGG"}, {"id": "113", "sequence": "A"}, {"id": "114", "sequence": "G"}, {"id": "115", "sequence": "ACATTAGGA"}, {"id": "116", "sequence": "A"}, {"id": "117", "sequence": "T"}, {"id": "118", "sequence": "TGGCAGTAGCTCAGAGATCT"}, {"id": "119", "sequence": "G"}, {"id": "120", "sequence": "CTCTGCTCACCG"}, {"id": "121", "sequence": "C"}, {"id": "122", "sequence": "T"}, {"id": "123", "sequence": "GATCTTCAAGTTTGAAAATTGCATCTCAAATC"}, {"id": "124", "sequence": "TAAGACCCAGAGGGCTCACCCAGAGTCGAG"}, {"id": "125", "sequence": "T"}, {"id": "126", "sequence": "G"}, {"id": "127", "sequence": "CTCAAGGACAGCTCTCC"}, {"id": "128", "sequence": "C"}, {"id": "129", "sequence": "T"}, {"id": "130", "sequence": "TTGTGT"}, {"id": "131", "sequence": "T"}, {"id": "132", "sequence": "C"}, {"id": "133", "sequence": "CAGAGTGTATACGA"}, {"id": "134", "sequence": "A"}, {"id": "135", "sequence": "T"}, {"id": "136", "sequence": "G"}, {"id": "137", "sequence": "TAACTCTGTTC"}, {"id": "138", "sequence": "T"}, {"id": "139", "sequence": "GGGCAC"}, {"id": "140", "sequence": "C"}, {"id": "141", "sequence": "T"}, {"id": "142", "sequence": "GGTGAAAGA"}, {"id": "143", "sequence": "A"}, {"id": "144", "sequence": "T"}, {"id": "145", "sequence": "AACAGAGGAAATGCC"}, {"id": "146", "sequence": "G"}, {"id": "147", "sequence": "T"}, {"id": "148", "sequence": "GGCTTTTTATCAGAACATGTTTCCAAGCTTAT"}, {"id": "149", "sequence": "CCCTTTTCCC"}, {"id": "150", "sequence": "T"}, {"id": "151", "sequence": "A"}, {"id": "152", "sequence": "GCTCTCCTTGTCCCTCC"}, {"id": "153", "sequence": "T"}, {"id": "154", "sequence": "C"}, {"id": "155", "sequence": "A"}, {"id": "156", "sequence": "C"}, {"id": "157", "sequence": "A"}, {"id": "158", "sequence": "GATCTCTTCACT"}, {"id": "159", "sequence": "G"}, {"id": "160", "sequence": "GCCT"}, {"id": "161", "sequence": "T"}, {"id": "162", "sequence": "C"}, {"id": "163", "sequence": "TTATCTTTACTGTTACC"}, {"id": "164", "sequence": "G"}, {"id": "165", "sequence": "A"}, {"id": "166", "sequence": "AATCTTTCC"}, {"id": "167", "sequence": "G"}, {"id": "168", "sequence": "A"}, {"id": "169", "sequence": "GAA"}, {"id": "170", "sequence": "C"}, {"id": "171", "sequence": "G"}, {"id": "172", "sequence": "CTGCTCTTTCCCTCAATTGTTCATTTGTCT"}, {"id": "173", "sequence": "C"}, {"id": "174", "sequence": "T"}, {"id": "175", "sequence": "A"}, {"id": "176", "sequence": "C"}, {"id": "177", "sequence": "T"}, {"id": "178", "sequence": "A"}, {"id": "179", "sequence": "TGTCCAGGAATGAACC"}, {"id": "180", "sequence": "G"}, {"id": "181", "sequence": "A"}, {"id": "182", "sequence": "CTGCTCTCTT"}, {"id": "183", "sequence": "A"}, {"id": "184", "sequence": "C"}, {"id": "185", "sequence": "TTGTCAGATC"}, {"id": "186", "sequence": "G"}, {"id": "187", "sequence": "A"}, {"id": "188", "sequence": "G"}, {"id": "189", "sequence": "A"}, {"id": "190", "sequence": "C"}, {"id": "191", "sequence": "TTCTCATCCCTCCT"}, {"id": "192", "sequence": "T"}, {"id": "193", "sequence": "C"}, {"id": "194", "sequence": "G"}, {"id": "195", "sequence": "A"}, {"id": "196", "sequence": "AGGGC"}, {"id": "197", "sequence": "T"}, {"id": "198", "sequence": "C"}, {"id": "199", "sequence": "T"}, {"id": "200", "sequence": "C"}, {"id": "201", "sequence": "T"}, {"id": "202", "sequence": "TAA"}, {"id": "203", "sequence": "G"}, {"id": "204", "sequence": "C"}, {"id": "205", "sequence": "TACTCCACAT"}, {"id": "206", "sequence": "C"}, {"id": "207", "sequence": "CAAA"}, {"id": "208", "sequence": "T"}, {"id": "209", "sequence": "G"}, {"id": "210", "sequence": "CTACCCAGGCCATTTTAAGTTTCCTGT"}, {"id": "211", "sequence": "GG"}, {"id": "212", "sequence": "ACTAAGGACAAAGGTGCGGGGAGAT"}, {"id": "213", "sequence": "A"}, {"id": "214", "sequence": "G"}, {"id": "215", "sequence": "A"}], "path": [{"mapping": [{"edit": [{"from_length": 8, "to_length": 8}], "position": {"node_id": "1"}, "rank": "1"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "3"}, "rank": "2"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "5"}, "rank": "3"}, {"edit": [{"from_length": 3, "to_length": 3}], "position": {"node_id": "6"}, "rank": "4"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "8"}, "rank": "5"}, {"edit": [{"from_length": 19, "to_length": 19}], "position": {"node_id": "9"}, "rank": "6"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "11"}, "rank": "7"}, {"edit": [{"from_length": 4, "to_length": 4}], "position": {"node_id": "12"}, "rank": "8"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "14"}, "rank": "9"}, {"edit": [{"from_length": 12, "to_length": 12}], "position": {"node_id": "15"}, "rank": "10"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "17"}, "rank": "11"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "18"}, "rank": "12"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "20"}, "rank": "13"}, {"edit": [{"from_length": 9, "to_length": 9}], "position": {"node_id": "21"}, "rank": "14"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "23"}, "rank": "15"}, {"edit": [{"from_length": 2, "to_length": 2}], "position": {"node_id": "24"}, "rank": "16"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "26"}, "rank": "17"}, {"edit": [{"from_length": 18, "to_length": 18}], "position": {"node_id": "27"}, "rank": "18"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "29"}, "rank": "19"}, {"edit": [{"from_length": 19, "to_length": 19}], "position": {"node_id": "30"}, "rank": "20"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "32"}, "rank": "21"}, {"edit": [{"from_length": 17, "to_length": 17}], "position": {"node_id": "33"}, "rank": "22"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "35"}, "rank": "23"}, {"edit": [{"from_length": 12, "to_length": 12}], "position": {"node_id": "36"}, "rank": "24"}, {"edit": [{"from_length": 5, "to_length": 5}], "position": {"node_id": "38"}, "rank": "25"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "40"}, "rank": "26"}, {"edit": [{"from_length": 8, "to_length": 8}], "position": {"node_id": "41"}, "rank": "27"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "43"}, "rank": "28"}, {"edit": [{"from_length": 12, "to_length": 12}], "position": {"node_id": "44"}, "rank": "29"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "46"}, "rank": "30"}, {"edit": [{"from_length": 3, "to_length": 3}], "position": {"node_id": "47"}, "rank": "31"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "49"}, "rank": "32"}, {"edit": [{"from_length": 13, "to_length": 13}], "position": {"node_id": "50"}, "rank": "33"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "52"}, "rank": "34"}, {"edit": [{"from_length": 2, "to_length": 2}], "position": {"node_id": "53"}, "rank": "35"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "55"}, "rank": "36"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "56"}, "rank": "37"}, {"edit": [{"from_length": 18, "to_length": 18}], "position": {"node_id": "57"}, "rank": "38"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "60"}, "rank": "39"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "61"}, "rank": "40"}, {"edit": [{"from_length": 3, "to_length": 3}], "position": {"node_id": "62"}, "rank": "41"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "64"}, "rank": "42"}, {"edit": [{"from_length": 9, "to_length": 9}], "position": {"node_id": "65"}, "rank": "43"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "67"}, "rank": "44"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "68"}, "rank": "45"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "70"}, "rank": "46"}, {"edit": [{"from_length": 2, "to_length": 2}], "position": {"node_id": "71"}, "rank": "47"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "73"}, "rank": "48"}, {"edit": [{"from_length": 14, "to_length": 14}], "position": {"node_id": "74"}, "rank": "49"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "76"}, "rank": "50"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "78"}, "rank": "51"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "79"}, "rank": "52"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "81"}, "rank": "53"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "83"}, "rank": "54"}, {"edit": [{"from_length": 5, "to_length": 5}], "position": {"node_id": "84"}, "rank": "55"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "86"}, "rank": "56"}, {"edit": [{"from_length": 19, "to_length": 19}], "position": {"node_id": "87"}, "rank": "57"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "89"}, "rank": "58"}, {"edit": [{"from_length": 23, "to_length": 23}], "position": {"node_id": "90"}, "rank": "59"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "92"}, "rank": "60"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "94"}, "rank": "61"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "95"}, "rank": "62"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "97"}, "rank": "63"}, {"edit": [{"from_length": 2, "to_length": 2}], "position": {"node_id": "98"}, "rank": "64"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "100"}, "rank": "65"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "101"}, "rank": "66"}, {"edit": [{"from_length": 26, "to_length": 26}], "position": {"node_id": "102"}, "rank": "67"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "103"}, "rank": "68"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "104"}, "rank": "69"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "106"}, "rank": "70"}, {"edit": [{"from_length": 14, "to_length": 14}], "position": {"node_id": "107"}, "rank": "71"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "109"}, "rank": "72"}, {"edit": [{"from_length": 11, "to_length": 11}], "position": {"node_id": "110"}, "rank": "73"}, {"edit": [{"from_length": 22, "to_length": 22}], "position": {"node_id": "112"}, "rank": "74"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "114"}, "rank": "75"}, {"edit": [{"from_length": 9, "to_length": 9}], "position": {"node_id": "115"}, "rank": "76"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "117"}, "rank": "77"}, {"edit": [{"from_length": 20, "to_length": 20}], "position": {"node_id": "118"}, "rank": "78"}, {"edit": [{"from_length": 12, "to_length": 12}], "position": {"node_id": "120"}, "rank": "79"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "122"}, "rank": "80"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "123"}, "rank": "81"}, {"edit": [{"from_length": 30, "to_length": 30}], "position": {"node_id": "124"}, "rank": "82"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "126"}, "rank": "83"}, {"edit": [{"from_length": 17, "to_length": 17}], "position": {"node_id": "127"}, "rank": "84"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "129"}, "rank": "85"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "130"}, "rank": "86"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "132"}, "rank": "87"}, {"edit": [{"from_length": 14, "to_length": 14}], "position": {"node_id": "133"}, "rank": "88"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "135"}, "rank": "89"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "136"}, "rank": "90"}, {"edit": [{"from_length": 11, "to_length": 11}], "position": {"node_id": "137"}, "rank": "91"}, {"edit": [{"from_length": 6, "to_length": 6}], "position": {"node_id": "139"}, "rank": "92"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "141"}, "rank": "93"}, {"edit": [{"from_length": 9, "to_length": 9}], "position": {"node_id": "142"}, "rank": "94"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "144"}, "rank": "95"}, {"edit": [{"from_length": 15, "to_length": 15}], "position": {"node_id": "145"}, "rank": "96"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "147"}, "rank": "97"}, {"edit": [{"from_length": 32, "to_length": 32}], "position": {"node_id": "148"}, "rank": "98"}, {"edit": [{"from_length": 10, "to_length": 10}], "position": {"node_id": "149"}, "rank": "99"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "151"}, "rank": "100"}, {"edit": [{"from_length": 17, "to_length": 17}], "position": {"node_id": "152"}, "rank": "101"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "154"}, "rank": "102"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "155"}, "rank": "103"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "157"}, "rank": "104"}, {"edit": [{"from_length": 12, "to_length": 12}], "position": {"node_id": "158"}, "rank": "105"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "159"}, "rank": "106"}, {"edit": [{"from_length": 4, "to_length": 4}], "position": {"node_id": "160"}, "rank": "107"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "162"}, "rank": "108"}, {"edit": [{"from_length": 17, "to_length": 17}], "position": {"node_id": "163"}, "rank": "109"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "165"}, "rank": "110"}, {"edit": [{"from_length": 9, "to_length": 9}], "position": {"node_id": "166"}, "rank": "111"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "168"}, "rank": "112"}, {"edit": [{"from_length": 3, "to_length": 3}], "position": {"node_id": "169"}, "rank": "113"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "171"}, "rank": "114"}, {"edit": [{"from_length": 30, "to_length": 30}], "position": {"node_id": "172"}, "rank": "115"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "174"}, "rank": "116"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "176"}, "rank": "117"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "177"}, "rank": "118"}, {"edit": [{"from_length": 16, "to_length": 16}], "position": {"node_id": "179"}, "rank": "119"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "181"}, "rank": "120"}, {"edit": [{"from_length": 10, "to_length": 10}], "position": {"node_id": "182"}, "rank": "121"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "184"}, "rank": "122"}, {"edit": [{"from_length": 10, "to_length": 10}], "position": {"node_id": "185"}, "rank": "123"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "187"}, "rank": "124"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "188"}, "rank": "125"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "190"}, "rank": "126"}, {"edit": [{"from_length": 14, "to_length": 14}], "position": {"node_id": "191"}, "rank": "127"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "193"}, "rank": "128"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "195"}, "rank": "129"}, {"edit": [{"from_length": 5, "to_length": 5}], "position": {"node_id": "196"}, "rank": "130"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "198"}, "rank": "131"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "199"}, "rank": "132"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "201"}, "rank": "133"}, {"edit": [{"from_length": 3, "to_length": 3}], "position": {"node_id": "202"}, "rank": "134"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "204"}, "rank": "135"}, {"edit": [{"from_length": 10, "to_length": 10}], "position": {"node_id": "205"}, "rank": "136"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "206"}, "rank": "137"}, {"edit": [{"from_length": 4, "to_length": 4}], "position": {"node_id": "207"}, "rank": "138"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "209"}, "rank": "139"}, {"edit": [{"from_length": 27, "to_length": 27}], "position": {"node_id": "210"}, "rank": "140"}, {"edit": [{"from_length": 2, "to_length": 2}], "position": {"node_id": "211"}, "rank": "141"}, {"edit": [{"from_length": 25, "to_length": 25}], "position": {"node_id": "212"}, "rank": "142"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "214"}, "rank": "143"}, {"edit": [{"from_length": 1, "to_length": 1}], "position": {"node_id": "215"}, "rank": "144"}], "name": "x"}]}