106
+ − 1 <!DOCTYPE html>
+ − 2 <html>
+ − 3 <head>
+ − 4 <meta charset="UTF-8">
+ − 5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/">
+ − 6
+ − 7 <title>Blast output</title>
+ − 8
+ − 9 <style>
+ − 10 body {
+ − 11 color: #333333;
+ − 12 font-family: Arial,Sans-Serif;
+ − 13 }
+ − 14
+ − 15 :link {
+ − 16 color: #336699;
+ − 17 }
+ − 18
+ − 19 .right {
+ − 20 float: right;
+ − 21 }
+ − 22
+ − 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+ − 24 #strip_html_warning {
+ − 25 display: none;
+ − 26 }
+ − 27
+ − 28 #content {
+ − 29 margin: 0 2em;
+ − 30 padding: 0.5em;
+ − 31 border: 1px solid #888888;
+ − 32 background-color: #d3dff5;
+ − 33 }
+ − 34
+ − 35 h1, h2, h3, h4, h5, h6 {
+ − 36 color: #2A6979;
+ − 37 font-family: arial,verdana,sans-serif;
+ − 38 letter-spacing: -1px;
+ − 39 margin: 1.2em 0 0.3em;
+ − 40 }
+ − 41
+ − 42 h1 {
+ − 43 border-bottom: 1px solid #CCCCCC;
+ − 44 font-size: 150%;
+ − 45 padding-bottom: 0.1em;
+ − 46 }
+ − 47
+ − 48 h2 {
+ − 49 font-size: 120%;
+ − 50 font-weight: bold;
+ − 51 }
+ − 52
+ − 53 h4.darkHeader {
+ − 54 color: #4D4D4D;
+ − 55 letter-spacing: 0;
+ − 56 font-weight: bold;
+ − 57 }
+ − 58
+ − 59 #nodata {
+ − 60 font-weight: bold;
+ − 61 }
+ − 62
+ − 63 .index {
+ − 64 margin-bottom: 3em;
+ − 65 }
+ − 66 .index div.indexentry {
+ − 67 margin: 1.2em 1.6em;
+ − 68 font-weight: bold;
+ − 69 font-size: 100%;
+ − 70 }
+ − 71
+ − 72 .headerdata {
+ − 73 font-size: 90%;
+ − 74 }
+ − 75 .headerdata .param {
+ − 76 font-weight: bold;
+ − 77 text-align: right;
+ − 78 padding: 0 1em;
+ − 79 }
+ − 80
+ − 81 .grey {
+ − 82 background-color: #eeeeee;
+ − 83 border: 1px solid #cccccc;
+ − 84 padding: 1em;
+ − 85 }
+ − 86
+ − 87 .white {
+ − 88 background-color: white;
+ − 89 border: 1px solid #cccccc;
+ − 90 padding: 1.5em 2%;
+ − 91 }
+ − 92
+ − 93 .graphicrow {
+ − 94 clear: left;
+ − 95 width: 100%;
+ − 96 }
+ − 97
+ − 98 .graphicitem {
+ − 99 float: left;
+ − 100 }
+ − 101
+ − 102
+ − 103
+ − 104 .graphics .grey {
+ − 105 text-align: center;
+ − 106 }
+ − 107
+ − 108 .graphic {
+ − 109 background-color: white;
+ − 110 border: 2px solid black;
+ − 111 padding: 1.5em;
+ − 112 margin: auto;
+ − 113 }
+ − 114
+ − 115 .centered, .defline, div.legend, div.tablewrapper {
+ − 116 margin-left: auto;
+ − 117 margin-right: auto;
+ − 118 }
+ − 119
+ − 120 .defline {
+ − 121 background-color: white;
+ − 122 border: 1px solid black;
+ − 123 margin: .5em auto;
+ − 124 padding-left: .2em;
+ − 125 padding-right: .2em;
+ − 126 max-width: 50em;
+ − 127 text-align: left;
+ − 128 height: 2.8em;
+ − 129 overflow: hidden;
+ − 130 }
+ − 131
+ − 132 div.legend {
+ − 133 max-width: 40em;
+ − 134 }
+ − 135 div.legend div {
+ − 136 width: 100%;
+ − 137 color: white;
+ − 138 font-weight: bold;
+ − 139 border-spacing: 0;
+ − 140 }
+ − 141 div.legend div .graphicitem {
+ − 142 width: 20%;
+ − 143 padding: 0;
+ − 144 margin: 0;
+ − 145 border: none;
+ − 146 }
+ − 147
+ − 148 div.tablewrapper {
+ − 149 width: 50%;
+ − 150 min-width: 60em;
+ − 151 }
+ − 152
+ − 153 /* For small widths we give the graphic 100% */
+ − 154 @media (max-width: 72.5em) {
+ − 155 div.tablewrapper {
+ − 156 width: 100%;
+ − 157 min-width: 0px;
+ − 158 }
+ − 159 }
+ − 160
+ − 161 .scale {
+ − 162 width: 100%;
+ − 163 margin: .5em 0;
+ − 164 font-weight: bold;
+ − 165 }
+ − 166 .scale div {
+ − 167 color: red;
+ − 168 text-align: left;
+ − 169 }
+ − 170 .scale .graphicrow {
+ − 171 margin: .5em 0 .5em 0;
+ − 172 color: white;
+ − 173 }
+ − 174 .scale .graphicitem {
+ − 175 position: relative;
+ − 176 }
+ − 177 .scale .graphicitem div {
+ − 178 margin: 0 1px;
+ − 179 padding: 0 2px;
+ − 180 text-align: right;
+ − 181 background-color: red;
+ − 182 color: white;
+ − 183 }
+ − 184 .scale .graphicitem:first-child div {
+ − 185 margin-left: 0px;
+ − 186 }
+ − 187 .scale .graphicitem:last-child div {
+ − 188 margin-right: 0px;
+ − 189 }
+ − 190 .scale .graphicitem .lastlabel {
+ − 191 position: absolute;
+ − 192 top: 0px;
+ − 193 left: 100%;
+ − 194 background-color: transparent;
+ − 195 color: red;
+ − 196 }
+ − 197
+ − 198 a.matchresult {
+ − 199 display: block;
+ − 200 margin: 0;
+ − 201 padding: 0;
+ − 202 }
+ − 203 div.matchrow {
+ − 204 margin-top: 4px;
+ − 205 }
+ − 206 div.matchrow, div.matchitem {
+ − 207 height: 4px;
+ − 208 }
+ − 209
+ − 210
+ − 211 table.descriptiontable {
+ − 212 font-size: 85%;
+ − 213 border: 1px solid #97b0c8;
+ − 214 border-spacing: 0;
+ − 215 color: #222222;
+ − 216 line-height: 1.3em;
+ − 217 background-color: white;
+ − 218 }
+ − 219 table.descriptiontable col:first-child {
+ − 220 width: 100%;
+ − 221 }
+ − 222 table.descriptiontable tr:hover {
+ − 223 background-color: #D5DEE3;
+ − 224 }
+ − 225 table.descriptiontable th {
+ − 226 color: #14376C;
+ − 227 font-weight: normal;
+ − 228 background-color: #F0F0F0;
+ − 229 background: linear-gradient(#FFFFFF, #F0F0F0);
+ − 230 border-bottom: 1px solid #D4DFE9;
+ − 231 border-right: 1px solid #CFCFCF;
+ − 232 border-left: 0px solid black;
+ − 233 border-top: 0px solid black;
+ − 234 }
+ − 235 table.descriptiontable td {
+ − 236 overflow: hidden;
+ − 237 text-align: center;
+ − 238 padding: .4em .8em;
+ − 239 }
+ − 240 table.descriptiontable td div {
+ − 241 width: 1em;
+ − 242 overflow: visible;
+ − 243 white-space: nowrap;
+ − 244 text-align: left;
+ − 245 }
+ − 246
+ − 247
+ − 248
+ − 249 .alignments .white {
+ − 250 padding: 1.5em 1em;
+ − 251 }
+ − 252
+ − 253 .alignment {
+ − 254 border-top: 1px solid black;
+ − 255 padding-left: 1em;
+ − 256 padding-right: 1em;
+ − 257 }
+ − 258
+ − 259 div.linkheader {
+ − 260 padding-top: .2em;
+ − 261 font-size: 85%;
+ − 262 color: #14376C;
+ − 263 }
+ − 264 div.linkheader a.linkheader {
+ − 265 margin-right: 1em;
+ − 266 }
+ − 267 div.linkheader .right a {
+ − 268 text-decoration: none;
+ − 269 }
+ − 270
+ − 271 .title .hittitle {
+ − 272 color: #222222;
+ − 273 margin-bottom: .3em;
+ − 274 }
+ − 275 .title .titleinfo {
+ − 276 font-size: 80%;
+ − 277 margin-top: 0;
+ − 278 margin-bottom: .3em;
+ − 279 }
+ − 280 .title .titleinfo .b {
+ − 281 color: #606060;
+ − 282 font-weight: bold;
+ − 283 font-size: 90%;
+ − 284 }
+ − 285
+ − 286 .moretitles {
+ − 287 margin: 1.2em;
+ − 288 }
+ − 289 .moretitles .titleinfo {
+ − 290 margin: 0;
+ − 291 padding: 0;
+ − 292 }
+ − 293 .moretitles .hittitle {
+ − 294 margin: .4em 0 .2em 0;
+ − 295 padding: 0;
+ − 296 }
+ − 297
+ − 298 a.showmoretitles {
+ − 299 font-size: 75%;
+ − 300 color: #336699;
+ − 301 font-weight: bold;
+ − 302 margin-top: 0;
+ − 303 }
+ − 304 a.showmoretitles:hover {
+ − 305 }
+ − 306
+ − 307 .hotspot {
+ − 308 color: #606060;
+ − 309 font-family: verdana, arial, sans-serif;
+ − 310 margin-bottom: 2.5em;
+ − 311 }
+ − 312
+ − 313 .hotspot p.range {
+ − 314 font-size: 70%;
+ − 315 margin-top: 0;
+ − 316 margin-top: 1em;
+ − 317 margin-bottom: .2em;
+ − 318 }
+ − 319 .hotspot p.range span.range {
+ − 320 font-weight: bold;
+ − 321 }
+ − 322 .hotspot p.range a.range {
+ − 323 margin-left: .5em;
+ − 324 }
+ − 325
+ − 326 table.hotspotstable {
+ − 327 border-top: 1px solid;
+ − 328 border-bottom: 1px solid;
+ − 329 text-align: left;
+ − 330 border-collapse: collapse;
+ − 331 }
+ − 332 table.hotspotstable th, table.hotspotstable td {
+ − 333 padding: .1em 1em;
+ − 334 }
+ − 335 table.hotspotstable th {
+ − 336 font-size: 70%;
+ − 337 }
+ − 338 table.hotspotstable td {
+ − 339 min-width: 7em;
+ − 340 color: #222222;
+ − 341 font-size: 80%;
+ − 342 }
+ − 343
+ − 344 pre.alignmentgraphic {
+ − 345 color: #222222;
+ − 346 }
+ − 347
+ − 348 footer {
+ − 349 text-align: center;
+ − 350 color: #cccccc;
+ − 351 font-size: 70%;
+ − 352 margin-top: 1em;
+ − 353 }
+ − 354 footer :link {
+ − 355 color: #5588cc;
+ − 356 }
+ − 357
+ − 358 </style>
+ − 359
+ − 360 <script type="text/javascript">
+ − 361 function toggle_visibility(id) {
+ − 362 var e = document.getElementById(id);
+ − 363 if(e.style.display != 'block')
+ − 364 e.style.display = 'block';
+ − 365 else
+ − 366 e.style.display = 'none';
+ − 367 }
+ − 368 </script>
+ − 369
+ − 370 </head>
+ − 371
+ − 372
+ − 373 <body>
+ − 374
+ − 375 <div id="strip_html_warning">
+ − 376 <!-- This div should be hidden by the header css block. Galaxy
+ − 377 strips all css, breaking this page but making this warning
+ − 378 visible. This warning contains some ugly old skool tabular html
+ − 379 layout that is not stripped. -->
+ − 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+ − 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+ − 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+ − 383 </b></font></td></tr></table>
+ − 384 </div>
+ − 385
+ − 386 <div id=content>
+ − 387
+ − 388
+ − 389 <section class=index>
+ − 390 <h1>Queries</h1>
+ − 391
+ − 392 <div class=indexentry><a href="#match1">
+ − 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+ − 394 (20 letters, 2 hits)
+ − 395 </a></div>
+ − 396 <div class=indexentry><a href="#match2">
+ − 397 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+ − 398 (20 letters, 0 hits)
+ − 399 </a></div>
+ − 400 <div class=indexentry><a href="#match3">
+ − 401 Query_3: Probe|NOST-Spec_(Genetic_ID)
+ − 402 (20 letters, 3 hits)
+ − 403 </a></div>
+ − 404 <div class=indexentry><a href="#match4">
+ − 405 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 406 (24 letters, 0 hits)
+ − 407 </a></div>
+ − 408 <div class=indexentry><a href="#match5">
+ − 409 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+ − 410 (20 letters, 0 hits)
+ − 411 </a></div>
+ − 412 <div class=indexentry><a href="#match6">
+ − 413 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+ − 414 (25 letters, 2 hits)
+ − 415 </a></div>
+ − 416 <div class=indexentry><a href="#match7">
+ − 417 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+ − 418 (74 letters, 2 hits)
+ − 419 </a></div>
+ − 420
+ − 421 </section>
+ − 422
+ − 423
+ − 424 <section class=match id=match1>
+ − 425
+ − 426 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 427
+ − 428 <section class=header>
+ − 429
+ − 430 <table class=headerdata>
+ − 431 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 432 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 433 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 434 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 435 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 436 </table>
+ − 437
+ − 438 </section>
+ − 439
+ − 440
+ − 441 <section class=graphics>
+ − 442 <h2>Graphic Summary</h2>
+ − 443
+ − 444 <div class=grey>
+ − 445 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+ − 446
+ − 447 <div class=defline id=defline1>
+ − 448 Mouse-over to show defline and scores, click to show alignments
+ − 449 </div>
+ − 450
+ − 451 <div class=graphic>
+ − 452 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 453 <div class=legend><div class=graphicrow>
+ − 454 <div class=graphicitem style="background-color: black"><40</div>
+ − 455 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 456 <div class=graphicitem style="background-color: green">50–80</div>
+ − 457 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 458 <div class=graphicitem style="background-color: red">200≤</div>
+ − 459 </div></div>
+ − 460 <div style="clear: left"></div>
+ − 461
+ − 462 <div class=tablewrapper>
+ − 463
+ − 464 <div class=scale>
+ − 465 <div>query:</div>
+ − 466 <div class=graphicrow>
+ − 467 <div>
+ − 468 <div class=graphicitem style="width: 10%">
+ − 469 <div>2</div>
+ − 470 </div>
+ − 471 <div class=graphicitem style="width: 10%">
+ − 472 <div>4</div>
+ − 473 </div>
+ − 474 <div class=graphicitem style="width: 10%">
+ − 475 <div>6</div>
+ − 476 </div>
+ − 477 <div class=graphicitem style="width: 10%">
+ − 478 <div>8</div>
+ − 479 </div>
+ − 480 <div class=graphicitem style="width: 10%">
+ − 481 <div>10</div>
+ − 482 </div>
+ − 483 <div class=graphicitem style="width: 10%">
+ − 484 <div>12</div>
+ − 485 </div>
+ − 486 <div class=graphicitem style="width: 10%">
+ − 487 <div>14</div>
+ − 488 </div>
+ − 489 <div class=graphicitem style="width: 10%">
+ − 490 <div>16</div>
+ − 491 </div>
+ − 492 <div class=graphicitem style="width: 10%">
+ − 493 <div>18</div>
+ − 494 </div>
+ − 495 <div class=graphicitem style="width: 10%">
+ − 496 <div>20</div>
+ − 497 </div>
+ − 498 </div>
+ − 499 </div>
+ − 500 <div style="clear: left"></div>
+ − 501 </div>
+ − 502
+ − 503 <a class=matchresult
+ − 504 href="#hit1-1"
+ − 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+ − 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+ − 508 <div class="matchrow graphicrow">
+ − 509 <div class="matchitem graphicitem"
+ − 510 style="background-color: black; width: 100%"></div>
+ − 511 </div>
+ − 512 </a>
+ − 513
+ − 514 <a class=matchresult
+ − 515 href="#hit1-2"
+ − 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+ − 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+ − 519 <div class="matchrow graphicrow">
+ − 520 <div class="matchitem graphicitem"
+ − 521 style="background-color: black; width: 100%"></div>
+ − 522 </div>
+ − 523 </a>
+ − 524
+ − 525 </div>
+ − 526 </div>
+ − 527 </div>
+ − 528 </section>
+ − 529
+ − 530
+ − 531
+ − 532 <section class=descriptions>
+ − 533 <h2>Descriptions</h2>
+ − 534
+ − 535 <div class=grey><div class=white>
+ − 536 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 537
+ − 538 <table class=descriptiontable>
+ − 539 <col/><col/><col/><col/><col/><col/><col/>
+ − 540 <tr>
+ − 541 <th>Description</th>
+ − 542 <th>Max score</th>
+ − 543 <th>Total score</th>
+ − 544 <th>Query cover</th>
+ − 545 <th>E value</th>
+ − 546 <th>Ident</th>
+ − 547 <th>Accession</th>
+ − 548 </tr>
+ − 549 <tr>
+ − 550 <td><div><a href="#hit1-1"
+ − 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+ − 552 id="description1-1">
+ − 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+ − 554 </a></div></td>
+ − 555 <td>40.1</td>
+ − 556 <td>40.1</td>
+ − 557 <td>100%</td>
+ − 558 <td>1.513e-07</td>
+ − 559 <td>100%</td>
+ − 560 <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td>
+ − 561 </tr>
+ − 562 <tr>
+ − 563 <td><div><a href="#hit1-2"
+ − 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+ − 565 id="description1-2">
+ − 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+ − 567 </a></div></td>
+ − 568 <td>40.1</td>
+ − 569 <td>40.1</td>
+ − 570 <td>100%</td>
+ − 571 <td>1.513e-07</td>
+ − 572 <td>100%</td>
+ − 573 <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td>
+ − 574 </tr>
+ − 575 </table>
+ − 576
+ − 577 </div></div>
+ − 578 </section>
+ − 579
+ − 580
+ − 581
+ − 582 <section class=alignments>
+ − 583 <h2>Alignments</h2>
+ − 584
+ − 585 <div class=grey><div class=white>
+ − 586 <div class=alignment id=hit1-1>
+ − 587
+ − 588 <div class=linkheader>
+ − 589 <div class=right><a href="#description1-1">Descriptions</a></div>
+ − 590 <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Gene Bank</a>
+ − 591 </div>
+ − 592
+ − 593 <div class=title>
+ − 594 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+ − 595 <p class=titleinfo>
+ − 596 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a>
+ − 597 <span class=b>Length:</span> 2457
+ − 598 <span class=b>Number of Matches:</span> 1
+ − 599 </p>
+ − 600 </div>
+ − 601
+ − 602
+ − 603 <div class=hotspot id=hotspot1-1-1>
+ − 604 <p class=range>
+ − 605 <span class=range>Range 1: 2119 to 2138</span>
+ − 606 </p>
+ − 607
+ − 608 <table class=hotspotstable>
+ − 609 <tr>
+ − 610 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 611 </tr>
+ − 612 <tr>
+ − 613 <td>40.1 bits(20)</td>
+ − 614 <td>0.0</td>
+ − 615 <td>20/20(100%)</td>
+ − 616 <td>0/20(0%)</td>
+ − 617 <td>Plus/Plus</td>
+ − 618 </tr>
+ − 619 </table>
+ − 620
+ − 621 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20
+ − 622 ||||||||||||||||||||
+ − 623 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre>
+ − 624 </div>
+ − 625
+ − 626 </div>
+ − 627
+ − 628 <div class=alignment id=hit1-2>
+ − 629
+ − 630 <div class=linkheader>
+ − 631 <div class=right><a href="#description1-2">Descriptions</a></div>
+ − 632 <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Gene Bank</a>
+ − 633 </div>
+ − 634
+ − 635 <div class=title>
+ − 636 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+ − 637 <p class=titleinfo>
+ − 638 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a>
+ − 639 <span class=b>Length:</span> 323
+ − 640 <span class=b>Number of Matches:</span> 1
+ − 641 </p>
+ − 642 </div>
+ − 643
+ − 644
+ − 645 <div class=hotspot id=hotspot1-2-1>
+ − 646 <p class=range>
+ − 647 <span class=range>Range 1: 200 to 219</span>
+ − 648 </p>
+ − 649
+ − 650 <table class=hotspotstable>
+ − 651 <tr>
+ − 652 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 653 </tr>
+ − 654 <tr>
+ − 655 <td>40.1 bits(20)</td>
+ − 656 <td>0.0</td>
+ − 657 <td>20/20(100%)</td>
+ − 658 <td>0/20(0%)</td>
+ − 659 <td>Plus/Plus</td>
+ − 660 </tr>
+ − 661 </table>
+ − 662
+ − 663 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20
+ − 664 ||||||||||||||||||||
+ − 665 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre>
+ − 666 </div>
+ − 667
+ − 668 </div>
+ − 669
+ − 670 </div></div>
+ − 671 </section>
+ − 672 </section>
+ − 673
+ − 674 <section class=match id=match2>
+ − 675
+ − 676 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 677
+ − 678 <section class=header>
+ − 679
+ − 680 <table class=headerdata>
+ − 681 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 682 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 683 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 684 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 685 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 686 </table>
+ − 687
+ − 688 </section>
+ − 689
+ − 690 <section>
+ − 691 <h2>No Hits</h2>
+ − 692 <div class=grey>
+ − 693 <table class=headerdata>
+ − 694 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 695 </table>
+ − 696 </div>
+ − 697 </section>
+ − 698 </section>
+ − 699
+ − 700 <section class=match id=match3>
+ − 701
+ − 702 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 703
+ − 704 <section class=header>
+ − 705
+ − 706 <table class=headerdata>
+ − 707 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 708 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 709 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 710 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 711 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 712 </table>
+ − 713
+ − 714 </section>
+ − 715
+ − 716
+ − 717 <section class=graphics>
+ − 718 <h2>Graphic Summary</h2>
+ − 719
+ − 720 <div class=grey>
+ − 721 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+ − 722
+ − 723 <div class=defline id=defline3>
+ − 724 Mouse-over to show defline and scores, click to show alignments
+ − 725 </div>
+ − 726
+ − 727 <div class=graphic>
+ − 728 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 729 <div class=legend><div class=graphicrow>
+ − 730 <div class=graphicitem style="background-color: black"><40</div>
+ − 731 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 732 <div class=graphicitem style="background-color: green">50–80</div>
+ − 733 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 734 <div class=graphicitem style="background-color: red">200≤</div>
+ − 735 </div></div>
+ − 736 <div style="clear: left"></div>
+ − 737
+ − 738 <div class=tablewrapper>
+ − 739
+ − 740 <div class=scale>
+ − 741 <div>query:</div>
+ − 742 <div class=graphicrow>
+ − 743 <div>
+ − 744 <div class=graphicitem style="width: 10%">
+ − 745 <div>2</div>
+ − 746 </div>
+ − 747 <div class=graphicitem style="width: 10%">
+ − 748 <div>4</div>
+ − 749 </div>
+ − 750 <div class=graphicitem style="width: 10%">
+ − 751 <div>6</div>
+ − 752 </div>
+ − 753 <div class=graphicitem style="width: 10%">
+ − 754 <div>8</div>
+ − 755 </div>
+ − 756 <div class=graphicitem style="width: 10%">
+ − 757 <div>10</div>
+ − 758 </div>
+ − 759 <div class=graphicitem style="width: 10%">
+ − 760 <div>12</div>
+ − 761 </div>
+ − 762 <div class=graphicitem style="width: 10%">
+ − 763 <div>14</div>
+ − 764 </div>
+ − 765 <div class=graphicitem style="width: 10%">
+ − 766 <div>16</div>
+ − 767 </div>
+ − 768 <div class=graphicitem style="width: 10%">
+ − 769 <div>18</div>
+ − 770 </div>
+ − 771 <div class=graphicitem style="width: 10%">
+ − 772 <div>20</div>
+ − 773 </div>
+ − 774 </div>
+ − 775 </div>
+ − 776 <div style="clear: left"></div>
+ − 777 </div>
+ − 778
+ − 779 <a class=matchresult
+ − 780 href="#hit3-1"
+ − 781 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+ − 782 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 783 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+ − 784 <div class="matchrow graphicrow">
+ − 785 <div class="matchitem graphicitem"
+ − 786 style="background-color: black; width: 100%"></div>
+ − 787 </div>
+ − 788 </a>
+ − 789
+ − 790 <a class=matchresult
+ − 791 href="#hit3-2"
+ − 792 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+ − 793 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 794 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+ − 795 <div class="matchrow graphicrow">
+ − 796 <div class="matchitem graphicitem"
+ − 797 style="background-color: black; width: 100%"></div>
+ − 798 </div>
+ − 799 </a>
+ − 800
+ − 801 <a class=matchresult
+ − 802 href="#hit3-3"
+ − 803 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+ − 804 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 805 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000">
+ − 806 <div class="matchrow graphicrow">
+ − 807 <div class="matchitem graphicitem"
+ − 808 style="background-color: transparent; width: 15%"></div>
+ − 809 <div class="matchitem graphicitem"
+ − 810 style="background-color: black; width: 85%"></div>
+ − 811 </div>
+ − 812 </a>
+ − 813
+ − 814 </div>
+ − 815 </div>
+ − 816 </div>
+ − 817 </section>
+ − 818
+ − 819
+ − 820
+ − 821 <section class=descriptions>
+ − 822 <h2>Descriptions</h2>
+ − 823
+ − 824 <div class=grey><div class=white>
+ − 825 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 826
+ − 827 <table class=descriptiontable>
+ − 828 <col/><col/><col/><col/><col/><col/><col/>
+ − 829 <tr>
+ − 830 <th>Description</th>
+ − 831 <th>Max score</th>
+ − 832 <th>Total score</th>
+ − 833 <th>Query cover</th>
+ − 834 <th>E value</th>
+ − 835 <th>Ident</th>
+ − 836 <th>Accession</th>
+ − 837 </tr>
+ − 838 <tr>
+ − 839 <td><div><a href="#hit3-1"
+ − 840 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+ − 841 id="description3-1">
+ − 842 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+ − 843 </a></div></td>
+ − 844 <td>40.1</td>
+ − 845 <td>40.1</td>
+ − 846 <td>100%</td>
+ − 847 <td>1.513e-07</td>
+ − 848 <td>100%</td>
+ − 849 <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td>
+ − 850 </tr>
+ − 851 <tr>
+ − 852 <td><div><a href="#hit3-2"
+ − 853 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+ − 854 id="description3-2">
+ − 855 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+ − 856 </a></div></td>
+ − 857 <td>40.1</td>
+ − 858 <td>40.1</td>
+ − 859 <td>100%</td>
+ − 860 <td>1.513e-07</td>
+ − 861 <td>100%</td>
+ − 862 <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td>
+ − 863 </tr>
+ − 864 <tr>
+ − 865 <td><div><a href="#hit3-3"
+ − 866 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"
+ − 867 id="description3-3">
+ − 868 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000
+ − 869 </a></div></td>
+ − 870 <td>34.2</td>
+ − 871 <td>34.2</td>
+ − 872 <td>85%</td>
+ − 873 <td>9.334e-06</td>
+ − 874 <td>100%</td>
+ − 875 <td><a href="http://example.com/example-genebank/AJ308515.1/">1</a></td>
+ − 876 </tr>
+ − 877 </table>
+ − 878
+ − 879 </div></div>
+ − 880 </section>
+ − 881
+ − 882
+ − 883
+ − 884 <section class=alignments>
+ − 885 <h2>Alignments</h2>
+ − 886
+ − 887 <div class=grey><div class=white>
+ − 888 <div class=alignment id=hit3-1>
+ − 889
+ − 890 <div class=linkheader>
+ − 891 <div class=right><a href="#description3-1">Descriptions</a></div>
+ − 892 <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Gene Bank</a>
+ − 893 </div>
+ − 894
+ − 895 <div class=title>
+ − 896 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+ − 897 <p class=titleinfo>
+ − 898 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a>
+ − 899 <span class=b>Length:</span> 2457
+ − 900 <span class=b>Number of Matches:</span> 1
+ − 901 </p>
+ − 902 </div>
+ − 903
+ − 904
+ − 905 <div class=hotspot id=hotspot3-1-1>
+ − 906 <p class=range>
+ − 907 <span class=range>Range 1: 2143 to 2162</span>
+ − 908 </p>
+ − 909
+ − 910 <table class=hotspotstable>
+ − 911 <tr>
+ − 912 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 913 </tr>
+ − 914 <tr>
+ − 915 <td>40.1 bits(20)</td>
+ − 916 <td>0.0</td>
+ − 917 <td>20/20(100%)</td>
+ − 918 <td>0/20(0%)</td>
+ − 919 <td>Plus/Plus</td>
+ − 920 </tr>
+ − 921 </table>
+ − 922
+ − 923 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20
+ − 924 ||||||||||||||||||||
+ − 925 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre>
+ − 926 </div>
+ − 927
+ − 928 </div>
+ − 929
+ − 930 <div class=alignment id=hit3-2>
+ − 931
+ − 932 <div class=linkheader>
+ − 933 <div class=right><a href="#description3-2">Descriptions</a></div>
+ − 934 <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Gene Bank</a>
+ − 935 </div>
+ − 936
+ − 937 <div class=title>
+ − 938 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+ − 939 <p class=titleinfo>
+ − 940 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a>
+ − 941 <span class=b>Length:</span> 323
+ − 942 <span class=b>Number of Matches:</span> 1
+ − 943 </p>
+ − 944 </div>
+ − 945
+ − 946
+ − 947 <div class=hotspot id=hotspot3-2-1>
+ − 948 <p class=range>
+ − 949 <span class=range>Range 1: 224 to 243</span>
+ − 950 </p>
+ − 951
+ − 952 <table class=hotspotstable>
+ − 953 <tr>
+ − 954 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 955 </tr>
+ − 956 <tr>
+ − 957 <td>40.1 bits(20)</td>
+ − 958 <td>0.0</td>
+ − 959 <td>20/20(100%)</td>
+ − 960 <td>0/20(0%)</td>
+ − 961 <td>Plus/Plus</td>
+ − 962 </tr>
+ − 963 </table>
+ − 964
+ − 965 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20
+ − 966 ||||||||||||||||||||
+ − 967 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre>
+ − 968 </div>
+ − 969
+ − 970 </div>
+ − 971
+ − 972 <div class=alignment id=hit3-3>
+ − 973
+ − 974 <div class=linkheader>
+ − 975 <div class=right><a href="#description3-3">Descriptions</a></div>
+ − 976 <a class="linkheader" href="http://example.com/example-genebank/AJ308515.1/">Gene Bank</a>
+ − 977 </div>
+ − 978
+ − 979 <div class=title>
+ − 980 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p>
+ − 981 <p class=titleinfo>
+ − 982 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a>
+ − 983 <span class=b>Length:</span> 1045
+ − 984 <span class=b>Number of Matches:</span> 1
+ − 985 </p>
+ − 986 </div>
+ − 987
+ − 988
+ − 989 <div class=hotspot id=hotspot3-3-1>
+ − 990 <p class=range>
+ − 991 <span class=range>Range 1: 2 to 18</span>
+ − 992 </p>
+ − 993
+ − 994 <table class=hotspotstable>
+ − 995 <tr>
+ − 996 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 997 </tr>
+ − 998 <tr>
+ − 999 <td>34.2 bits(17)</td>
+ − 1000 <td>0.0</td>
+ − 1001 <td>17/17(100%)</td>
+ − 1002 <td>0/17(0%)</td>
+ − 1003 <td>Plus/Plus</td>
+ − 1004 </tr>
+ − 1005 </table>
+ − 1006
+ − 1007 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20
+ − 1008 |||||||||||||||||
+ − 1009 Subject 2 GCGCGGTGTCATCTATG 18</pre>
+ − 1010 </div>
+ − 1011
+ − 1012 </div>
+ − 1013
+ − 1014 </div></div>
+ − 1015 </section>
+ − 1016 </section>
+ − 1017
+ − 1018 <section class=match id=match4>
+ − 1019
+ − 1020 <h1>Nucleotide Sequence (24 letters)</h1>
+ − 1021
+ − 1022 <section class=header>
+ − 1023
+ − 1024 <table class=headerdata>
+ − 1025 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1026 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1027 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1028 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1029 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 1030 </table>
+ − 1031
+ − 1032 </section>
+ − 1033
+ − 1034 <section>
+ − 1035 <h2>No Hits</h2>
+ − 1036 <div class=grey>
+ − 1037 <table class=headerdata>
+ − 1038 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1039 </table>
+ − 1040 </div>
+ − 1041 </section>
+ − 1042 </section>
+ − 1043
+ − 1044 <section class=match id=match5>
+ − 1045
+ − 1046 <h1>Nucleotide Sequence (20 letters)</h1>
+ − 1047
+ − 1048 <section class=header>
+ − 1049
+ − 1050 <table class=headerdata>
+ − 1051 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1052 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1053 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1054 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1055 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 1056 </table>
+ − 1057
+ − 1058 </section>
+ − 1059
+ − 1060 <section>
+ − 1061 <h2>No Hits</h2>
+ − 1062 <div class=grey>
+ − 1063 <table class=headerdata>
+ − 1064 <tr><td class=param>Message:</td><td>No hits found</td></tr>
+ − 1065 </table>
+ − 1066 </div>
+ − 1067 </section>
+ − 1068 </section>
+ − 1069
+ − 1070 <section class=match id=match6>
+ − 1071
+ − 1072 <h1>Nucleotide Sequence (25 letters)</h1>
+ − 1073
+ − 1074 <section class=header>
+ − 1075
+ − 1076 <table class=headerdata>
+ − 1077 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1078 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1079 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1080 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1081 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 1082 </table>
+ − 1083
+ − 1084 </section>
+ − 1085
+ − 1086
+ − 1087 <section class=graphics>
+ − 1088 <h2>Graphic Summary</h2>
+ − 1089
+ − 1090 <div class=grey>
+ − 1091 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+ − 1092
+ − 1093 <div class=defline id=defline6>
+ − 1094 Mouse-over to show defline and scores, click to show alignments
+ − 1095 </div>
+ − 1096
+ − 1097 <div class=graphic>
+ − 1098 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 1099 <div class=legend><div class=graphicrow>
+ − 1100 <div class=graphicitem style="background-color: black"><40</div>
+ − 1101 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 1102 <div class=graphicitem style="background-color: green">50–80</div>
+ − 1103 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 1104 <div class=graphicitem style="background-color: red">200≤</div>
+ − 1105 </div></div>
+ − 1106 <div style="clear: left"></div>
+ − 1107
+ − 1108 <div class=tablewrapper>
+ − 1109
+ − 1110 <div class=scale>
+ − 1111 <div>query:</div>
+ − 1112 <div class=graphicrow>
+ − 1113 <div>
+ − 1114 <div class=graphicitem style="width: 12%">
+ − 1115 <div>3</div>
+ − 1116 </div>
+ − 1117 <div class=graphicitem style="width: 12%">
+ − 1118 <div>6</div>
+ − 1119 </div>
+ − 1120 <div class=graphicitem style="width: 12%">
+ − 1121 <div>9</div>
+ − 1122 </div>
+ − 1123 <div class=graphicitem style="width: 12%">
+ − 1124 <div>12</div>
+ − 1125 </div>
+ − 1126 <div class=graphicitem style="width: 12%">
+ − 1127 <div>15</div>
+ − 1128 </div>
+ − 1129 <div class=graphicitem style="width: 12%">
+ − 1130 <div>18</div>
+ − 1131 </div>
+ − 1132 <div class=graphicitem style="width: 12%">
+ − 1133 <div>21</div>
+ − 1134 </div>
+ − 1135 <div class=graphicitem style="width: 12%">
+ − 1136 <div>24</div>
+ − 1137 </div>
+ − 1138 <div class=graphicitem style="width: 4%">
+ − 1139 <div>25</div>
+ − 1140 </div>
+ − 1141 </div>
+ − 1142 </div>
+ − 1143 <div style="clear: left"></div>
+ − 1144 </div>
+ − 1145
+ − 1146 <a class=matchresult
+ − 1147 href="#hit6-1"
+ − 1148 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+ − 1149 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1150 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+ − 1151 <div class="matchrow graphicrow">
+ − 1152 <div class="matchitem graphicitem"
+ − 1153 style="background-color: black; width: 88%"></div>
+ − 1154 <div class="matchitem graphicitem"
+ − 1155 style="background-color: transparent; width: 12%"></div>
+ − 1156 </div>
+ − 1157 </a>
+ − 1158
+ − 1159 <a class=matchresult
+ − 1160 href="#hit6-2"
+ − 1161 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+ − 1162 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1163 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+ − 1164 <div class="matchrow graphicrow">
+ − 1165 <div class="matchitem graphicitem"
+ − 1166 style="background-color: black; width: 88%"></div>
+ − 1167 <div class="matchitem graphicitem"
+ − 1168 style="background-color: transparent; width: 12%"></div>
+ − 1169 </div>
+ − 1170 </a>
+ − 1171
+ − 1172 </div>
+ − 1173 </div>
+ − 1174 </div>
+ − 1175 </section>
+ − 1176
+ − 1177
+ − 1178
+ − 1179 <section class=descriptions>
+ − 1180 <h2>Descriptions</h2>
+ − 1181
+ − 1182 <div class=grey><div class=white>
+ − 1183 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1184
+ − 1185 <table class=descriptiontable>
+ − 1186 <col/><col/><col/><col/><col/><col/><col/>
+ − 1187 <tr>
+ − 1188 <th>Description</th>
+ − 1189 <th>Max score</th>
+ − 1190 <th>Total score</th>
+ − 1191 <th>Query cover</th>
+ − 1192 <th>E value</th>
+ − 1193 <th>Ident</th>
+ − 1194 <th>Accession</th>
+ − 1195 </tr>
+ − 1196 <tr>
+ − 1197 <td><div><a href="#hit6-1"
+ − 1198 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+ − 1199 id="description6-1">
+ − 1200 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+ − 1201 </a></div></td>
+ − 1202 <td>36.2</td>
+ − 1203 <td>36.2</td>
+ − 1204 <td>88%</td>
+ − 1205 <td>3.148e-06</td>
+ − 1206 <td>95%</td>
+ − 1207 <td><a href="http://example.com/example-genebank/EUG/">7</a></td>
+ − 1208 </tr>
+ − 1209 <tr>
+ − 1210 <td><div><a href="#hit6-2"
+ − 1211 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+ − 1212 id="description6-2">
+ − 1213 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+ − 1214 </a></div></td>
+ − 1215 <td>36.2</td>
+ − 1216 <td>36.2</td>
+ − 1217 <td>88%</td>
+ − 1218 <td>3.148e-06</td>
+ − 1219 <td>95%</td>
+ − 1220 <td><a href="http://example.com/example-genebank/AY326434/">6</a></td>
+ − 1221 </tr>
+ − 1222 </table>
+ − 1223
+ − 1224 </div></div>
+ − 1225 </section>
+ − 1226
+ − 1227
+ − 1228
+ − 1229 <section class=alignments>
+ − 1230 <h2>Alignments</h2>
+ − 1231
+ − 1232 <div class=grey><div class=white>
+ − 1233 <div class=alignment id=hit6-1>
+ − 1234
+ − 1235 <div class=linkheader>
+ − 1236 <div class=right><a href="#description6-1">Descriptions</a></div>
+ − 1237 <a class="linkheader" href="http://example.com/example-genebank/EUG/">Gene Bank</a>
+ − 1238 </div>
+ − 1239
+ − 1240 <div class=title>
+ − 1241 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+ − 1242 <p class=titleinfo>
+ − 1243 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a>
+ − 1244 <span class=b>Length:</span> 4983
+ − 1245 <span class=b>Number of Matches:</span> 1
+ − 1246 </p>
+ − 1247 </div>
+ − 1248
+ − 1249
+ − 1250 <div class=hotspot id=hotspot6-1-1>
+ − 1251 <p class=range>
+ − 1252 <span class=range>Range 1: 2344 to 2365</span>
+ − 1253 </p>
+ − 1254
+ − 1255 <table class=hotspotstable>
+ − 1256 <tr>
+ − 1257 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1258 </tr>
+ − 1259 <tr>
+ − 1260 <td>36.2 bits(18)</td>
+ − 1261 <td>0.0</td>
+ − 1262 <td>21/22(95%)</td>
+ − 1263 <td>0/22(0%)</td>
+ − 1264 <td>Plus/Plus</td>
+ − 1265 </tr>
+ − 1266 </table>
+ − 1267
+ − 1268 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22
+ − 1269 |||||||||||||| |||||||
+ − 1270 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre>
+ − 1271 </div>
+ − 1272
+ − 1273 </div>
+ − 1274
+ − 1275 <div class=alignment id=hit6-2>
+ − 1276
+ − 1277 <div class=linkheader>
+ − 1278 <div class=right><a href="#description6-2">Descriptions</a></div>
+ − 1279 <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Gene Bank</a>
+ − 1280 </div>
+ − 1281
+ − 1282 <div class=title>
+ − 1283 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+ − 1284 <p class=titleinfo>
+ − 1285 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a>
+ − 1286 <span class=b>Length:</span> 4180
+ − 1287 <span class=b>Number of Matches:</span> 1
+ − 1288 </p>
+ − 1289 </div>
+ − 1290
+ − 1291
+ − 1292 <div class=hotspot id=hotspot6-2-1>
+ − 1293 <p class=range>
+ − 1294 <span class=range>Range 1: 1541 to 1562</span>
+ − 1295 </p>
+ − 1296
+ − 1297 <table class=hotspotstable>
+ − 1298 <tr>
+ − 1299 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1300 </tr>
+ − 1301 <tr>
+ − 1302 <td>36.2 bits(18)</td>
+ − 1303 <td>0.0</td>
+ − 1304 <td>21/22(95%)</td>
+ − 1305 <td>0/22(0%)</td>
+ − 1306 <td>Plus/Plus</td>
+ − 1307 </tr>
+ − 1308 </table>
+ − 1309
+ − 1310 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22
+ − 1311 |||||||||||||| |||||||
+ − 1312 Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre>
+ − 1313 </div>
+ − 1314
+ − 1315 </div>
+ − 1316
+ − 1317 </div></div>
+ − 1318 </section>
+ − 1319 </section>
+ − 1320
+ − 1321 <section class=match id=match7>
+ − 1322
+ − 1323 <h1>Nucleotide Sequence (74 letters)</h1>
+ − 1324
+ − 1325 <section class=header>
+ − 1326
+ − 1327 <table class=headerdata>
+ − 1328 <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+ − 1329 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+ − 1330 <tr><td class=param>Query length:</td><td>20</td></tr>
+ − 1331 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+ − 1332 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+ − 1333 </table>
+ − 1334
+ − 1335 </section>
+ − 1336
+ − 1337
+ − 1338 <section class=graphics>
+ − 1339 <h2>Graphic Summary</h2>
+ − 1340
+ − 1341 <div class=grey>
+ − 1342 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+ − 1343
+ − 1344 <div class=defline id=defline7>
+ − 1345 Mouse-over to show defline and scores, click to show alignments
+ − 1346 </div>
+ − 1347
+ − 1348 <div class=graphic>
+ − 1349 <h4 class=darkHeader>Color key for alignment scores</h4>
+ − 1350 <div class=legend><div class=graphicrow>
+ − 1351 <div class=graphicitem style="background-color: black"><40</div>
+ − 1352 <div class=graphicitem style="background-color: blue">40–50</div>
+ − 1353 <div class=graphicitem style="background-color: green">50–80</div>
+ − 1354 <div class=graphicitem style="background-color: magenta">80–200</div>
+ − 1355 <div class=graphicitem style="background-color: red">200≤</div>
+ − 1356 </div></div>
+ − 1357 <div style="clear: left"></div>
+ − 1358
+ − 1359 <div class=tablewrapper>
+ − 1360
+ − 1361 <div class=scale>
+ − 1362 <div>query:</div>
+ − 1363 <div class=graphicrow>
+ − 1364 <div>
+ − 1365 <div class=graphicitem style="width: 10.8108108108%">
+ − 1366 <div>8</div>
+ − 1367 </div>
+ − 1368 <div class=graphicitem style="width: 10.8108108108%">
+ − 1369 <div>16</div>
+ − 1370 </div>
+ − 1371 <div class=graphicitem style="width: 10.8108108108%">
+ − 1372 <div>24</div>
+ − 1373 </div>
+ − 1374 <div class=graphicitem style="width: 10.8108108108%">
+ − 1375 <div>32</div>
+ − 1376 </div>
+ − 1377 <div class=graphicitem style="width: 10.8108108108%">
+ − 1378 <div>40</div>
+ − 1379 </div>
+ − 1380 <div class=graphicitem style="width: 10.8108108108%">
+ − 1381 <div>48</div>
+ − 1382 </div>
+ − 1383 <div class=graphicitem style="width: 10.8108108108%">
+ − 1384 <div>56</div>
+ − 1385 </div>
+ − 1386 <div class=graphicitem style="width: 10.8108108108%">
+ − 1387 <div>64</div>
+ − 1388 </div>
+ − 1389 <div class=graphicitem style="width: 10.8108108108%">
+ − 1390 <div>72</div>
+ − 1391 </div>
+ − 1392 <div class=graphicitem style="width: 2.7027027027%">
+ − 1393 <div> </div>
+ − 1394 <div class=lastlabel>74</div>
+ − 1395 </div>
+ − 1396 </div>
+ − 1397 </div>
+ − 1398 <div style="clear: left"></div>
+ − 1399 </div>
+ − 1400
+ − 1401 <a class=matchresult
+ − 1402 href="#hit7-1"
+ − 1403 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+ − 1404 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1405 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+ − 1406 <div class="matchrow graphicrow">
+ − 1407 <div class="matchitem graphicitem"
+ − 1408 style="background-color: green; width: 100%"></div>
+ − 1409 </div>
+ − 1410 </a>
+ − 1411
+ − 1412 <a class=matchresult
+ − 1413 href="#hit7-2"
+ − 1414 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+ − 1415 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+ − 1416 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+ − 1417 <div class="matchrow graphicrow">
+ − 1418 <div class="matchitem graphicitem"
+ − 1419 style="background-color: green; width: 100%"></div>
+ − 1420 </div>
+ − 1421 </a>
+ − 1422
+ − 1423 </div>
+ − 1424 </div>
+ − 1425 </div>
+ − 1426 </section>
+ − 1427
+ − 1428
+ − 1429
+ − 1430 <section class=descriptions>
+ − 1431 <h2>Descriptions</h2>
+ − 1432
+ − 1433 <div class=grey><div class=white>
+ − 1434 <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+ − 1435
+ − 1436 <table class=descriptiontable>
+ − 1437 <col/><col/><col/><col/><col/><col/><col/>
+ − 1438 <tr>
+ − 1439 <th>Description</th>
+ − 1440 <th>Max score</th>
+ − 1441 <th>Total score</th>
+ − 1442 <th>Query cover</th>
+ − 1443 <th>E value</th>
+ − 1444 <th>Ident</th>
+ − 1445 <th>Accession</th>
+ − 1446 </tr>
+ − 1447 <tr>
+ − 1448 <td><div><a href="#hit7-1"
+ − 1449 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+ − 1450 id="description7-1">
+ − 1451 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+ − 1452 </a></div></td>
+ − 1453 <td>67.9</td>
+ − 1454 <td>67.9</td>
+ − 1455 <td>100%</td>
+ − 1456 <td>3.564e-15</td>
+ − 1457 <td>86%</td>
+ − 1458 <td><a href="http://example.com/example-genebank/EUG/">7</a></td>
+ − 1459 </tr>
+ − 1460 <tr>
+ − 1461 <td><div><a href="#hit7-2"
+ − 1462 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+ − 1463 id="description7-2">
+ − 1464 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+ − 1465 </a></div></td>
+ − 1466 <td>67.9</td>
+ − 1467 <td>67.9</td>
+ − 1468 <td>100%</td>
+ − 1469 <td>3.564e-15</td>
+ − 1470 <td>86%</td>
+ − 1471 <td><a href="http://example.com/example-genebank/AY326434/">6</a></td>
+ − 1472 </tr>
+ − 1473 </table>
+ − 1474
+ − 1475 </div></div>
+ − 1476 </section>
+ − 1477
+ − 1478
+ − 1479
+ − 1480 <section class=alignments>
+ − 1481 <h2>Alignments</h2>
+ − 1482
+ − 1483 <div class=grey><div class=white>
+ − 1484 <div class=alignment id=hit7-1>
+ − 1485
+ − 1486 <div class=linkheader>
+ − 1487 <div class=right><a href="#description7-1">Descriptions</a></div>
+ − 1488 <a class="linkheader" href="http://example.com/example-genebank/EUG/">Gene Bank</a>
+ − 1489 </div>
+ − 1490
+ − 1491 <div class=title>
+ − 1492 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+ − 1493 <p class=titleinfo>
+ − 1494 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a>
+ − 1495 <span class=b>Length:</span> 4983
+ − 1496 <span class=b>Number of Matches:</span> 1
+ − 1497 </p>
+ − 1498 </div>
+ − 1499
+ − 1500
+ − 1501 <div class=hotspot id=hotspot7-1-1>
+ − 1502 <p class=range>
+ − 1503 <span class=range>Range 1: 2319 to 2392</span>
+ − 1504 </p>
+ − 1505
+ − 1506 <table class=hotspotstable>
+ − 1507 <tr>
+ − 1508 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1509 </tr>
+ − 1510 <tr>
+ − 1511 <td>67.9 bits(34)</td>
+ − 1512 <td>0.0</td>
+ − 1513 <td>64/74(86%)</td>
+ − 1514 <td>0/74(0%)</td>
+ − 1515 <td>Plus/Plus</td>
+ − 1516 </tr>
+ − 1517 </table>
+ − 1518
+ − 1519 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60
+ − 1520 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| |
+ − 1521 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre>
+ − 1522 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74
+ − 1523 ||||| ||||||||
+ − 1524 Subject 2379 TTCGCCGTCCAGAA 2392</pre>
+ − 1525 </div>
+ − 1526
+ − 1527 </div>
+ − 1528
+ − 1529 <div class=alignment id=hit7-2>
+ − 1530
+ − 1531 <div class=linkheader>
+ − 1532 <div class=right><a href="#description7-2">Descriptions</a></div>
+ − 1533 <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Gene Bank</a>
+ − 1534 </div>
+ − 1535
+ − 1536 <div class=title>
+ − 1537 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+ − 1538 <p class=titleinfo>
+ − 1539 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a>
+ − 1540 <span class=b>Length:</span> 4180
+ − 1541 <span class=b>Number of Matches:</span> 1
+ − 1542 </p>
+ − 1543 </div>
+ − 1544
+ − 1545
+ − 1546 <div class=hotspot id=hotspot7-2-1>
+ − 1547 <p class=range>
+ − 1548 <span class=range>Range 1: 1589 to 1516</span>
+ − 1549 </p>
+ − 1550
+ − 1551 <table class=hotspotstable>
+ − 1552 <tr>
+ − 1553 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+ − 1554 </tr>
+ − 1555 <tr>
+ − 1556 <td>67.9 bits(34)</td>
+ − 1557 <td>0.0</td>
+ − 1558 <td>64/74(86%)</td>
+ − 1559 <td>0/74(0%)</td>
+ − 1560 <td>Plus/Minus</td>
+ − 1561 </tr>
+ − 1562 </table>
+ − 1563
+ − 1564 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60
+ − 1565 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| |
+ − 1566 Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre>
+ − 1567 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74
+ − 1568 ||||| ||||||||
+ − 1569 Subject 1529 TTCGCCGTCCAGAA 1516</pre>
+ − 1570 </div>
+ − 1571
+ − 1572 </div>
+ − 1573
+ − 1574 </div></div>
+ − 1575 </section>
+ − 1576 </section>
+ − 1577
+ − 1578 </div>
+ − 1579
+ − 1580 <footer>
+ − 1581 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>.
+ − 1582 </footer>
+ − 1583 </body>
+ − 1584 </html>
+ − 1585
