Mercurial > repos > jackcurragh > ribogalaxy_samtools_index
changeset 0:5bdc8418c378 draft
Uploaded
line wrap: on
 line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/macros.xml Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,223 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">samtools</requirement> + <yield/> + </requirements> + </xml> + <token name="@TOOL_VERSION@">1.13</token> + <token name="@PROFILE@">20.05</token> + <token name="@FLAGS@"><![CDATA[ + #set $flags = 0 + #if $filter + #set $flags = sum(map(int, str($filter).split(','))) + #end if + ]]></token> + <token name="@PREPARE_IDX@"><![CDATA[ + ##prepare input and indices + ln -s '$input' infile && + #if $input.is_of_type('bam'): + #if str( $input.metadata.bam_index ) != "None": + ln -s '${input.metadata.bam_index}' infile.bai && + #else: + samtools index infile infile.bai && + #end if + #elif $input.is_of_type('cram'): + #if str( $input.metadata.cram_index ) != "None": + ln -s '${input.metadata.cram_index}' infile.crai && + #else: + samtools index infile infile.crai && + #end if + #end if + ]]></token> + <token name="@PREPARE_IDX_MULTIPLE@"><![CDATA[ + ##prepare input and indices + #for $i, $bam in enumerate( $input_bams ): + ln -s '$bam' '${i}' && + #if $bam.is_of_type('bam'): + #if str( $bam.metadata.bam_index ) != "None": + ln -s '${bam.metadata.bam_index}' '${i}.bai' && + #else: + samtools index '${i}' '${i}.bai' && + #end if + #elif $bam.is_of_type('cram'): + #if str( $bam.metadata.cram_index ) != "None": + ln -s '${bam.metadata.cram_index}' '${i}.crai' && + #else: + samtools index '${i}' '${i}.crai' && + #end if + #end if + #end for + ]]></token> + <token name="@PREPARE_FASTA_IDX@"><![CDATA[ + ##checks for reference data ($addref_cond.addref_select=="history" or =="cached") + ##and sets the -t/-T parameters accordingly: + ##- in case of history a symbolic link is used because samtools (view) will generate + ## the index which might not be possible in the directory containing the fasta file + ##- in case of cached the absolute path is used which allows to read the cram file + ## without specifying the reference + #if $addref_cond.addref_select == "history": + ln -s '${addref_cond.ref}' reference.fa && + samtools faidx reference.fa && + #set reffa="reference.fa" + #set reffai="reference.fa.fai" + #elif $addref_cond.addref_select == "cached": + #set reffa=str($addref_cond.ref.fields.path) + #set reffai=str($addref_cond.ref.fields.path)+".fai" + #else + #set reffa=None + #set reffai=None + #end if + ]]></token> + + <xml name="optional_reference"> + <conditional name="addref_cond"> + <param name="addref_select" type="select" label="Use a reference sequence"> + <help>@HELP@</help> + <option value="no">No</option> + <option value="history">Use a genome/index from the history</option> + <option value="cached">Use a built-in genome</option> + </param> + <when value="no"/> + <when value="history"> + <param name="ref" argument="@ARGUMENT@" type="data" format="fasta,fasta.gz" label="Reference"/> + </when> + <when value="cached"> + <param name="ref" argument="@ARGUMENT@" type="select" label="Reference"> + <options from_data_table="fasta_indexes"> + <filter type="data_meta" ref="input" key="dbkey" column="dbkey"/> + </options> + <validator type="no_options" message="No reference genome is available for the build associated with the selected input dataset"/> + </param> + </when> + </conditional> + </xml> + <xml name="mandatory_reference" token_help="" token_argument=""> + <conditional name="addref_cond"> + <param name="addref_select" type="select" label="Use a reference sequence"> + <help>@HELP@</help> + <option value="history">Use a genome/index from the history</option> + <option value="cached">Use a built-in genome</option> + </param> + <when value="history"> + <param name="ref" argument="@ARGUMENT@" type="data" format="fasta,fasta.gz" label="Reference"/> + </when> + <when value="cached"> + <param name="ref" argument="@ARGUMENT@" type="select" label="Reference"> + <options from_data_table="fasta_indexes"> + <filter type="data_meta" ref="input" key="dbkey" column="dbkey"/> + <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" /> + </options> + </param> + </when> + </conditional> + </xml> + + + <token name="@ADDTHREADS@"><![CDATA[ + ##compute the number of ADDITIONAL threads to be used by samtools (-@) + addthreads=\${GALAXY_SLOTS:-1} && (( addthreads-- )) && + ]]></token> + <token name="@ADDMEMORY@"><![CDATA[ + ##compute the number of memory available to samtools sort (-m) + ##use only 75% of available: https://github.com/samtools/samtools/issues/831 + addmemory=\${GALAXY_MEMORY_MB_PER_SLOT:-768} && + ((addmemory=addmemory*75/100)) && + ]]></token> + <xml name="seed_input"> + <param name="seed" type="integer" optional="True" label="Seed for random number generator" help="If empty a random seed is used." /> + </xml> + <xml name="flag_options" token_s1="false" token_s2="false" token_s4="false" token_s8="false" token_s16="false" token_s32="false" token_s64="false" token_s128="false" token_s256="false" token_s512="false" token_s1024="false" token_s2048="false"> + <option value="1" selected="@S1@">Read is paired</option> + <option value="2" selected="@S2@">Read is mapped in a proper pair</option> + <option value="4" selected="@S4@">Read is unmapped</option> + <option value="8" selected="@S8@">Mate is unmapped</option> + <option value="16" selected="@S16@">Read is mapped to the reverse strand of the reference</option> + <option value="32" selected="@S32@">Mate is mapped to the reverse strand of the reference</option> + <option value="64" selected="@S64@">Read is the first in a pair</option> + <option value="128" selected="@S128@">Read is the second in a pair</option> + <option value="256" selected="@S256@">Alignment of the read is not primary</option> + <option value="512" selected="@S512@">Read fails platform/vendor quality checks</option> + <option value="1024" selected="@S1024@">Read is a PCR or optical duplicate</option> + <option value="2048" selected="@S2048@">Alignment is supplementary</option> + </xml> + + <!-- region specification macros and tokens for tools that allow the specification + of region by bed file / space separated list of regions --> + <token name="@REGIONS_FILE@"><![CDATA[ + #if $cond_region.select_region == 'tab': + -t '$cond_region.targetregions' + #end if + ]]></token> + <token name="@REGIONS_MANUAL@"><![CDATA[ + #if $cond_region.select_region == 'text': + #for $i, $x in enumerate($cond_region.regions_repeat): + '${x.region}' + #end for + #end if + ]]></token> + <xml name="regions_macro"> + <conditional name="cond_region"> + <param name="select_region" type="select" label="Filter by regions" help="restricts output to only those alignments which overlap the specified region(s)"> + <option value="no" selected="True">No</option> + <option value="text">Manualy specify regions</option> + <option value="tab">Regions from tabular file</option> + </param> + <when value="no"/> + <when value="text"> + <repeat name="regions_repeat" min="1" default="1" title="Regions"> + <param name="region" type="text" label="region" help="format chr:from-to"> + <validator type="regex" message="Required format: CHR[:FROM[-TO]]; where CHR: string containing any character except quotes, whitespace and colon; FROM and TO: any integer">^[^\s'\":]+(:\d+(-\d+){0,1}){0,1}$</validator> + </param> + </repeat> + </when> + <when value="tab"> + <param name="targetregions" argument="-t/--target-regions" type="data" format="tabular" label="Target regions file" help="Do stats in these regions only. Tab-delimited file chr,from,to (1-based, inclusive)" /> + </when> + </conditional> + </xml> + + <xml name="citations"> + <citations> + <citation type="bibtex"> + @misc{SAM_def, + title={Definition of SAM/BAM format}, + url = {https://samtools.github.io/hts-specs/},} + </citation> + <citation type="doi">10.1093/bioinformatics/btp352</citation> + <citation type="doi">10.1093/bioinformatics/btr076</citation> + <citation type="doi">10.1093/bioinformatics/btr509</citation> + <citation type="bibtex"> + @misc{Danecek_et_al, + Author={Danecek, P., Schiffels, S., Durbin, R.}, + title={Multiallelic calling model in bcftools (-m)}, + url = {http://samtools.github.io/bcftools/call-m.pdf},} + </citation> + <citation type="bibtex"> + @misc{Durbin_VCQC, + Author={Durbin, R.}, + title={Segregation based metric for variant call QC}, + url = {http://samtools.github.io/bcftools/rd-SegBias.pdf},} + </citation> + <citation type="bibtex"> + @misc{Li_SamMath, + Author={Li, H.}, + title={Mathematical Notes on SAMtools Algorithms}, + url = {http://www.broadinstitute.org/gatk/media/docs/Samtools.pdf},} + </citation> + <citation type="bibtex"> + @misc{SamTools_github, + title={SAMTools GitHub page}, + url = {https://github.com/samtools/samtools},} + </citation> + </citations> + </xml> + <xml name="version_command"> + <version_command><![CDATA[samtools 2>&1 | grep Version]]></version_command> + </xml> + <xml name="stdio"> + <stdio> + <exit_code range="1:" level="fatal" description="Error" /> + </stdio> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/samtools_index.xml Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,51 @@ +<tool id="samtools_index" name="Samtools index" version="2.0.4" profile="@PROFILE@"> + <description>order of storing aligned sequences</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <expand macro="version_command"/> + <command><![CDATA[ + @ADDTHREADS@ + @ADDMEMORY@ + samtools index + -@ \$addthreads + -m \$addmemory"M" + $prim_key_cond.prim_key_select + '${input1}' + '${output1}' + ]]></command> + <inputs> + <param name="input1" type="data" format="sam,unsorted.bam,cram" label="BAM File" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" type="select" label="Index type"> + <option value="-b" selected="True">BAI (-b)</option> + <option value="-c" selected="True">CSI (-c)</option> + </param> + <when value="-b"/> + <when value="-c"/> + </conditional> + </inputs> + <outputs> + <data name="output1" format="bam"> + <change_format> + <when input="prim_key_cond.prim_key_select" value="-b" format="bai" /> + <when input="prim_key_cond.prim_key_select" value="-c" format="csi" /> + </change_format> + </data> + </outputs> + <tests> + <test> + <param name="input1" value="1.bam" ftype="bam" /> + <param name="prim_key_cond.prim_key_select" value="-c" /> + <output name="output1" file="1.bam.bai" ftype="bai" lines_diff="4" /> + </test> + </tests> + <help> +**What it does** + +Indexes a BAM file + </help> + <expand macro="citations"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/name.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:queryname +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/pos.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:coordinate +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ???????????????????????
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/tag.as.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/tag.fi.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/tag.rg.n.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_index/test-data/tag.rg.sort.expected.sam Wed Mar 23 12:51:35 2022 +0000 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull
