Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example3.html @ 99:8f02008a5f20
look at all blast*.loc files; python2.6 compat fix
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Tue, 01 Jul 2014 16:00:29 +0200 |
| parents | e780606b7c25 |
| children | b3b5ee557170 |
| rev | line source |
|---|---|
| 32 | 1 <!DOCTYPE html> |
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> |
| 32 | 6 |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 43 border-bottom: 1px solid #CCCCCC; | |
| 44 font-size: 150%; | |
| 45 padding-bottom: 0.1em; | |
| 46 } | |
| 47 | |
| 48 h2 { | |
| 49 font-size: 120%; | |
| 50 font-weight: bold; | |
| 51 } | |
| 52 | |
| 53 h4.darkHeader { | |
| 54 color: #4D4D4D; | |
| 55 letter-spacing: 0; | |
| 56 font-weight: bold; | |
| 57 } | |
| 58 | |
| 59 #nodata { | |
| 60 font-weight: bold; | |
| 61 } | |
| 62 | |
| 63 .index { | |
| 64 margin-bottom: 3em; | |
| 65 } | |
| 66 .index div.indexentry { | |
| 67 margin: 1.2em 1.6em; | |
| 68 font-weight: bold; | |
| 69 font-size: 100%; | |
| 70 } | |
| 71 | |
| 72 .headerdata { | |
| 73 font-size: 90%; | |
| 74 } | |
| 75 .headerdata .param { | |
| 76 font-weight: bold; | |
| 77 text-align: right; | |
| 78 padding: 0 1em; | |
| 79 } | |
| 80 | |
| 81 .grey { | |
| 82 background-color: #eeeeee; | |
| 83 border: 1px solid #cccccc; | |
| 84 padding: 1em; | |
| 85 } | |
| 86 | |
| 87 .white { | |
| 88 background-color: white; | |
| 89 border: 1px solid #cccccc; | |
| 90 padding: 1.5em 2%; | |
| 91 } | |
| 92 | |
| 93 .graphicrow { | |
| 94 clear: left; | |
| 95 width: 100%; | |
| 96 } | |
| 97 | |
| 98 .graphicitem { | |
| 99 float: left; | |
| 100 } | |
| 101 | |
| 102 | |
| 103 | |
| 104 .graphics .grey { | |
| 105 text-align: center; | |
| 106 } | |
| 107 | |
| 108 .graphic { | |
| 109 background-color: white; | |
| 110 border: 2px solid black; | |
| 111 padding: 1.5em; | |
| 112 margin: auto; | |
| 113 } | |
| 114 | |
| 115 .centered, .defline, div.legend, div.tablewrapper { | |
| 116 margin-left: auto; | |
| 117 margin-right: auto; | |
| 118 } | |
| 119 | |
| 120 .defline { | |
| 121 background-color: white; | |
| 122 border: 1px solid black; | |
| 123 margin: .5em auto; | |
| 124 padding-left: .2em; | |
| 125 padding-right: .2em; | |
| 126 max-width: 50em; | |
| 127 text-align: left; | |
| 128 height: 2.8em; | |
| 59 | 129 overflow: hidden; |
| 32 | 130 } |
| 131 | |
| 132 div.legend { | |
| 133 max-width: 40em; | |
| 134 } | |
| 135 div.legend div { | |
| 136 width: 100%; | |
| 137 color: white; | |
| 138 font-weight: bold; | |
| 139 border-spacing: 0; | |
| 140 } | |
| 141 div.legend div .graphicitem { | |
| 142 width: 20%; | |
| 143 padding: 0; | |
| 144 margin: 0; | |
| 145 border: none; | |
| 146 } | |
| 147 | |
| 148 div.tablewrapper { | |
| 149 width: 50%; | |
| 150 min-width: 60em; | |
| 151 } | |
| 152 | |
| 153 /* For small widths we give the graphic 100% */ | |
| 154 @media (max-width: 72.5em) { | |
| 155 div.tablewrapper { | |
| 156 width: 100%; | |
| 157 min-width: 0px; | |
| 158 } | |
| 159 } | |
| 160 | |
| 161 .scale { | |
| 162 width: 100%; | |
| 163 margin: .5em 0; | |
| 164 font-weight: bold; | |
| 165 } | |
| 166 .scale div { | |
| 167 color: red; | |
| 168 text-align: left; | |
| 169 } | |
| 170 .scale .graphicrow { | |
| 171 margin: .5em 0 .5em 0; | |
| 172 color: white; | |
| 173 } | |
| 174 .scale .graphicitem { | |
| 175 position: relative; | |
| 176 } | |
| 177 .scale .graphicitem div { | |
| 178 margin: 0 1px; | |
| 179 padding: 0 2px; | |
| 180 text-align: right; | |
| 181 background-color: red; | |
| 182 color: white; | |
| 183 } | |
| 184 .scale .graphicitem:first-child div { | |
| 185 margin-left: 0px; | |
| 186 } | |
| 187 .scale .graphicitem:last-child div { | |
| 188 margin-right: 0px; | |
| 189 } | |
| 190 .scale .graphicitem .lastlabel { | |
| 191 position: absolute; | |
| 192 top: 0px; | |
| 193 left: 100%; | |
| 194 background-color: transparent; | |
| 195 color: red; | |
| 196 } | |
| 197 | |
| 198 a.matchresult { | |
| 199 display: block; | |
| 200 margin: 0; | |
| 201 padding: 0; | |
| 202 } | |
| 203 div.matchrow { | |
| 204 margin-top: 4px; | |
| 205 } | |
| 206 div.matchrow, div.matchitem { | |
| 207 height: 4px; | |
| 208 } | |
| 209 | |
| 210 | |
| 211 table.descriptiontable { | |
| 212 font-size: 85%; | |
| 213 border: 1px solid #97b0c8; | |
| 214 border-spacing: 0; | |
| 215 color: #222222; | |
| 216 line-height: 1.3em; | |
| 217 background-color: white; | |
| 218 } | |
| 219 table.descriptiontable col:first-child { | |
| 220 width: 100%; | |
| 221 } | |
| 222 table.descriptiontable tr:hover { | |
| 223 background-color: #D5DEE3; | |
| 224 } | |
| 225 table.descriptiontable th { | |
| 226 color: #14376C; | |
| 227 font-weight: normal; | |
| 228 background-color: #F0F0F0; | |
| 229 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 230 border-bottom: 1px solid #D4DFE9; | |
| 231 border-right: 1px solid #CFCFCF; | |
| 232 border-left: 0px solid black; | |
| 233 border-top: 0px solid black; | |
| 234 } | |
| 235 table.descriptiontable td { | |
| 236 overflow: hidden; | |
| 237 text-align: center; | |
| 238 padding: .4em .8em; | |
| 239 } | |
| 240 table.descriptiontable td div { | |
| 241 width: 1em; | |
| 242 overflow: visible; | |
| 243 white-space: nowrap; | |
| 244 text-align: left; | |
| 245 } | |
| 246 | |
| 247 | |
| 248 | |
| 249 .alignments .white { | |
| 250 padding: 1.5em 1em; | |
| 251 } | |
| 252 | |
| 253 .alignment { | |
| 254 border-top: 1px solid black; | |
| 255 padding-left: 1em; | |
| 256 padding-right: 1em; | |
| 257 } | |
| 258 | |
| 259 div.linkheader { | |
| 260 padding-top: .2em; | |
| 261 font-size: 85%; | |
| 262 color: #14376C; | |
| 263 } | |
| 264 div.linkheader a.linkheader { | |
| 265 margin-right: 1em; | |
| 266 } | |
| 267 div.linkheader .right a { | |
| 268 text-decoration: none; | |
| 269 } | |
| 270 | |
| 271 .title .hittitle { | |
| 272 color: #222222; | |
| 273 margin-bottom: .3em; | |
| 274 } | |
| 275 .title .titleinfo { | |
| 276 font-size: 80%; | |
| 277 margin-top: 0; | |
| 278 margin-bottom: .3em; | |
| 279 } | |
| 280 .title .titleinfo .b { | |
| 281 color: #606060; | |
| 282 font-weight: bold; | |
| 283 font-size: 90%; | |
| 284 } | |
| 285 | |
| 286 .moretitles { | |
| 287 margin: 1.2em; | |
| 288 } | |
| 289 .moretitles .titleinfo { | |
| 290 margin: 0; | |
| 291 padding: 0; | |
| 292 } | |
| 293 .moretitles .hittitle { | |
| 294 margin: .4em 0 .2em 0; | |
| 295 padding: 0; | |
| 296 } | |
| 297 | |
| 298 a.showmoretitles { | |
| 299 font-size: 75%; | |
| 300 color: #336699; | |
| 301 font-weight: bold; | |
| 302 margin-top: 0; | |
| 303 } | |
| 304 a.showmoretitles:hover { | |
| 305 } | |
| 306 | |
| 307 .hotspot { | |
| 308 color: #606060; | |
| 309 font-family: verdana, arial, sans-serif; | |
| 310 margin-bottom: 2.5em; | |
| 311 } | |
| 312 | |
| 313 .hotspot p.range { | |
| 314 font-size: 70%; | |
| 315 margin-top: 0; | |
| 316 margin-top: 1em; | |
| 317 margin-bottom: .2em; | |
| 318 } | |
| 319 .hotspot p.range span.range { | |
| 320 font-weight: bold; | |
| 321 } | |
| 322 .hotspot p.range a.range { | |
| 323 margin-left: .5em; | |
| 324 } | |
| 325 | |
| 326 table.hotspotstable { | |
| 327 border-top: 1px solid; | |
| 328 border-bottom: 1px solid; | |
| 329 text-align: left; | |
| 330 border-collapse: collapse; | |
| 331 } | |
| 332 table.hotspotstable th, table.hotspotstable td { | |
| 333 padding: .1em 1em; | |
| 334 } | |
| 335 table.hotspotstable th { | |
| 336 font-size: 70%; | |
| 337 } | |
| 338 table.hotspotstable td { | |
| 339 min-width: 7em; | |
| 340 color: #222222; | |
| 341 font-size: 80%; | |
| 342 } | |
| 343 | |
| 344 pre.alignmentgraphic { | |
| 345 color: #222222; | |
| 346 } | |
| 347 | |
| 348 footer { | |
| 349 text-align: center; | |
| 350 color: #cccccc; | |
| 351 font-size: 70%; | |
| 352 margin-top: 1em; | |
| 353 } | |
| 354 footer :link { | |
| 355 color: #5588cc; | |
| 356 } | |
| 357 | |
| 358 </style> | |
| 359 | |
| 360 <script type="text/javascript"> | |
| 361 function toggle_visibility(id) { | |
| 362 var e = document.getElementById(id); | |
| 363 if(e.style.display != 'block') | |
| 364 e.style.display = 'block'; | |
| 365 else | |
| 366 e.style.display = 'none'; | |
| 367 } | |
| 368 </script> | |
| 369 | |
| 370 </head> | |
| 371 | |
| 372 | |
| 373 <body> | |
| 374 | |
| 375 <div id="strip_html_warning"> | |
| 376 <!-- This div should be hidden by the header css block. Galaxy | |
| 377 strips all css, breaking this page but making this warning | |
| 378 visible. This warning contains some ugly old skool tabular html | |
| 379 layout that is not stripped. --> | |
| 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 383 </b></font></td></tr></table> | |
| 384 </div> | |
| 385 | |
| 386 <div id=content> | |
| 387 | |
| 388 | |
| 389 <section class=index> | |
| 390 <h1>Queries</h1> | |
| 391 | |
| 392 <div class=indexentry><a href="#match1"> | |
| 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 394 (20 letters, 0 hits) | |
| 395 </a></div> | |
| 396 <div class=indexentry><a href="#match2"> | |
| 397 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 398 (20 letters, 0 hits) | |
| 399 </a></div> | |
| 400 <div class=indexentry><a href="#match3"> | |
| 401 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 402 (20 letters, 1 hits) | |
| 403 </a></div> | |
| 404 <div class=indexentry><a href="#match4"> | |
| 405 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 406 (20 letters, 0 hits) | |
| 407 </a></div> | |
| 408 <div class=indexentry><a href="#match5"> | |
| 409 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 410 (20 letters, 0 hits) | |
| 411 </a></div> | |
| 412 <div class=indexentry><a href="#match6"> | |
| 413 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 414 (20 letters, 1 hits) | |
| 415 </a></div> | |
| 416 <div class=indexentry><a href="#match7"> | |
| 417 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 418 (20 letters, 0 hits) | |
| 419 </a></div> | |
| 420 <div class=indexentry><a href="#match8"> | |
| 421 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 422 (20 letters, 0 hits) | |
| 423 </a></div> | |
| 424 <div class=indexentry><a href="#match9"> | |
| 425 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 426 (20 letters, 0 hits) | |
| 427 </a></div> | |
| 428 <div class=indexentry><a href="#match10"> | |
| 429 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 430 (20 letters, 0 hits) | |
| 431 </a></div> | |
| 432 <div class=indexentry><a href="#match11"> | |
| 433 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 434 (20 letters, 0 hits) | |
| 435 </a></div> | |
| 436 <div class=indexentry><a href="#match12"> | |
| 437 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 438 (20 letters, 0 hits) | |
| 439 </a></div> | |
| 440 <div class=indexentry><a href="#match13"> | |
| 441 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 442 (20 letters, 0 hits) | |
| 443 </a></div> | |
| 444 <div class=indexentry><a href="#match14"> | |
| 445 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 446 (20 letters, 0 hits) | |
| 447 </a></div> | |
| 448 <div class=indexentry><a href="#match15"> | |
| 449 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 450 (20 letters, 0 hits) | |
| 451 </a></div> | |
| 452 <div class=indexentry><a href="#match16"> | |
| 453 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 454 (20 letters, 0 hits) | |
| 455 </a></div> | |
| 456 <div class=indexentry><a href="#match17"> | |
| 457 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 458 (20 letters, 0 hits) | |
| 459 </a></div> | |
| 460 <div class=indexentry><a href="#match18"> | |
| 461 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 462 (20 letters, 1 hits) | |
| 463 </a></div> | |
| 464 <div class=indexentry><a href="#match19"> | |
| 465 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 466 (20 letters, 1 hits) | |
| 467 </a></div> | |
| 468 <div class=indexentry><a href="#match20"> | |
| 469 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 470 (20 letters, 0 hits) | |
| 471 </a></div> | |
| 472 <div class=indexentry><a href="#match21"> | |
| 473 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 474 (20 letters, 0 hits) | |
| 475 </a></div> | |
| 476 <div class=indexentry><a href="#match22"> | |
| 477 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 478 (20 letters, 1 hits) | |
| 479 </a></div> | |
| 480 <div class=indexentry><a href="#match23"> | |
| 481 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 482 (20 letters, 0 hits) | |
| 483 </a></div> | |
| 484 <div class=indexentry><a href="#match24"> | |
| 485 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 486 (20 letters, 0 hits) | |
| 487 </a></div> | |
| 488 <div class=indexentry><a href="#match25"> | |
| 489 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 490 (24 letters, 0 hits) | |
| 491 </a></div> | |
| 492 <div class=indexentry><a href="#match26"> | |
| 493 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 494 (24 letters, 0 hits) | |
| 495 </a></div> | |
| 496 <div class=indexentry><a href="#match27"> | |
| 497 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 498 (24 letters, 0 hits) | |
| 499 </a></div> | |
| 500 <div class=indexentry><a href="#match28"> | |
| 501 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 502 (24 letters, 0 hits) | |
| 503 </a></div> | |
| 504 <div class=indexentry><a href="#match29"> | |
| 505 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 506 (24 letters, 0 hits) | |
| 507 </a></div> | |
| 508 <div class=indexentry><a href="#match30"> | |
| 509 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 510 (24 letters, 0 hits) | |
| 511 </a></div> | |
| 512 <div class=indexentry><a href="#match31"> | |
| 513 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 514 (24 letters, 0 hits) | |
| 515 </a></div> | |
| 516 <div class=indexentry><a href="#match32"> | |
| 517 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 518 (24 letters, 0 hits) | |
| 519 </a></div> | |
| 520 <div class=indexentry><a href="#match33"> | |
| 521 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 522 (20 letters, 0 hits) | |
| 523 </a></div> | |
| 524 <div class=indexentry><a href="#match34"> | |
| 525 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 526 (20 letters, 0 hits) | |
| 527 </a></div> | |
| 528 <div class=indexentry><a href="#match35"> | |
| 529 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 530 (20 letters, 0 hits) | |
| 531 </a></div> | |
| 532 <div class=indexentry><a href="#match36"> | |
| 533 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 534 (20 letters, 0 hits) | |
| 535 </a></div> | |
| 536 <div class=indexentry><a href="#match37"> | |
| 537 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 538 (20 letters, 0 hits) | |
| 539 </a></div> | |
| 540 <div class=indexentry><a href="#match38"> | |
| 541 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 542 (20 letters, 0 hits) | |
| 543 </a></div> | |
| 544 <div class=indexentry><a href="#match39"> | |
| 545 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 546 (20 letters, 0 hits) | |
| 547 </a></div> | |
| 548 <div class=indexentry><a href="#match40"> | |
| 549 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 550 (20 letters, 0 hits) | |
| 551 </a></div> | |
| 552 <div class=indexentry><a href="#match41"> | |
| 553 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 554 (25 letters, 0 hits) | |
| 555 </a></div> | |
| 556 <div class=indexentry><a href="#match42"> | |
| 557 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 558 (25 letters, 0 hits) | |
| 559 </a></div> | |
| 560 <div class=indexentry><a href="#match43"> | |
| 561 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 562 (25 letters, 0 hits) | |
| 563 </a></div> | |
| 564 <div class=indexentry><a href="#match44"> | |
| 565 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 566 (25 letters, 0 hits) | |
| 567 </a></div> | |
| 568 <div class=indexentry><a href="#match45"> | |
| 569 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 570 (25 letters, 0 hits) | |
| 571 </a></div> | |
| 572 <div class=indexentry><a href="#match46"> | |
| 573 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 574 (25 letters, 0 hits) | |
| 575 </a></div> | |
| 576 <div class=indexentry><a href="#match47"> | |
| 577 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 578 (25 letters, 1 hits) | |
| 579 </a></div> | |
| 580 <div class=indexentry><a href="#match48"> | |
| 581 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 582 (25 letters, 1 hits) | |
| 583 </a></div> | |
| 584 <div class=indexentry><a href="#match49"> | |
| 585 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 586 (74 letters, 0 hits) | |
| 587 </a></div> | |
| 588 <div class=indexentry><a href="#match50"> | |
| 589 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 590 (74 letters, 0 hits) | |
| 591 </a></div> | |
| 592 <div class=indexentry><a href="#match51"> | |
| 593 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 594 (74 letters, 0 hits) | |
| 595 </a></div> | |
| 596 <div class=indexentry><a href="#match52"> | |
| 597 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 598 (74 letters, 0 hits) | |
| 599 </a></div> | |
| 600 <div class=indexentry><a href="#match53"> | |
| 601 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 602 (74 letters, 0 hits) | |
| 603 </a></div> | |
| 604 <div class=indexentry><a href="#match54"> | |
| 605 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 606 (74 letters, 0 hits) | |
| 607 </a></div> | |
| 608 <div class=indexentry><a href="#match55"> | |
| 609 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 610 (74 letters, 1 hits) | |
| 611 </a></div> | |
| 612 <div class=indexentry><a href="#match56"> | |
| 613 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 614 (74 letters, 1 hits) | |
| 615 </a></div> | |
| 616 | |
| 617 </section> | |
| 618 | |
| 619 | |
| 620 <section class=match id=match1> | |
| 621 | |
| 622 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 623 | |
| 624 <section class=header> | |
| 625 | |
| 626 <table class=headerdata> | |
| 627 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 628 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 629 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 630 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 631 <tr><td class=param>Database:</td><td></td></tr> | |
| 632 </table> | |
| 633 | |
| 634 </section> | |
| 635 | |
| 636 <section> | |
| 637 <h2>No Hits</h2> | |
| 638 <div class=grey> | |
| 639 <table class=headerdata> | |
| 640 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 641 </table> | |
| 642 </div> | |
| 643 </section> | |
| 644 </section> | |
| 645 | |
| 646 <section class=match id=match2> | |
| 647 | |
| 648 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 649 | |
| 650 <section class=header> | |
| 651 | |
| 652 <table class=headerdata> | |
| 653 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 654 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 655 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 656 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 657 <tr><td class=param>Database:</td><td></td></tr> | |
| 658 </table> | |
| 659 | |
| 660 </section> | |
| 661 | |
| 662 <section> | |
| 663 <h2>No Hits</h2> | |
| 664 <div class=grey> | |
| 665 <table class=headerdata> | |
| 666 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 667 </table> | |
| 668 </div> | |
| 669 </section> | |
| 670 </section> | |
| 671 | |
| 672 <section class=match id=match3> | |
| 673 | |
| 674 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 675 | |
| 676 <section class=header> | |
| 677 | |
| 678 <table class=headerdata> | |
| 679 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 680 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 681 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 682 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 683 <tr><td class=param>Database:</td><td></td></tr> | |
| 684 </table> | |
| 685 | |
| 686 </section> | |
| 687 | |
| 688 | |
| 689 <section class=graphics> | |
| 690 <h2>Graphic Summary</h2> | |
| 691 | |
| 692 <div class=grey> | |
| 693 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 694 | |
| 695 <div class=defline id=defline3> | |
| 696 Mouse-over to show defline and scores, click to show alignments | |
| 697 </div> | |
| 698 | |
| 699 <div class=graphic> | |
| 700 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 701 <div class=legend><div class=graphicrow> | |
| 702 <div class=graphicitem style="background-color: black"><40</div> | |
| 703 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 704 <div class=graphicitem style="background-color: green">50–80</div> | |
| 705 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 706 <div class=graphicitem style="background-color: red">200≤</div> | |
| 707 </div></div> | |
| 708 <div style="clear: left"></div> | |
| 709 | |
| 710 <div class=tablewrapper> | |
| 711 | |
| 712 <div class=scale> | |
| 713 <div>query:</div> | |
| 714 <div class=graphicrow> | |
| 715 <div> | |
| 77 | 716 <div class=graphicitem style="width: 10%"> |
| 32 | 717 <div>2</div> |
| 718 </div> | |
| 77 | 719 <div class=graphicitem style="width: 10%"> |
| 32 | 720 <div>4</div> |
| 721 </div> | |
| 77 | 722 <div class=graphicitem style="width: 10%"> |
| 32 | 723 <div>6</div> |
| 724 </div> | |
| 77 | 725 <div class=graphicitem style="width: 10%"> |
| 32 | 726 <div>8</div> |
| 727 </div> | |
| 77 | 728 <div class=graphicitem style="width: 10%"> |
| 32 | 729 <div>10</div> |
| 730 </div> | |
| 77 | 731 <div class=graphicitem style="width: 10%"> |
| 32 | 732 <div>12</div> |
| 733 </div> | |
| 77 | 734 <div class=graphicitem style="width: 10%"> |
| 32 | 735 <div>14</div> |
| 736 </div> | |
| 77 | 737 <div class=graphicitem style="width: 10%"> |
| 32 | 738 <div>16</div> |
| 739 </div> | |
| 77 | 740 <div class=graphicitem style="width: 10%"> |
| 32 | 741 <div>18</div> |
| 742 </div> | |
| 77 | 743 <div class=graphicitem style="width: 10%"> |
| 32 | 744 <div>20</div> |
| 745 </div> | |
| 746 </div> | |
| 747 </div> | |
| 748 <div style="clear: left"></div> | |
| 749 </div> | |
| 750 | |
| 751 <a class=matchresult | |
| 59 | 752 href="#hit3-1" |
| 32 | 753 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 754 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 755 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 756 <div class="matchrow graphicrow"> | |
| 757 <div class="matchitem graphicitem" | |
| 77 | 758 style="background-color: black; width: 100%"></div> |
| 32 | 759 </div> |
| 760 </a> | |
| 761 | |
| 762 </div> | |
| 763 </div> | |
| 764 </div> | |
| 765 </section> | |
| 766 | |
| 767 | |
| 768 | |
| 769 <section class=descriptions> | |
| 770 <h2>Descriptions</h2> | |
| 771 | |
| 772 <div class=grey><div class=white> | |
| 773 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 774 | |
| 775 <table class=descriptiontable> | |
| 776 <col/><col/><col/><col/><col/><col/><col/> | |
| 777 <tr> | |
| 778 <th>Description</th> | |
| 779 <th>Max score</th> | |
| 780 <th>Total score</th> | |
| 781 <th>Query cover</th> | |
| 782 <th>E value</th> | |
| 783 <th>Ident</th> | |
| 784 <th>Accession</th> | |
| 785 </tr> | |
| 786 <tr> | |
| 59 | 787 <td><div><a href="#hit3-1" |
| 32 | 788 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 789 id="description3-1"> |
| 32 | 790 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 791 </a></div></td> | |
| 792 <td>37.4</td> | |
| 793 <td>37.4</td> | |
| 794 <td>100%</td> | |
| 795 <td>7.011e-08</td> | |
| 796 <td>100%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
797 <td><a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> |
| 32 | 798 </tr> |
| 799 </table> | |
| 800 | |
| 801 </div></div> | |
| 802 </section> | |
| 803 | |
| 804 | |
| 805 | |
| 806 <section class=alignments> | |
| 807 <h2>Alignments</h2> | |
| 808 | |
| 809 <div class=grey><div class=white> | |
| 59 | 810 <div class=alignment id=hit3-1> |
| 32 | 811 |
| 812 <div class=linkheader> | |
| 59 | 813 <div class=right><a href="#description3-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
814 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> |
| 32 | 815 </div> |
| 816 | |
| 817 <div class=title> | |
| 818 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 819 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
820 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> |
| 32 | 821 <span class=b>Length:</span> 323 |
| 822 <span class=b>Number of Matches:</span> 1 | |
| 823 </p> | |
| 824 </div> | |
| 825 | |
| 826 | |
| 59 | 827 <div class=hotspot id=hotspot3-1-1> |
| 32 | 828 <p class=range> |
| 829 <span class=range>Range 1: 200 to 219</span> | |
| 830 </p> | |
| 831 | |
| 832 <table class=hotspotstable> | |
| 833 <tr> | |
| 834 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 835 </tr> | |
| 836 <tr> | |
| 837 <td>37.4 bits(40)</td> | |
| 838 <td>0.0</td> | |
| 839 <td>20/20(100%)</td> | |
| 840 <td>0/20(0%)</td> | |
| 841 <td>Plus/Plus</td> | |
| 842 </tr> | |
| 843 </table> | |
| 844 | |
| 845 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 846 |||||||||||||||||||| | |
| 847 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 848 </div> | |
| 849 | |
| 850 </div> | |
| 851 | |
| 852 </div></div> | |
| 853 </section> | |
| 854 </section> | |
| 855 | |
| 856 <section class=match id=match4> | |
| 857 | |
| 858 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 859 | |
| 860 <section class=header> | |
| 861 | |
| 862 <table class=headerdata> | |
| 863 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 864 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 865 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 866 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 867 <tr><td class=param>Database:</td><td></td></tr> | |
| 868 </table> | |
| 869 | |
| 870 </section> | |
| 871 | |
| 872 <section> | |
| 873 <h2>No Hits</h2> | |
| 874 <div class=grey> | |
| 875 <table class=headerdata> | |
| 876 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 877 </table> | |
| 878 </div> | |
| 879 </section> | |
| 880 </section> | |
| 881 | |
| 882 <section class=match id=match5> | |
| 883 | |
| 884 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 885 | |
| 886 <section class=header> | |
| 887 | |
| 888 <table class=headerdata> | |
| 889 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 890 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 891 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 892 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 893 <tr><td class=param>Database:</td><td></td></tr> | |
| 894 </table> | |
| 895 | |
| 896 </section> | |
| 897 | |
| 898 <section> | |
| 899 <h2>No Hits</h2> | |
| 900 <div class=grey> | |
| 901 <table class=headerdata> | |
| 902 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 903 </table> | |
| 904 </div> | |
| 905 </section> | |
| 906 </section> | |
| 907 | |
| 908 <section class=match id=match6> | |
| 909 | |
| 910 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 911 | |
| 912 <section class=header> | |
| 913 | |
| 914 <table class=headerdata> | |
| 915 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 916 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 917 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 918 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 919 <tr><td class=param>Database:</td><td></td></tr> | |
| 920 </table> | |
| 921 | |
| 922 </section> | |
| 923 | |
| 924 | |
| 925 <section class=graphics> | |
| 926 <h2>Graphic Summary</h2> | |
| 927 | |
| 928 <div class=grey> | |
| 929 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 930 | |
| 931 <div class=defline id=defline6> | |
| 932 Mouse-over to show defline and scores, click to show alignments | |
| 933 </div> | |
| 934 | |
| 935 <div class=graphic> | |
| 936 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 937 <div class=legend><div class=graphicrow> | |
| 938 <div class=graphicitem style="background-color: black"><40</div> | |
| 939 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 940 <div class=graphicitem style="background-color: green">50–80</div> | |
| 941 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 942 <div class=graphicitem style="background-color: red">200≤</div> | |
| 943 </div></div> | |
| 944 <div style="clear: left"></div> | |
| 945 | |
| 946 <div class=tablewrapper> | |
| 947 | |
| 948 <div class=scale> | |
| 949 <div>query:</div> | |
| 950 <div class=graphicrow> | |
| 951 <div> | |
| 77 | 952 <div class=graphicitem style="width: 10%"> |
| 32 | 953 <div>2</div> |
| 954 </div> | |
| 77 | 955 <div class=graphicitem style="width: 10%"> |
| 32 | 956 <div>4</div> |
| 957 </div> | |
| 77 | 958 <div class=graphicitem style="width: 10%"> |
| 32 | 959 <div>6</div> |
| 960 </div> | |
| 77 | 961 <div class=graphicitem style="width: 10%"> |
| 32 | 962 <div>8</div> |
| 963 </div> | |
| 77 | 964 <div class=graphicitem style="width: 10%"> |
| 32 | 965 <div>10</div> |
| 966 </div> | |
| 77 | 967 <div class=graphicitem style="width: 10%"> |
| 32 | 968 <div>12</div> |
| 969 </div> | |
| 77 | 970 <div class=graphicitem style="width: 10%"> |
| 32 | 971 <div>14</div> |
| 972 </div> | |
| 77 | 973 <div class=graphicitem style="width: 10%"> |
| 32 | 974 <div>16</div> |
| 975 </div> | |
| 77 | 976 <div class=graphicitem style="width: 10%"> |
| 32 | 977 <div>18</div> |
| 978 </div> | |
| 77 | 979 <div class=graphicitem style="width: 10%"> |
| 32 | 980 <div>20</div> |
| 981 </div> | |
| 982 </div> | |
| 983 </div> | |
| 984 <div style="clear: left"></div> | |
| 985 </div> | |
| 986 | |
| 987 <a class=matchresult | |
| 59 | 988 href="#hit6-1" |
| 32 | 989 onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 990 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 991 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 992 <div class="matchrow graphicrow"> | |
| 993 <div class="matchitem graphicitem" | |
| 77 | 994 style="background-color: black; width: 100%"></div> |
| 32 | 995 </div> |
| 996 </a> | |
| 997 | |
| 998 </div> | |
| 999 </div> | |
| 1000 </div> | |
| 1001 </section> | |
| 1002 | |
| 1003 | |
| 1004 | |
| 1005 <section class=descriptions> | |
| 1006 <h2>Descriptions</h2> | |
| 1007 | |
| 1008 <div class=grey><div class=white> | |
| 1009 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1010 | |
| 1011 <table class=descriptiontable> | |
| 1012 <col/><col/><col/><col/><col/><col/><col/> | |
| 1013 <tr> | |
| 1014 <th>Description</th> | |
| 1015 <th>Max score</th> | |
| 1016 <th>Total score</th> | |
| 1017 <th>Query cover</th> | |
| 1018 <th>E value</th> | |
| 1019 <th>Ident</th> | |
| 1020 <th>Accession</th> | |
| 1021 </tr> | |
| 1022 <tr> | |
| 59 | 1023 <td><div><a href="#hit6-1" |
| 32 | 1024 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 1025 id="description6-1"> |
| 32 | 1026 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 1027 </a></div></td> | |
| 1028 <td>37.4</td> | |
| 1029 <td>37.4</td> | |
| 1030 <td>100%</td> | |
| 1031 <td>7.011e-08</td> | |
| 1032 <td>100%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1033 <td><a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> |
| 32 | 1034 </tr> |
| 1035 </table> | |
| 1036 | |
| 1037 </div></div> | |
| 1038 </section> | |
| 1039 | |
| 1040 | |
| 1041 | |
| 1042 <section class=alignments> | |
| 1043 <h2>Alignments</h2> | |
| 1044 | |
| 1045 <div class=grey><div class=white> | |
| 59 | 1046 <div class=alignment id=hit6-1> |
| 32 | 1047 |
| 1048 <div class=linkheader> | |
| 59 | 1049 <div class=right><a href="#description6-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1050 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> |
| 32 | 1051 </div> |
| 1052 | |
| 1053 <div class=title> | |
| 1054 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1055 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1056 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> |
| 32 | 1057 <span class=b>Length:</span> 2457 |
| 1058 <span class=b>Number of Matches:</span> 1 | |
| 1059 </p> | |
| 1060 </div> | |
| 1061 | |
| 1062 | |
| 59 | 1063 <div class=hotspot id=hotspot6-1-1> |
| 32 | 1064 <p class=range> |
| 1065 <span class=range>Range 1: 2119 to 2138</span> | |
| 1066 </p> | |
| 1067 | |
| 1068 <table class=hotspotstable> | |
| 1069 <tr> | |
| 1070 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1071 </tr> | |
| 1072 <tr> | |
| 1073 <td>37.4 bits(40)</td> | |
| 1074 <td>0.0</td> | |
| 1075 <td>20/20(100%)</td> | |
| 1076 <td>0/20(0%)</td> | |
| 1077 <td>Plus/Plus</td> | |
| 1078 </tr> | |
| 1079 </table> | |
| 1080 | |
| 1081 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 1082 |||||||||||||||||||| | |
| 1083 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 1084 </div> | |
| 1085 | |
| 1086 </div> | |
| 1087 | |
| 1088 </div></div> | |
| 1089 </section> | |
| 1090 </section> | |
| 1091 | |
| 1092 <section class=match id=match7> | |
| 1093 | |
| 1094 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1095 | |
| 1096 <section class=header> | |
| 1097 | |
| 1098 <table class=headerdata> | |
| 1099 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1100 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1101 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1102 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1103 <tr><td class=param>Database:</td><td></td></tr> | |
| 1104 </table> | |
| 1105 | |
| 1106 </section> | |
| 1107 | |
| 1108 <section> | |
| 1109 <h2>No Hits</h2> | |
| 1110 <div class=grey> | |
| 1111 <table class=headerdata> | |
| 1112 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1113 </table> | |
| 1114 </div> | |
| 1115 </section> | |
| 1116 </section> | |
| 1117 | |
| 1118 <section class=match id=match8> | |
| 1119 | |
| 1120 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1121 | |
| 1122 <section class=header> | |
| 1123 | |
| 1124 <table class=headerdata> | |
| 1125 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1126 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1127 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1128 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1129 <tr><td class=param>Database:</td><td></td></tr> | |
| 1130 </table> | |
| 1131 | |
| 1132 </section> | |
| 1133 | |
| 1134 <section> | |
| 1135 <h2>No Hits</h2> | |
| 1136 <div class=grey> | |
| 1137 <table class=headerdata> | |
| 1138 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1139 </table> | |
| 1140 </div> | |
| 1141 </section> | |
| 1142 </section> | |
| 1143 | |
| 1144 <section class=match id=match9> | |
| 1145 | |
| 1146 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1147 | |
| 1148 <section class=header> | |
| 1149 | |
| 1150 <table class=headerdata> | |
| 1151 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1152 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1153 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1154 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1155 <tr><td class=param>Database:</td><td></td></tr> | |
| 1156 </table> | |
| 1157 | |
| 1158 </section> | |
| 1159 | |
| 1160 <section> | |
| 1161 <h2>No Hits</h2> | |
| 1162 <div class=grey> | |
| 1163 <table class=headerdata> | |
| 1164 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1165 </table> | |
| 1166 </div> | |
| 1167 </section> | |
| 1168 </section> | |
| 1169 | |
| 1170 <section class=match id=match10> | |
| 1171 | |
| 1172 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1173 | |
| 1174 <section class=header> | |
| 1175 | |
| 1176 <table class=headerdata> | |
| 1177 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1178 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1179 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1180 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1181 <tr><td class=param>Database:</td><td></td></tr> | |
| 1182 </table> | |
| 1183 | |
| 1184 </section> | |
| 1185 | |
| 1186 <section> | |
| 1187 <h2>No Hits</h2> | |
| 1188 <div class=grey> | |
| 1189 <table class=headerdata> | |
| 1190 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1191 </table> | |
| 1192 </div> | |
| 1193 </section> | |
| 1194 </section> | |
| 1195 | |
| 1196 <section class=match id=match11> | |
| 1197 | |
| 1198 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1199 | |
| 1200 <section class=header> | |
| 1201 | |
| 1202 <table class=headerdata> | |
| 1203 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1204 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1205 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1206 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1207 <tr><td class=param>Database:</td><td></td></tr> | |
| 1208 </table> | |
| 1209 | |
| 1210 </section> | |
| 1211 | |
| 1212 <section> | |
| 1213 <h2>No Hits</h2> | |
| 1214 <div class=grey> | |
| 1215 <table class=headerdata> | |
| 1216 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1217 </table> | |
| 1218 </div> | |
| 1219 </section> | |
| 1220 </section> | |
| 1221 | |
| 1222 <section class=match id=match12> | |
| 1223 | |
| 1224 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1225 | |
| 1226 <section class=header> | |
| 1227 | |
| 1228 <table class=headerdata> | |
| 1229 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1230 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1231 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1232 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1233 <tr><td class=param>Database:</td><td></td></tr> | |
| 1234 </table> | |
| 1235 | |
| 1236 </section> | |
| 1237 | |
| 1238 <section> | |
| 1239 <h2>No Hits</h2> | |
| 1240 <div class=grey> | |
| 1241 <table class=headerdata> | |
| 1242 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1243 </table> | |
| 1244 </div> | |
| 1245 </section> | |
| 1246 </section> | |
| 1247 | |
| 1248 <section class=match id=match13> | |
| 1249 | |
| 1250 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1251 | |
| 1252 <section class=header> | |
| 1253 | |
| 1254 <table class=headerdata> | |
| 1255 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1256 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1257 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1258 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1259 <tr><td class=param>Database:</td><td></td></tr> | |
| 1260 </table> | |
| 1261 | |
| 1262 </section> | |
| 1263 | |
| 1264 <section> | |
| 1265 <h2>No Hits</h2> | |
| 1266 <div class=grey> | |
| 1267 <table class=headerdata> | |
| 1268 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1269 </table> | |
| 1270 </div> | |
| 1271 </section> | |
| 1272 </section> | |
| 1273 | |
| 1274 <section class=match id=match14> | |
| 1275 | |
| 1276 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1277 | |
| 1278 <section class=header> | |
| 1279 | |
| 1280 <table class=headerdata> | |
| 1281 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1282 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1283 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1284 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1285 <tr><td class=param>Database:</td><td></td></tr> | |
| 1286 </table> | |
| 1287 | |
| 1288 </section> | |
| 1289 | |
| 1290 <section> | |
| 1291 <h2>No Hits</h2> | |
| 1292 <div class=grey> | |
| 1293 <table class=headerdata> | |
| 1294 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1295 </table> | |
| 1296 </div> | |
| 1297 </section> | |
| 1298 </section> | |
| 1299 | |
| 1300 <section class=match id=match15> | |
| 1301 | |
| 1302 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1303 | |
| 1304 <section class=header> | |
| 1305 | |
| 1306 <table class=headerdata> | |
| 1307 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1308 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1309 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1310 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1311 <tr><td class=param>Database:</td><td></td></tr> | |
| 1312 </table> | |
| 1313 | |
| 1314 </section> | |
| 1315 | |
| 1316 <section> | |
| 1317 <h2>No Hits</h2> | |
| 1318 <div class=grey> | |
| 1319 <table class=headerdata> | |
| 1320 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1321 </table> | |
| 1322 </div> | |
| 1323 </section> | |
| 1324 </section> | |
| 1325 | |
| 1326 <section class=match id=match16> | |
| 1327 | |
| 1328 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1329 | |
| 1330 <section class=header> | |
| 1331 | |
| 1332 <table class=headerdata> | |
| 1333 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1334 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1335 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1336 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1337 <tr><td class=param>Database:</td><td></td></tr> | |
| 1338 </table> | |
| 1339 | |
| 1340 </section> | |
| 1341 | |
| 1342 <section> | |
| 1343 <h2>No Hits</h2> | |
| 1344 <div class=grey> | |
| 1345 <table class=headerdata> | |
| 1346 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1347 </table> | |
| 1348 </div> | |
| 1349 </section> | |
| 1350 </section> | |
| 1351 | |
| 1352 <section class=match id=match17> | |
| 1353 | |
| 1354 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1355 | |
| 1356 <section class=header> | |
| 1357 | |
| 1358 <table class=headerdata> | |
| 1359 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1360 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1361 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1362 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1363 <tr><td class=param>Database:</td><td></td></tr> | |
| 1364 </table> | |
| 1365 | |
| 1366 </section> | |
| 1367 | |
| 1368 <section> | |
| 1369 <h2>No Hits</h2> | |
| 1370 <div class=grey> | |
| 1371 <table class=headerdata> | |
| 1372 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1373 </table> | |
| 1374 </div> | |
| 1375 </section> | |
| 1376 </section> | |
| 1377 | |
| 1378 <section class=match id=match18> | |
| 1379 | |
| 1380 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1381 | |
| 1382 <section class=header> | |
| 1383 | |
| 1384 <table class=headerdata> | |
| 1385 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1386 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1387 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1388 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1389 <tr><td class=param>Database:</td><td></td></tr> | |
| 1390 </table> | |
| 1391 | |
| 1392 </section> | |
| 1393 | |
| 1394 | |
| 1395 <section class=graphics> | |
| 1396 <h2>Graphic Summary</h2> | |
| 1397 | |
| 1398 <div class=grey> | |
| 1399 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1400 | |
| 1401 <div class=defline id=defline18> | |
| 1402 Mouse-over to show defline and scores, click to show alignments | |
| 1403 </div> | |
| 1404 | |
| 1405 <div class=graphic> | |
| 1406 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1407 <div class=legend><div class=graphicrow> | |
| 1408 <div class=graphicitem style="background-color: black"><40</div> | |
| 1409 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1410 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1411 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1412 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1413 </div></div> | |
| 1414 <div style="clear: left"></div> | |
| 1415 | |
| 1416 <div class=tablewrapper> | |
| 1417 | |
| 1418 <div class=scale> | |
| 1419 <div>query:</div> | |
| 1420 <div class=graphicrow> | |
| 1421 <div> | |
| 77 | 1422 <div class=graphicitem style="width: 10%"> |
| 32 | 1423 <div>2</div> |
| 1424 </div> | |
| 77 | 1425 <div class=graphicitem style="width: 10%"> |
| 32 | 1426 <div>4</div> |
| 1427 </div> | |
| 77 | 1428 <div class=graphicitem style="width: 10%"> |
| 32 | 1429 <div>6</div> |
| 1430 </div> | |
| 77 | 1431 <div class=graphicitem style="width: 10%"> |
| 32 | 1432 <div>8</div> |
| 1433 </div> | |
| 77 | 1434 <div class=graphicitem style="width: 10%"> |
| 32 | 1435 <div>10</div> |
| 1436 </div> | |
| 77 | 1437 <div class=graphicitem style="width: 10%"> |
| 32 | 1438 <div>12</div> |
| 1439 </div> | |
| 77 | 1440 <div class=graphicitem style="width: 10%"> |
| 32 | 1441 <div>14</div> |
| 1442 </div> | |
| 77 | 1443 <div class=graphicitem style="width: 10%"> |
| 32 | 1444 <div>16</div> |
| 1445 </div> | |
| 77 | 1446 <div class=graphicitem style="width: 10%"> |
| 32 | 1447 <div>18</div> |
| 1448 </div> | |
| 77 | 1449 <div class=graphicitem style="width: 10%"> |
| 32 | 1450 <div>20</div> |
| 1451 </div> | |
| 1452 </div> | |
| 1453 </div> | |
| 1454 <div style="clear: left"></div> | |
| 1455 </div> | |
| 1456 | |
| 1457 <a class=matchresult | |
| 59 | 1458 href="#hit18-1" |
| 32 | 1459 onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
| 1460 onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1461 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 1462 <div class="matchrow graphicrow"> | |
| 1463 <div class="matchitem graphicitem" | |
| 77 | 1464 style="background-color: transparent; width: 15%"></div> |
| 32 | 1465 <div class="matchitem graphicitem" |
| 77 | 1466 style="background-color: black; width: 85%"></div> |
| 32 | 1467 </div> |
| 1468 </a> | |
| 1469 | |
| 1470 </div> | |
| 1471 </div> | |
| 1472 </div> | |
| 1473 </section> | |
| 1474 | |
| 1475 | |
| 1476 | |
| 1477 <section class=descriptions> | |
| 1478 <h2>Descriptions</h2> | |
| 1479 | |
| 1480 <div class=grey><div class=white> | |
| 1481 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1482 | |
| 1483 <table class=descriptiontable> | |
| 1484 <col/><col/><col/><col/><col/><col/><col/> | |
| 1485 <tr> | |
| 1486 <th>Description</th> | |
| 1487 <th>Max score</th> | |
| 1488 <th>Total score</th> | |
| 1489 <th>Query cover</th> | |
| 1490 <th>E value</th> | |
| 1491 <th>Ident</th> | |
| 1492 <th>Accession</th> | |
| 1493 </tr> | |
| 1494 <tr> | |
| 59 | 1495 <td><div><a href="#hit18-1" |
| 32 | 1496 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
| 59 | 1497 id="description18-1"> |
| 32 | 1498 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
| 1499 </a></div></td> | |
| 1500 <td>31.9</td> | |
| 1501 <td>31.9</td> | |
| 1502 <td>85%</td> | |
| 1503 <td>2.981e-06</td> | |
| 1504 <td>100%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1505 <td><a href="http://example.com/example-genebank?id=Subject_2">Subject_2</a></td> |
| 32 | 1506 </tr> |
| 1507 </table> | |
| 1508 | |
| 1509 </div></div> | |
| 1510 </section> | |
| 1511 | |
| 1512 | |
| 1513 | |
| 1514 <section class=alignments> | |
| 1515 <h2>Alignments</h2> | |
| 1516 | |
| 1517 <div class=grey><div class=white> | |
| 59 | 1518 <div class=alignment id=hit18-1> |
| 32 | 1519 |
| 1520 <div class=linkheader> | |
| 59 | 1521 <div class=right><a href="#description18-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1522 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_2">Gene Bank</a> |
| 32 | 1523 </div> |
| 1524 | |
| 1525 <div class=title> | |
| 1526 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 1527 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1528 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_2">Subject_2</a> |
| 32 | 1529 <span class=b>Length:</span> 1045 |
| 1530 <span class=b>Number of Matches:</span> 1 | |
| 1531 </p> | |
| 1532 </div> | |
| 1533 | |
| 1534 | |
| 59 | 1535 <div class=hotspot id=hotspot18-1-1> |
| 32 | 1536 <p class=range> |
| 1537 <span class=range>Range 1: 2 to 18</span> | |
| 1538 </p> | |
| 1539 | |
| 1540 <table class=hotspotstable> | |
| 1541 <tr> | |
| 1542 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1543 </tr> | |
| 1544 <tr> | |
| 1545 <td>31.9 bits(34)</td> | |
| 1546 <td>0.0</td> | |
| 1547 <td>17/17(100%)</td> | |
| 1548 <td>0/17(0%)</td> | |
| 1549 <td>Plus/Plus</td> | |
| 1550 </tr> | |
| 1551 </table> | |
| 1552 | |
| 1553 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1554 ||||||||||||||||| | |
| 1555 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1556 </div> | |
| 1557 | |
| 1558 </div> | |
| 1559 | |
| 1560 </div></div> | |
| 1561 </section> | |
| 1562 </section> | |
| 1563 | |
| 1564 <section class=match id=match19> | |
| 1565 | |
| 1566 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1567 | |
| 1568 <section class=header> | |
| 1569 | |
| 1570 <table class=headerdata> | |
| 1571 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1572 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1573 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1574 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1575 <tr><td class=param>Database:</td><td></td></tr> | |
| 1576 </table> | |
| 1577 | |
| 1578 </section> | |
| 1579 | |
| 1580 | |
| 1581 <section class=graphics> | |
| 1582 <h2>Graphic Summary</h2> | |
| 1583 | |
| 1584 <div class=grey> | |
| 1585 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1586 | |
| 1587 <div class=defline id=defline19> | |
| 1588 Mouse-over to show defline and scores, click to show alignments | |
| 1589 </div> | |
| 1590 | |
| 1591 <div class=graphic> | |
| 1592 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1593 <div class=legend><div class=graphicrow> | |
| 1594 <div class=graphicitem style="background-color: black"><40</div> | |
| 1595 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1596 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1597 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1598 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1599 </div></div> | |
| 1600 <div style="clear: left"></div> | |
| 1601 | |
| 1602 <div class=tablewrapper> | |
| 1603 | |
| 1604 <div class=scale> | |
| 1605 <div>query:</div> | |
| 1606 <div class=graphicrow> | |
| 1607 <div> | |
| 77 | 1608 <div class=graphicitem style="width: 10%"> |
| 32 | 1609 <div>2</div> |
| 1610 </div> | |
| 77 | 1611 <div class=graphicitem style="width: 10%"> |
| 32 | 1612 <div>4</div> |
| 1613 </div> | |
| 77 | 1614 <div class=graphicitem style="width: 10%"> |
| 32 | 1615 <div>6</div> |
| 1616 </div> | |
| 77 | 1617 <div class=graphicitem style="width: 10%"> |
| 32 | 1618 <div>8</div> |
| 1619 </div> | |
| 77 | 1620 <div class=graphicitem style="width: 10%"> |
| 32 | 1621 <div>10</div> |
| 1622 </div> | |
| 77 | 1623 <div class=graphicitem style="width: 10%"> |
| 32 | 1624 <div>12</div> |
| 1625 </div> | |
| 77 | 1626 <div class=graphicitem style="width: 10%"> |
| 32 | 1627 <div>14</div> |
| 1628 </div> | |
| 77 | 1629 <div class=graphicitem style="width: 10%"> |
| 32 | 1630 <div>16</div> |
| 1631 </div> | |
| 77 | 1632 <div class=graphicitem style="width: 10%"> |
| 32 | 1633 <div>18</div> |
| 1634 </div> | |
| 77 | 1635 <div class=graphicitem style="width: 10%"> |
| 32 | 1636 <div>20</div> |
| 1637 </div> | |
| 1638 </div> | |
| 1639 </div> | |
| 1640 <div style="clear: left"></div> | |
| 1641 </div> | |
| 1642 | |
| 1643 <a class=matchresult | |
| 59 | 1644 href="#hit19-1" |
| 32 | 1645 onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 1646 onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1647 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 1648 <div class="matchrow graphicrow"> | |
| 1649 <div class="matchitem graphicitem" | |
| 77 | 1650 style="background-color: black; width: 100%"></div> |
| 32 | 1651 </div> |
| 1652 </a> | |
| 1653 | |
| 1654 </div> | |
| 1655 </div> | |
| 1656 </div> | |
| 1657 </section> | |
| 1658 | |
| 1659 | |
| 1660 | |
| 1661 <section class=descriptions> | |
| 1662 <h2>Descriptions</h2> | |
| 1663 | |
| 1664 <div class=grey><div class=white> | |
| 1665 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1666 | |
| 1667 <table class=descriptiontable> | |
| 1668 <col/><col/><col/><col/><col/><col/><col/> | |
| 1669 <tr> | |
| 1670 <th>Description</th> | |
| 1671 <th>Max score</th> | |
| 1672 <th>Total score</th> | |
| 1673 <th>Query cover</th> | |
| 1674 <th>E value</th> | |
| 1675 <th>Ident</th> | |
| 1676 <th>Accession</th> | |
| 1677 </tr> | |
| 1678 <tr> | |
| 59 | 1679 <td><div><a href="#hit19-1" |
| 32 | 1680 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 1681 id="description19-1"> |
| 32 | 1682 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 1683 </a></div></td> | |
| 1684 <td>37.4</td> | |
| 1685 <td>37.4</td> | |
| 1686 <td>100%</td> | |
| 1687 <td>7.011e-08</td> | |
| 1688 <td>100%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1689 <td><a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> |
| 32 | 1690 </tr> |
| 1691 </table> | |
| 1692 | |
| 1693 </div></div> | |
| 1694 </section> | |
| 1695 | |
| 1696 | |
| 1697 | |
| 1698 <section class=alignments> | |
| 1699 <h2>Alignments</h2> | |
| 1700 | |
| 1701 <div class=grey><div class=white> | |
| 59 | 1702 <div class=alignment id=hit19-1> |
| 32 | 1703 |
| 1704 <div class=linkheader> | |
| 59 | 1705 <div class=right><a href="#description19-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1706 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> |
| 32 | 1707 </div> |
| 1708 | |
| 1709 <div class=title> | |
| 1710 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 1711 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1712 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> |
| 32 | 1713 <span class=b>Length:</span> 323 |
| 1714 <span class=b>Number of Matches:</span> 1 | |
| 1715 </p> | |
| 1716 </div> | |
| 1717 | |
| 1718 | |
| 59 | 1719 <div class=hotspot id=hotspot19-1-1> |
| 32 | 1720 <p class=range> |
| 1721 <span class=range>Range 1: 224 to 243</span> | |
| 1722 </p> | |
| 1723 | |
| 1724 <table class=hotspotstable> | |
| 1725 <tr> | |
| 1726 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1727 </tr> | |
| 1728 <tr> | |
| 1729 <td>37.4 bits(40)</td> | |
| 1730 <td>0.0</td> | |
| 1731 <td>20/20(100%)</td> | |
| 1732 <td>0/20(0%)</td> | |
| 1733 <td>Plus/Plus</td> | |
| 1734 </tr> | |
| 1735 </table> | |
| 1736 | |
| 1737 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1738 |||||||||||||||||||| | |
| 1739 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 1740 </div> | |
| 1741 | |
| 1742 </div> | |
| 1743 | |
| 1744 </div></div> | |
| 1745 </section> | |
| 1746 </section> | |
| 1747 | |
| 1748 <section class=match id=match20> | |
| 1749 | |
| 1750 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1751 | |
| 1752 <section class=header> | |
| 1753 | |
| 1754 <table class=headerdata> | |
| 1755 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1756 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1757 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1758 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1759 <tr><td class=param>Database:</td><td></td></tr> | |
| 1760 </table> | |
| 1761 | |
| 1762 </section> | |
| 1763 | |
| 1764 <section> | |
| 1765 <h2>No Hits</h2> | |
| 1766 <div class=grey> | |
| 1767 <table class=headerdata> | |
| 1768 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1769 </table> | |
| 1770 </div> | |
| 1771 </section> | |
| 1772 </section> | |
| 1773 | |
| 1774 <section class=match id=match21> | |
| 1775 | |
| 1776 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1777 | |
| 1778 <section class=header> | |
| 1779 | |
| 1780 <table class=headerdata> | |
| 1781 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1782 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1783 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1784 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1785 <tr><td class=param>Database:</td><td></td></tr> | |
| 1786 </table> | |
| 1787 | |
| 1788 </section> | |
| 1789 | |
| 1790 <section> | |
| 1791 <h2>No Hits</h2> | |
| 1792 <div class=grey> | |
| 1793 <table class=headerdata> | |
| 1794 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1795 </table> | |
| 1796 </div> | |
| 1797 </section> | |
| 1798 </section> | |
| 1799 | |
| 1800 <section class=match id=match22> | |
| 1801 | |
| 1802 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1803 | |
| 1804 <section class=header> | |
| 1805 | |
| 1806 <table class=headerdata> | |
| 1807 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1808 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1809 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1810 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1811 <tr><td class=param>Database:</td><td></td></tr> | |
| 1812 </table> | |
| 1813 | |
| 1814 </section> | |
| 1815 | |
| 1816 | |
| 1817 <section class=graphics> | |
| 1818 <h2>Graphic Summary</h2> | |
| 1819 | |
| 1820 <div class=grey> | |
| 1821 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 1822 | |
| 1823 <div class=defline id=defline22> | |
| 1824 Mouse-over to show defline and scores, click to show alignments | |
| 1825 </div> | |
| 1826 | |
| 1827 <div class=graphic> | |
| 1828 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1829 <div class=legend><div class=graphicrow> | |
| 1830 <div class=graphicitem style="background-color: black"><40</div> | |
| 1831 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1832 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1833 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1834 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1835 </div></div> | |
| 1836 <div style="clear: left"></div> | |
| 1837 | |
| 1838 <div class=tablewrapper> | |
| 1839 | |
| 1840 <div class=scale> | |
| 1841 <div>query:</div> | |
| 1842 <div class=graphicrow> | |
| 1843 <div> | |
| 77 | 1844 <div class=graphicitem style="width: 10%"> |
| 32 | 1845 <div>2</div> |
| 1846 </div> | |
| 77 | 1847 <div class=graphicitem style="width: 10%"> |
| 32 | 1848 <div>4</div> |
| 1849 </div> | |
| 77 | 1850 <div class=graphicitem style="width: 10%"> |
| 32 | 1851 <div>6</div> |
| 1852 </div> | |
| 77 | 1853 <div class=graphicitem style="width: 10%"> |
| 32 | 1854 <div>8</div> |
| 1855 </div> | |
| 77 | 1856 <div class=graphicitem style="width: 10%"> |
| 32 | 1857 <div>10</div> |
| 1858 </div> | |
| 77 | 1859 <div class=graphicitem style="width: 10%"> |
| 32 | 1860 <div>12</div> |
| 1861 </div> | |
| 77 | 1862 <div class=graphicitem style="width: 10%"> |
| 32 | 1863 <div>14</div> |
| 1864 </div> | |
| 77 | 1865 <div class=graphicitem style="width: 10%"> |
| 32 | 1866 <div>16</div> |
| 1867 </div> | |
| 77 | 1868 <div class=graphicitem style="width: 10%"> |
| 32 | 1869 <div>18</div> |
| 1870 </div> | |
| 77 | 1871 <div class=graphicitem style="width: 10%"> |
| 32 | 1872 <div>20</div> |
| 1873 </div> | |
| 1874 </div> | |
| 1875 </div> | |
| 1876 <div style="clear: left"></div> | |
| 1877 </div> | |
| 1878 | |
| 1879 <a class=matchresult | |
| 59 | 1880 href="#hit22-1" |
| 32 | 1881 onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 1882 onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1883 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1884 <div class="matchrow graphicrow"> | |
| 1885 <div class="matchitem graphicitem" | |
| 77 | 1886 style="background-color: black; width: 100%"></div> |
| 32 | 1887 </div> |
| 1888 </a> | |
| 1889 | |
| 1890 </div> | |
| 1891 </div> | |
| 1892 </div> | |
| 1893 </section> | |
| 1894 | |
| 1895 | |
| 1896 | |
| 1897 <section class=descriptions> | |
| 1898 <h2>Descriptions</h2> | |
| 1899 | |
| 1900 <div class=grey><div class=white> | |
| 1901 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1902 | |
| 1903 <table class=descriptiontable> | |
| 1904 <col/><col/><col/><col/><col/><col/><col/> | |
| 1905 <tr> | |
| 1906 <th>Description</th> | |
| 1907 <th>Max score</th> | |
| 1908 <th>Total score</th> | |
| 1909 <th>Query cover</th> | |
| 1910 <th>E value</th> | |
| 1911 <th>Ident</th> | |
| 1912 <th>Accession</th> | |
| 1913 </tr> | |
| 1914 <tr> | |
| 59 | 1915 <td><div><a href="#hit22-1" |
| 32 | 1916 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 1917 id="description22-1"> |
| 32 | 1918 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 1919 </a></div></td> | |
| 1920 <td>37.4</td> | |
| 1921 <td>37.4</td> | |
| 1922 <td>100%</td> | |
| 1923 <td>7.011e-08</td> | |
| 1924 <td>100%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1925 <td><a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> |
| 32 | 1926 </tr> |
| 1927 </table> | |
| 1928 | |
| 1929 </div></div> | |
| 1930 </section> | |
| 1931 | |
| 1932 | |
| 1933 | |
| 1934 <section class=alignments> | |
| 1935 <h2>Alignments</h2> | |
| 1936 | |
| 1937 <div class=grey><div class=white> | |
| 59 | 1938 <div class=alignment id=hit22-1> |
| 32 | 1939 |
| 1940 <div class=linkheader> | |
| 59 | 1941 <div class=right><a href="#description22-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1942 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> |
| 32 | 1943 </div> |
| 1944 | |
| 1945 <div class=title> | |
| 1946 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1947 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
1948 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> |
| 32 | 1949 <span class=b>Length:</span> 2457 |
| 1950 <span class=b>Number of Matches:</span> 1 | |
| 1951 </p> | |
| 1952 </div> | |
| 1953 | |
| 1954 | |
| 59 | 1955 <div class=hotspot id=hotspot22-1-1> |
| 32 | 1956 <p class=range> |
| 1957 <span class=range>Range 1: 2143 to 2162</span> | |
| 1958 </p> | |
| 1959 | |
| 1960 <table class=hotspotstable> | |
| 1961 <tr> | |
| 1962 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1963 </tr> | |
| 1964 <tr> | |
| 1965 <td>37.4 bits(40)</td> | |
| 1966 <td>0.0</td> | |
| 1967 <td>20/20(100%)</td> | |
| 1968 <td>0/20(0%)</td> | |
| 1969 <td>Plus/Plus</td> | |
| 1970 </tr> | |
| 1971 </table> | |
| 1972 | |
| 1973 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1974 |||||||||||||||||||| | |
| 1975 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 1976 </div> | |
| 1977 | |
| 1978 </div> | |
| 1979 | |
| 1980 </div></div> | |
| 1981 </section> | |
| 1982 </section> | |
| 1983 | |
| 1984 <section class=match id=match23> | |
| 1985 | |
| 1986 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1987 | |
| 1988 <section class=header> | |
| 1989 | |
| 1990 <table class=headerdata> | |
| 1991 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1992 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1993 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1994 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1995 <tr><td class=param>Database:</td><td></td></tr> | |
| 1996 </table> | |
| 1997 | |
| 1998 </section> | |
| 1999 | |
| 2000 <section> | |
| 2001 <h2>No Hits</h2> | |
| 2002 <div class=grey> | |
| 2003 <table class=headerdata> | |
| 2004 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2005 </table> | |
| 2006 </div> | |
| 2007 </section> | |
| 2008 </section> | |
| 2009 | |
| 2010 <section class=match id=match24> | |
| 2011 | |
| 2012 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2013 | |
| 2014 <section class=header> | |
| 2015 | |
| 2016 <table class=headerdata> | |
| 2017 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2018 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2019 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2020 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2021 <tr><td class=param>Database:</td><td></td></tr> | |
| 2022 </table> | |
| 2023 | |
| 2024 </section> | |
| 2025 | |
| 2026 <section> | |
| 2027 <h2>No Hits</h2> | |
| 2028 <div class=grey> | |
| 2029 <table class=headerdata> | |
| 2030 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2031 </table> | |
| 2032 </div> | |
| 2033 </section> | |
| 2034 </section> | |
| 2035 | |
| 2036 <section class=match id=match25> | |
| 2037 | |
| 2038 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2039 | |
| 2040 <section class=header> | |
| 2041 | |
| 2042 <table class=headerdata> | |
| 2043 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2044 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2045 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2046 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2047 <tr><td class=param>Database:</td><td></td></tr> | |
| 2048 </table> | |
| 2049 | |
| 2050 </section> | |
| 2051 | |
| 2052 <section> | |
| 2053 <h2>No Hits</h2> | |
| 2054 <div class=grey> | |
| 2055 <table class=headerdata> | |
| 2056 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2057 </table> | |
| 2058 </div> | |
| 2059 </section> | |
| 2060 </section> | |
| 2061 | |
| 2062 <section class=match id=match26> | |
| 2063 | |
| 2064 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2065 | |
| 2066 <section class=header> | |
| 2067 | |
| 2068 <table class=headerdata> | |
| 2069 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2070 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2071 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2072 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2073 <tr><td class=param>Database:</td><td></td></tr> | |
| 2074 </table> | |
| 2075 | |
| 2076 </section> | |
| 2077 | |
| 2078 <section> | |
| 2079 <h2>No Hits</h2> | |
| 2080 <div class=grey> | |
| 2081 <table class=headerdata> | |
| 2082 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2083 </table> | |
| 2084 </div> | |
| 2085 </section> | |
| 2086 </section> | |
| 2087 | |
| 2088 <section class=match id=match27> | |
| 2089 | |
| 2090 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2091 | |
| 2092 <section class=header> | |
| 2093 | |
| 2094 <table class=headerdata> | |
| 2095 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2096 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2097 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2098 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2099 <tr><td class=param>Database:</td><td></td></tr> | |
| 2100 </table> | |
| 2101 | |
| 2102 </section> | |
| 2103 | |
| 2104 <section> | |
| 2105 <h2>No Hits</h2> | |
| 2106 <div class=grey> | |
| 2107 <table class=headerdata> | |
| 2108 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2109 </table> | |
| 2110 </div> | |
| 2111 </section> | |
| 2112 </section> | |
| 2113 | |
| 2114 <section class=match id=match28> | |
| 2115 | |
| 2116 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2117 | |
| 2118 <section class=header> | |
| 2119 | |
| 2120 <table class=headerdata> | |
| 2121 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2122 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2123 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2124 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2125 <tr><td class=param>Database:</td><td></td></tr> | |
| 2126 </table> | |
| 2127 | |
| 2128 </section> | |
| 2129 | |
| 2130 <section> | |
| 2131 <h2>No Hits</h2> | |
| 2132 <div class=grey> | |
| 2133 <table class=headerdata> | |
| 2134 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2135 </table> | |
| 2136 </div> | |
| 2137 </section> | |
| 2138 </section> | |
| 2139 | |
| 2140 <section class=match id=match29> | |
| 2141 | |
| 2142 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2143 | |
| 2144 <section class=header> | |
| 2145 | |
| 2146 <table class=headerdata> | |
| 2147 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2148 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2149 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2150 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2151 <tr><td class=param>Database:</td><td></td></tr> | |
| 2152 </table> | |
| 2153 | |
| 2154 </section> | |
| 2155 | |
| 2156 <section> | |
| 2157 <h2>No Hits</h2> | |
| 2158 <div class=grey> | |
| 2159 <table class=headerdata> | |
| 2160 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2161 </table> | |
| 2162 </div> | |
| 2163 </section> | |
| 2164 </section> | |
| 2165 | |
| 2166 <section class=match id=match30> | |
| 2167 | |
| 2168 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2169 | |
| 2170 <section class=header> | |
| 2171 | |
| 2172 <table class=headerdata> | |
| 2173 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2174 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2175 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2176 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2177 <tr><td class=param>Database:</td><td></td></tr> | |
| 2178 </table> | |
| 2179 | |
| 2180 </section> | |
| 2181 | |
| 2182 <section> | |
| 2183 <h2>No Hits</h2> | |
| 2184 <div class=grey> | |
| 2185 <table class=headerdata> | |
| 2186 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2187 </table> | |
| 2188 </div> | |
| 2189 </section> | |
| 2190 </section> | |
| 2191 | |
| 2192 <section class=match id=match31> | |
| 2193 | |
| 2194 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2195 | |
| 2196 <section class=header> | |
| 2197 | |
| 2198 <table class=headerdata> | |
| 2199 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2200 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2201 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2202 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2203 <tr><td class=param>Database:</td><td></td></tr> | |
| 2204 </table> | |
| 2205 | |
| 2206 </section> | |
| 2207 | |
| 2208 <section> | |
| 2209 <h2>No Hits</h2> | |
| 2210 <div class=grey> | |
| 2211 <table class=headerdata> | |
| 2212 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2213 </table> | |
| 2214 </div> | |
| 2215 </section> | |
| 2216 </section> | |
| 2217 | |
| 2218 <section class=match id=match32> | |
| 2219 | |
| 2220 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 2221 | |
| 2222 <section class=header> | |
| 2223 | |
| 2224 <table class=headerdata> | |
| 2225 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2226 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2227 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2228 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2229 <tr><td class=param>Database:</td><td></td></tr> | |
| 2230 </table> | |
| 2231 | |
| 2232 </section> | |
| 2233 | |
| 2234 <section> | |
| 2235 <h2>No Hits</h2> | |
| 2236 <div class=grey> | |
| 2237 <table class=headerdata> | |
| 2238 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2239 </table> | |
| 2240 </div> | |
| 2241 </section> | |
| 2242 </section> | |
| 2243 | |
| 2244 <section class=match id=match33> | |
| 2245 | |
| 2246 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2247 | |
| 2248 <section class=header> | |
| 2249 | |
| 2250 <table class=headerdata> | |
| 2251 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2252 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2253 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2254 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2255 <tr><td class=param>Database:</td><td></td></tr> | |
| 2256 </table> | |
| 2257 | |
| 2258 </section> | |
| 2259 | |
| 2260 <section> | |
| 2261 <h2>No Hits</h2> | |
| 2262 <div class=grey> | |
| 2263 <table class=headerdata> | |
| 2264 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2265 </table> | |
| 2266 </div> | |
| 2267 </section> | |
| 2268 </section> | |
| 2269 | |
| 2270 <section class=match id=match34> | |
| 2271 | |
| 2272 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2273 | |
| 2274 <section class=header> | |
| 2275 | |
| 2276 <table class=headerdata> | |
| 2277 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2278 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2279 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2280 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2281 <tr><td class=param>Database:</td><td></td></tr> | |
| 2282 </table> | |
| 2283 | |
| 2284 </section> | |
| 2285 | |
| 2286 <section> | |
| 2287 <h2>No Hits</h2> | |
| 2288 <div class=grey> | |
| 2289 <table class=headerdata> | |
| 2290 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2291 </table> | |
| 2292 </div> | |
| 2293 </section> | |
| 2294 </section> | |
| 2295 | |
| 2296 <section class=match id=match35> | |
| 2297 | |
| 2298 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2299 | |
| 2300 <section class=header> | |
| 2301 | |
| 2302 <table class=headerdata> | |
| 2303 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2304 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2305 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2306 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2307 <tr><td class=param>Database:</td><td></td></tr> | |
| 2308 </table> | |
| 2309 | |
| 2310 </section> | |
| 2311 | |
| 2312 <section> | |
| 2313 <h2>No Hits</h2> | |
| 2314 <div class=grey> | |
| 2315 <table class=headerdata> | |
| 2316 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2317 </table> | |
| 2318 </div> | |
| 2319 </section> | |
| 2320 </section> | |
| 2321 | |
| 2322 <section class=match id=match36> | |
| 2323 | |
| 2324 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2325 | |
| 2326 <section class=header> | |
| 2327 | |
| 2328 <table class=headerdata> | |
| 2329 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2330 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2331 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2332 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2333 <tr><td class=param>Database:</td><td></td></tr> | |
| 2334 </table> | |
| 2335 | |
| 2336 </section> | |
| 2337 | |
| 2338 <section> | |
| 2339 <h2>No Hits</h2> | |
| 2340 <div class=grey> | |
| 2341 <table class=headerdata> | |
| 2342 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2343 </table> | |
| 2344 </div> | |
| 2345 </section> | |
| 2346 </section> | |
| 2347 | |
| 2348 <section class=match id=match37> | |
| 2349 | |
| 2350 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2351 | |
| 2352 <section class=header> | |
| 2353 | |
| 2354 <table class=headerdata> | |
| 2355 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2356 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2357 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2358 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2359 <tr><td class=param>Database:</td><td></td></tr> | |
| 2360 </table> | |
| 2361 | |
| 2362 </section> | |
| 2363 | |
| 2364 <section> | |
| 2365 <h2>No Hits</h2> | |
| 2366 <div class=grey> | |
| 2367 <table class=headerdata> | |
| 2368 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2369 </table> | |
| 2370 </div> | |
| 2371 </section> | |
| 2372 </section> | |
| 2373 | |
| 2374 <section class=match id=match38> | |
| 2375 | |
| 2376 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2377 | |
| 2378 <section class=header> | |
| 2379 | |
| 2380 <table class=headerdata> | |
| 2381 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2382 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2383 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2384 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2385 <tr><td class=param>Database:</td><td></td></tr> | |
| 2386 </table> | |
| 2387 | |
| 2388 </section> | |
| 2389 | |
| 2390 <section> | |
| 2391 <h2>No Hits</h2> | |
| 2392 <div class=grey> | |
| 2393 <table class=headerdata> | |
| 2394 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2395 </table> | |
| 2396 </div> | |
| 2397 </section> | |
| 2398 </section> | |
| 2399 | |
| 2400 <section class=match id=match39> | |
| 2401 | |
| 2402 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2403 | |
| 2404 <section class=header> | |
| 2405 | |
| 2406 <table class=headerdata> | |
| 2407 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2408 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2409 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2410 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2411 <tr><td class=param>Database:</td><td></td></tr> | |
| 2412 </table> | |
| 2413 | |
| 2414 </section> | |
| 2415 | |
| 2416 <section> | |
| 2417 <h2>No Hits</h2> | |
| 2418 <div class=grey> | |
| 2419 <table class=headerdata> | |
| 2420 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2421 </table> | |
| 2422 </div> | |
| 2423 </section> | |
| 2424 </section> | |
| 2425 | |
| 2426 <section class=match id=match40> | |
| 2427 | |
| 2428 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 2429 | |
| 2430 <section class=header> | |
| 2431 | |
| 2432 <table class=headerdata> | |
| 2433 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2434 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2435 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2436 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2437 <tr><td class=param>Database:</td><td></td></tr> | |
| 2438 </table> | |
| 2439 | |
| 2440 </section> | |
| 2441 | |
| 2442 <section> | |
| 2443 <h2>No Hits</h2> | |
| 2444 <div class=grey> | |
| 2445 <table class=headerdata> | |
| 2446 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2447 </table> | |
| 2448 </div> | |
| 2449 </section> | |
| 2450 </section> | |
| 2451 | |
| 2452 <section class=match id=match41> | |
| 2453 | |
| 2454 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2455 | |
| 2456 <section class=header> | |
| 2457 | |
| 2458 <table class=headerdata> | |
| 2459 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2460 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2461 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2462 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2463 <tr><td class=param>Database:</td><td></td></tr> | |
| 2464 </table> | |
| 2465 | |
| 2466 </section> | |
| 2467 | |
| 2468 <section> | |
| 2469 <h2>No Hits</h2> | |
| 2470 <div class=grey> | |
| 2471 <table class=headerdata> | |
| 2472 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2473 </table> | |
| 2474 </div> | |
| 2475 </section> | |
| 2476 </section> | |
| 2477 | |
| 2478 <section class=match id=match42> | |
| 2479 | |
| 2480 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2481 | |
| 2482 <section class=header> | |
| 2483 | |
| 2484 <table class=headerdata> | |
| 2485 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2486 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2487 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2488 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2489 <tr><td class=param>Database:</td><td></td></tr> | |
| 2490 </table> | |
| 2491 | |
| 2492 </section> | |
| 2493 | |
| 2494 <section> | |
| 2495 <h2>No Hits</h2> | |
| 2496 <div class=grey> | |
| 2497 <table class=headerdata> | |
| 2498 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2499 </table> | |
| 2500 </div> | |
| 2501 </section> | |
| 2502 </section> | |
| 2503 | |
| 2504 <section class=match id=match43> | |
| 2505 | |
| 2506 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2507 | |
| 2508 <section class=header> | |
| 2509 | |
| 2510 <table class=headerdata> | |
| 2511 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2512 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2513 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2514 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2515 <tr><td class=param>Database:</td><td></td></tr> | |
| 2516 </table> | |
| 2517 | |
| 2518 </section> | |
| 2519 | |
| 2520 <section> | |
| 2521 <h2>No Hits</h2> | |
| 2522 <div class=grey> | |
| 2523 <table class=headerdata> | |
| 2524 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2525 </table> | |
| 2526 </div> | |
| 2527 </section> | |
| 2528 </section> | |
| 2529 | |
| 2530 <section class=match id=match44> | |
| 2531 | |
| 2532 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2533 | |
| 2534 <section class=header> | |
| 2535 | |
| 2536 <table class=headerdata> | |
| 2537 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2538 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2539 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2540 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2541 <tr><td class=param>Database:</td><td></td></tr> | |
| 2542 </table> | |
| 2543 | |
| 2544 </section> | |
| 2545 | |
| 2546 <section> | |
| 2547 <h2>No Hits</h2> | |
| 2548 <div class=grey> | |
| 2549 <table class=headerdata> | |
| 2550 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2551 </table> | |
| 2552 </div> | |
| 2553 </section> | |
| 2554 </section> | |
| 2555 | |
| 2556 <section class=match id=match45> | |
| 2557 | |
| 2558 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2559 | |
| 2560 <section class=header> | |
| 2561 | |
| 2562 <table class=headerdata> | |
| 2563 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2564 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2565 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2566 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2567 <tr><td class=param>Database:</td><td></td></tr> | |
| 2568 </table> | |
| 2569 | |
| 2570 </section> | |
| 2571 | |
| 2572 <section> | |
| 2573 <h2>No Hits</h2> | |
| 2574 <div class=grey> | |
| 2575 <table class=headerdata> | |
| 2576 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2577 </table> | |
| 2578 </div> | |
| 2579 </section> | |
| 2580 </section> | |
| 2581 | |
| 2582 <section class=match id=match46> | |
| 2583 | |
| 2584 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2585 | |
| 2586 <section class=header> | |
| 2587 | |
| 2588 <table class=headerdata> | |
| 2589 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2590 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2591 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2592 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2593 <tr><td class=param>Database:</td><td></td></tr> | |
| 2594 </table> | |
| 2595 | |
| 2596 </section> | |
| 2597 | |
| 2598 <section> | |
| 2599 <h2>No Hits</h2> | |
| 2600 <div class=grey> | |
| 2601 <table class=headerdata> | |
| 2602 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2603 </table> | |
| 2604 </div> | |
| 2605 </section> | |
| 2606 </section> | |
| 2607 | |
| 2608 <section class=match id=match47> | |
| 2609 | |
| 2610 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2611 | |
| 2612 <section class=header> | |
| 2613 | |
| 2614 <table class=headerdata> | |
| 2615 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2616 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2617 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2618 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2619 <tr><td class=param>Database:</td><td></td></tr> | |
| 2620 </table> | |
| 2621 | |
| 2622 </section> | |
| 2623 | |
| 2624 | |
| 2625 <section class=graphics> | |
| 2626 <h2>Graphic Summary</h2> | |
| 2627 | |
| 2628 <div class=grey> | |
| 2629 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 2630 | |
| 2631 <div class=defline id=defline47> | |
| 2632 Mouse-over to show defline and scores, click to show alignments | |
| 2633 </div> | |
| 2634 | |
| 2635 <div class=graphic> | |
| 2636 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 2637 <div class=legend><div class=graphicrow> | |
| 2638 <div class=graphicitem style="background-color: black"><40</div> | |
| 2639 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2640 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2641 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 2642 <div class=graphicitem style="background-color: red">200≤</div> | |
| 2643 </div></div> | |
| 2644 <div style="clear: left"></div> | |
| 2645 | |
| 2646 <div class=tablewrapper> | |
| 2647 | |
| 2648 <div class=scale> | |
| 2649 <div>query:</div> | |
| 2650 <div class=graphicrow> | |
| 2651 <div> | |
| 77 | 2652 <div class=graphicitem style="width: 12%"> |
| 32 | 2653 <div>3</div> |
| 2654 </div> | |
| 77 | 2655 <div class=graphicitem style="width: 12%"> |
| 32 | 2656 <div>6</div> |
| 2657 </div> | |
| 77 | 2658 <div class=graphicitem style="width: 12%"> |
| 32 | 2659 <div>9</div> |
| 2660 </div> | |
| 77 | 2661 <div class=graphicitem style="width: 12%"> |
| 32 | 2662 <div>12</div> |
| 2663 </div> | |
| 77 | 2664 <div class=graphicitem style="width: 12%"> |
| 32 | 2665 <div>15</div> |
| 2666 </div> | |
| 77 | 2667 <div class=graphicitem style="width: 12%"> |
| 32 | 2668 <div>18</div> |
| 2669 </div> | |
| 77 | 2670 <div class=graphicitem style="width: 12%"> |
| 32 | 2671 <div>21</div> |
| 2672 </div> | |
| 77 | 2673 <div class=graphicitem style="width: 12%"> |
| 32 | 2674 <div>24</div> |
| 2675 </div> | |
| 77 | 2676 <div class=graphicitem style="width: 4%"> |
| 32 | 2677 <div>25</div> |
| 2678 </div> | |
| 2679 </div> | |
| 2680 </div> | |
| 2681 <div style="clear: left"></div> | |
| 2682 </div> | |
| 2683 | |
| 2684 <a class=matchresult | |
| 59 | 2685 href="#hit47-1" |
| 32 | 2686 onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 2687 onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2688 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 2689 <div class="matchrow graphicrow"> | |
| 2690 <div class="matchitem graphicitem" | |
| 77 | 2691 style="background-color: black; width: 100%"></div> |
| 32 | 2692 </div> |
| 2693 </a> | |
| 2694 | |
| 2695 </div> | |
| 2696 </div> | |
| 2697 </div> | |
| 2698 </section> | |
| 2699 | |
| 2700 | |
| 2701 | |
| 2702 <section class=descriptions> | |
| 2703 <h2>Descriptions</h2> | |
| 2704 | |
| 2705 <div class=grey><div class=white> | |
| 2706 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 2707 | |
| 2708 <table class=descriptiontable> | |
| 2709 <col/><col/><col/><col/><col/><col/><col/> | |
| 2710 <tr> | |
| 2711 <th>Description</th> | |
| 2712 <th>Max score</th> | |
| 2713 <th>Total score</th> | |
| 2714 <th>Query cover</th> | |
| 2715 <th>E value</th> | |
| 2716 <th>Ident</th> | |
| 2717 <th>Accession</th> | |
| 2718 </tr> | |
| 2719 <tr> | |
| 59 | 2720 <td><div><a href="#hit47-1" |
| 32 | 2721 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 2722 id="description47-1"> |
| 32 | 2723 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 2724 </a></div></td> | |
| 2725 <td>37.4</td> | |
| 2726 <td>37.4</td> | |
| 2727 <td>100%</td> | |
| 2728 <td>9.338e-08</td> | |
| 2729 <td>92%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2730 <td><a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> |
| 32 | 2731 </tr> |
| 2732 </table> | |
| 2733 | |
| 2734 </div></div> | |
| 2735 </section> | |
| 2736 | |
| 2737 | |
| 2738 | |
| 2739 <section class=alignments> | |
| 2740 <h2>Alignments</h2> | |
| 2741 | |
| 2742 <div class=grey><div class=white> | |
| 59 | 2743 <div class=alignment id=hit47-1> |
| 32 | 2744 |
| 2745 <div class=linkheader> | |
| 59 | 2746 <div class=right><a href="#description47-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2747 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> |
| 32 | 2748 </div> |
| 2749 | |
| 2750 <div class=title> | |
| 2751 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 2752 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2753 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> |
| 32 | 2754 <span class=b>Length:</span> 4180 |
| 2755 <span class=b>Number of Matches:</span> 1 | |
| 2756 </p> | |
| 2757 </div> | |
| 2758 | |
| 2759 | |
| 59 | 2760 <div class=hotspot id=hotspot47-1-1> |
| 32 | 2761 <p class=range> |
| 2762 <span class=range>Range 1: 1541 to 1565</span> | |
| 2763 </p> | |
| 2764 | |
| 2765 <table class=hotspotstable> | |
| 2766 <tr> | |
| 2767 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2768 </tr> | |
| 2769 <tr> | |
| 2770 <td>37.4 bits(40)</td> | |
| 2771 <td>0.0</td> | |
| 2772 <td>23/25(92%)</td> | |
| 2773 <td>0/25(0%)</td> | |
| 2774 <td>Plus/Plus</td> | |
| 2775 </tr> | |
| 2776 </table> | |
| 2777 | |
| 2778 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2779 |||||||||||||| ||||||| || | |
| 2780 Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre> | |
| 2781 </div> | |
| 2782 | |
| 2783 </div> | |
| 2784 | |
| 2785 </div></div> | |
| 2786 </section> | |
| 2787 </section> | |
| 2788 | |
| 2789 <section class=match id=match48> | |
| 2790 | |
| 2791 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 2792 | |
| 2793 <section class=header> | |
| 2794 | |
| 2795 <table class=headerdata> | |
| 2796 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2797 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2798 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2799 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2800 <tr><td class=param>Database:</td><td></td></tr> | |
| 2801 </table> | |
| 2802 | |
| 2803 </section> | |
| 2804 | |
| 2805 | |
| 2806 <section class=graphics> | |
| 2807 <h2>Graphic Summary</h2> | |
| 2808 | |
| 2809 <div class=grey> | |
| 2810 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 2811 | |
| 2812 <div class=defline id=defline48> | |
| 2813 Mouse-over to show defline and scores, click to show alignments | |
| 2814 </div> | |
| 2815 | |
| 2816 <div class=graphic> | |
| 2817 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 2818 <div class=legend><div class=graphicrow> | |
| 2819 <div class=graphicitem style="background-color: black"><40</div> | |
| 2820 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2821 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2822 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 2823 <div class=graphicitem style="background-color: red">200≤</div> | |
| 2824 </div></div> | |
| 2825 <div style="clear: left"></div> | |
| 2826 | |
| 2827 <div class=tablewrapper> | |
| 2828 | |
| 2829 <div class=scale> | |
| 2830 <div>query:</div> | |
| 2831 <div class=graphicrow> | |
| 2832 <div> | |
| 77 | 2833 <div class=graphicitem style="width: 12%"> |
| 32 | 2834 <div>3</div> |
| 2835 </div> | |
| 77 | 2836 <div class=graphicitem style="width: 12%"> |
| 32 | 2837 <div>6</div> |
| 2838 </div> | |
| 77 | 2839 <div class=graphicitem style="width: 12%"> |
| 32 | 2840 <div>9</div> |
| 2841 </div> | |
| 77 | 2842 <div class=graphicitem style="width: 12%"> |
| 32 | 2843 <div>12</div> |
| 2844 </div> | |
| 77 | 2845 <div class=graphicitem style="width: 12%"> |
| 32 | 2846 <div>15</div> |
| 2847 </div> | |
| 77 | 2848 <div class=graphicitem style="width: 12%"> |
| 32 | 2849 <div>18</div> |
| 2850 </div> | |
| 77 | 2851 <div class=graphicitem style="width: 12%"> |
| 32 | 2852 <div>21</div> |
| 2853 </div> | |
| 77 | 2854 <div class=graphicitem style="width: 12%"> |
| 32 | 2855 <div>24</div> |
| 2856 </div> | |
| 77 | 2857 <div class=graphicitem style="width: 4%"> |
| 32 | 2858 <div>25</div> |
| 2859 </div> | |
| 2860 </div> | |
| 2861 </div> | |
| 2862 <div style="clear: left"></div> | |
| 2863 </div> | |
| 2864 | |
| 2865 <a class=matchresult | |
| 59 | 2866 href="#hit48-1" |
| 32 | 2867 onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 2868 onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2869 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 2870 <div class="matchrow graphicrow"> | |
| 2871 <div class="matchitem graphicitem" | |
| 77 | 2872 style="background-color: black; width: 100%"></div> |
| 32 | 2873 </div> |
| 2874 </a> | |
| 2875 | |
| 2876 </div> | |
| 2877 </div> | |
| 2878 </div> | |
| 2879 </section> | |
| 2880 | |
| 2881 | |
| 2882 | |
| 2883 <section class=descriptions> | |
| 2884 <h2>Descriptions</h2> | |
| 2885 | |
| 2886 <div class=grey><div class=white> | |
| 2887 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 2888 | |
| 2889 <table class=descriptiontable> | |
| 2890 <col/><col/><col/><col/><col/><col/><col/> | |
| 2891 <tr> | |
| 2892 <th>Description</th> | |
| 2893 <th>Max score</th> | |
| 2894 <th>Total score</th> | |
| 2895 <th>Query cover</th> | |
| 2896 <th>E value</th> | |
| 2897 <th>Ident</th> | |
| 2898 <th>Accession</th> | |
| 2899 </tr> | |
| 2900 <tr> | |
| 59 | 2901 <td><div><a href="#hit48-1" |
| 32 | 2902 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 2903 id="description48-1"> |
| 32 | 2904 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 2905 </a></div></td> | |
| 2906 <td>37.4</td> | |
| 2907 <td>37.4</td> | |
| 2908 <td>100%</td> | |
| 2909 <td>9.338e-08</td> | |
| 2910 <td>92%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2911 <td><a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> |
| 32 | 2912 </tr> |
| 2913 </table> | |
| 2914 | |
| 2915 </div></div> | |
| 2916 </section> | |
| 2917 | |
| 2918 | |
| 2919 | |
| 2920 <section class=alignments> | |
| 2921 <h2>Alignments</h2> | |
| 2922 | |
| 2923 <div class=grey><div class=white> | |
| 59 | 2924 <div class=alignment id=hit48-1> |
| 32 | 2925 |
| 2926 <div class=linkheader> | |
| 59 | 2927 <div class=right><a href="#description48-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2928 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> |
| 32 | 2929 </div> |
| 2930 | |
| 2931 <div class=title> | |
| 2932 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 2933 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
2934 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> |
| 32 | 2935 <span class=b>Length:</span> 4983 |
| 2936 <span class=b>Number of Matches:</span> 1 | |
| 2937 </p> | |
| 2938 </div> | |
| 2939 | |
| 2940 | |
| 59 | 2941 <div class=hotspot id=hotspot48-1-1> |
| 32 | 2942 <p class=range> |
| 2943 <span class=range>Range 1: 2344 to 2368</span> | |
| 2944 </p> | |
| 2945 | |
| 2946 <table class=hotspotstable> | |
| 2947 <tr> | |
| 2948 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2949 </tr> | |
| 2950 <tr> | |
| 2951 <td>37.4 bits(40)</td> | |
| 2952 <td>0.0</td> | |
| 2953 <td>23/25(92%)</td> | |
| 2954 <td>0/25(0%)</td> | |
| 2955 <td>Plus/Plus</td> | |
| 2956 </tr> | |
| 2957 </table> | |
| 2958 | |
| 2959 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2960 |||||||||||||| ||||||| || | |
| 2961 Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre> | |
| 2962 </div> | |
| 2963 | |
| 2964 </div> | |
| 2965 | |
| 2966 </div></div> | |
| 2967 </section> | |
| 2968 </section> | |
| 2969 | |
| 2970 <section class=match id=match49> | |
| 2971 | |
| 2972 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 2973 | |
| 2974 <section class=header> | |
| 2975 | |
| 2976 <table class=headerdata> | |
| 2977 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 2978 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2979 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 2980 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 2981 <tr><td class=param>Database:</td><td></td></tr> | |
| 2982 </table> | |
| 2983 | |
| 2984 </section> | |
| 2985 | |
| 2986 <section> | |
| 2987 <h2>No Hits</h2> | |
| 2988 <div class=grey> | |
| 2989 <table class=headerdata> | |
| 2990 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2991 </table> | |
| 2992 </div> | |
| 2993 </section> | |
| 2994 </section> | |
| 2995 | |
| 2996 <section class=match id=match50> | |
| 2997 | |
| 2998 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 2999 | |
| 3000 <section class=header> | |
| 3001 | |
| 3002 <table class=headerdata> | |
| 3003 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3004 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3005 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3006 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3007 <tr><td class=param>Database:</td><td></td></tr> | |
| 3008 </table> | |
| 3009 | |
| 3010 </section> | |
| 3011 | |
| 3012 <section> | |
| 3013 <h2>No Hits</h2> | |
| 3014 <div class=grey> | |
| 3015 <table class=headerdata> | |
| 3016 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3017 </table> | |
| 3018 </div> | |
| 3019 </section> | |
| 3020 </section> | |
| 3021 | |
| 3022 <section class=match id=match51> | |
| 3023 | |
| 3024 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3025 | |
| 3026 <section class=header> | |
| 3027 | |
| 3028 <table class=headerdata> | |
| 3029 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3030 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3031 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3032 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3033 <tr><td class=param>Database:</td><td></td></tr> | |
| 3034 </table> | |
| 3035 | |
| 3036 </section> | |
| 3037 | |
| 3038 <section> | |
| 3039 <h2>No Hits</h2> | |
| 3040 <div class=grey> | |
| 3041 <table class=headerdata> | |
| 3042 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3043 </table> | |
| 3044 </div> | |
| 3045 </section> | |
| 3046 </section> | |
| 3047 | |
| 3048 <section class=match id=match52> | |
| 3049 | |
| 3050 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3051 | |
| 3052 <section class=header> | |
| 3053 | |
| 3054 <table class=headerdata> | |
| 3055 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3056 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3057 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3058 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3059 <tr><td class=param>Database:</td><td></td></tr> | |
| 3060 </table> | |
| 3061 | |
| 3062 </section> | |
| 3063 | |
| 3064 <section> | |
| 3065 <h2>No Hits</h2> | |
| 3066 <div class=grey> | |
| 3067 <table class=headerdata> | |
| 3068 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3069 </table> | |
| 3070 </div> | |
| 3071 </section> | |
| 3072 </section> | |
| 3073 | |
| 3074 <section class=match id=match53> | |
| 3075 | |
| 3076 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3077 | |
| 3078 <section class=header> | |
| 3079 | |
| 3080 <table class=headerdata> | |
| 3081 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3082 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3083 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3084 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3085 <tr><td class=param>Database:</td><td></td></tr> | |
| 3086 </table> | |
| 3087 | |
| 3088 </section> | |
| 3089 | |
| 3090 <section> | |
| 3091 <h2>No Hits</h2> | |
| 3092 <div class=grey> | |
| 3093 <table class=headerdata> | |
| 3094 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3095 </table> | |
| 3096 </div> | |
| 3097 </section> | |
| 3098 </section> | |
| 3099 | |
| 3100 <section class=match id=match54> | |
| 3101 | |
| 3102 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3103 | |
| 3104 <section class=header> | |
| 3105 | |
| 3106 <table class=headerdata> | |
| 3107 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3108 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3109 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3110 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3111 <tr><td class=param>Database:</td><td></td></tr> | |
| 3112 </table> | |
| 3113 | |
| 3114 </section> | |
| 3115 | |
| 3116 <section> | |
| 3117 <h2>No Hits</h2> | |
| 3118 <div class=grey> | |
| 3119 <table class=headerdata> | |
| 3120 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3121 </table> | |
| 3122 </div> | |
| 3123 </section> | |
| 3124 </section> | |
| 3125 | |
| 3126 <section class=match id=match55> | |
| 3127 | |
| 3128 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3129 | |
| 3130 <section class=header> | |
| 3131 | |
| 3132 <table class=headerdata> | |
| 3133 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3134 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3135 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3136 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3137 <tr><td class=param>Database:</td><td></td></tr> | |
| 3138 </table> | |
| 3139 | |
| 3140 </section> | |
| 3141 | |
| 3142 | |
| 3143 <section class=graphics> | |
| 3144 <h2>Graphic Summary</h2> | |
| 3145 | |
| 3146 <div class=grey> | |
| 3147 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 3148 | |
| 3149 <div class=defline id=defline55> | |
| 3150 Mouse-over to show defline and scores, click to show alignments | |
| 3151 </div> | |
| 3152 | |
| 3153 <div class=graphic> | |
| 3154 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 3155 <div class=legend><div class=graphicrow> | |
| 3156 <div class=graphicitem style="background-color: black"><40</div> | |
| 3157 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3158 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3159 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 3160 <div class=graphicitem style="background-color: red">200≤</div> | |
| 3161 </div></div> | |
| 3162 <div style="clear: left"></div> | |
| 3163 | |
| 3164 <div class=tablewrapper> | |
| 3165 | |
| 3166 <div class=scale> | |
| 3167 <div>query:</div> | |
| 3168 <div class=graphicrow> | |
| 3169 <div> | |
| 77 | 3170 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3171 <div>8</div> |
| 3172 </div> | |
| 77 | 3173 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3174 <div>16</div> |
| 3175 </div> | |
| 77 | 3176 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3177 <div>24</div> |
| 3178 </div> | |
| 77 | 3179 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3180 <div>32</div> |
| 3181 </div> | |
| 77 | 3182 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3183 <div>40</div> |
| 3184 </div> | |
| 77 | 3185 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3186 <div>48</div> |
| 3187 </div> | |
| 77 | 3188 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3189 <div>56</div> |
| 3190 </div> | |
| 77 | 3191 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3192 <div>64</div> |
| 3193 </div> | |
| 77 | 3194 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3195 <div>72</div> |
| 3196 </div> | |
| 77 | 3197 <div class=graphicitem style="width: 2.7027027027%"> |
| 32 | 3198 <div> </div> |
| 3199 <div class=lastlabel>74</div> | |
| 3200 </div> | |
| 3201 </div> | |
| 3202 </div> | |
| 3203 <div style="clear: left"></div> | |
| 3204 </div> | |
| 3205 | |
| 3206 <a class=matchresult | |
| 59 | 3207 href="#hit55-1" |
| 32 | 3208 onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 3209 onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3210 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 3211 <div class="matchrow graphicrow"> | |
| 3212 <div class="matchitem graphicitem" | |
| 77 | 3213 style="background-color: green; width: 100%"></div> |
| 32 | 3214 </div> |
| 3215 </a> | |
| 3216 | |
| 3217 </div> | |
| 3218 </div> | |
| 3219 </div> | |
| 3220 </section> | |
| 3221 | |
| 3222 | |
| 3223 | |
| 3224 <section class=descriptions> | |
| 3225 <h2>Descriptions</h2> | |
| 3226 | |
| 3227 <div class=grey><div class=white> | |
| 3228 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 3229 | |
| 3230 <table class=descriptiontable> | |
| 3231 <col/><col/><col/><col/><col/><col/><col/> | |
| 3232 <tr> | |
| 3233 <th>Description</th> | |
| 3234 <th>Max score</th> | |
| 3235 <th>Total score</th> | |
| 3236 <th>Query cover</th> | |
| 3237 <th>E value</th> | |
| 3238 <th>Ident</th> | |
| 3239 <th>Accession</th> | |
| 3240 </tr> | |
| 3241 <tr> | |
| 59 | 3242 <td><div><a href="#hit55-1" |
| 32 | 3243 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 3244 id="description55-1"> |
| 32 | 3245 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 3246 </a></div></td> | |
| 3247 <td>89.7</td> | |
| 3248 <td>89.7</td> | |
| 3249 <td>100%</td> | |
| 3250 <td>6.629e-23</td> | |
| 3251 <td>86%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3252 <td><a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> |
| 32 | 3253 </tr> |
| 3254 </table> | |
| 3255 | |
| 3256 </div></div> | |
| 3257 </section> | |
| 3258 | |
| 3259 | |
| 3260 | |
| 3261 <section class=alignments> | |
| 3262 <h2>Alignments</h2> | |
| 3263 | |
| 3264 <div class=grey><div class=white> | |
| 59 | 3265 <div class=alignment id=hit55-1> |
| 32 | 3266 |
| 3267 <div class=linkheader> | |
| 59 | 3268 <div class=right><a href="#description55-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3269 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> |
| 32 | 3270 </div> |
| 3271 | |
| 3272 <div class=title> | |
| 3273 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 3274 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3275 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> |
| 32 | 3276 <span class=b>Length:</span> 4180 |
| 3277 <span class=b>Number of Matches:</span> 1 | |
| 3278 </p> | |
| 3279 </div> | |
| 3280 | |
| 3281 | |
| 59 | 3282 <div class=hotspot id=hotspot55-1-1> |
| 32 | 3283 <p class=range> |
| 3284 <span class=range>Range 1: 1516 to 1589</span> | |
| 3285 </p> | |
| 3286 | |
| 3287 <table class=hotspotstable> | |
| 3288 <tr> | |
| 3289 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3290 </tr> | |
| 3291 <tr> | |
| 3292 <td>89.7 bits(98)</td> | |
| 3293 <td>0.0</td> | |
| 3294 <td>64/74(86%)</td> | |
| 3295 <td>0/74(0%)</td> | |
| 3296 <td>Plus/Plus</td> | |
| 3297 </tr> | |
| 3298 </table> | |
| 3299 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3300 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3301 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3302 Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1575</pre> |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3303 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3304 ||||| |||||||| |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3305 Subject 1576 TTCGCCGTCCAGAA 1589</pre> |
| 32 | 3306 </div> |
| 3307 | |
| 3308 </div> | |
| 3309 | |
| 3310 </div></div> | |
| 3311 </section> | |
| 3312 </section> | |
| 3313 | |
| 3314 <section class=match id=match56> | |
| 3315 | |
| 3316 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 3317 | |
| 3318 <section class=header> | |
| 3319 | |
| 3320 <table class=headerdata> | |
| 3321 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 3322 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 3323 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 3324 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 3325 <tr><td class=param>Database:</td><td></td></tr> | |
| 3326 </table> | |
| 3327 | |
| 3328 </section> | |
| 3329 | |
| 3330 | |
| 3331 <section class=graphics> | |
| 3332 <h2>Graphic Summary</h2> | |
| 3333 | |
| 3334 <div class=grey> | |
| 3335 <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3> | |
| 3336 | |
| 3337 <div class=defline id=defline56> | |
| 3338 Mouse-over to show defline and scores, click to show alignments | |
| 3339 </div> | |
| 3340 | |
| 3341 <div class=graphic> | |
| 3342 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 3343 <div class=legend><div class=graphicrow> | |
| 3344 <div class=graphicitem style="background-color: black"><40</div> | |
| 3345 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3346 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3347 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 3348 <div class=graphicitem style="background-color: red">200≤</div> | |
| 3349 </div></div> | |
| 3350 <div style="clear: left"></div> | |
| 3351 | |
| 3352 <div class=tablewrapper> | |
| 3353 | |
| 3354 <div class=scale> | |
| 3355 <div>query:</div> | |
| 3356 <div class=graphicrow> | |
| 3357 <div> | |
| 77 | 3358 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3359 <div>8</div> |
| 3360 </div> | |
| 77 | 3361 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3362 <div>16</div> |
| 3363 </div> | |
| 77 | 3364 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3365 <div>24</div> |
| 3366 </div> | |
| 77 | 3367 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3368 <div>32</div> |
| 3369 </div> | |
| 77 | 3370 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3371 <div>40</div> |
| 3372 </div> | |
| 77 | 3373 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3374 <div>48</div> |
| 3375 </div> | |
| 77 | 3376 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3377 <div>56</div> |
| 3378 </div> | |
| 77 | 3379 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3380 <div>64</div> |
| 3381 </div> | |
| 77 | 3382 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 3383 <div>72</div> |
| 3384 </div> | |
| 77 | 3385 <div class=graphicitem style="width: 2.7027027027%"> |
| 32 | 3386 <div> </div> |
| 3387 <div class=lastlabel>74</div> | |
| 3388 </div> | |
| 3389 </div> | |
| 3390 </div> | |
| 3391 <div style="clear: left"></div> | |
| 3392 </div> | |
| 3393 | |
| 3394 <a class=matchresult | |
| 59 | 3395 href="#hit56-1" |
| 32 | 3396 onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 3397 onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3398 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 3399 <div class="matchrow graphicrow"> | |
| 3400 <div class="matchitem graphicitem" | |
| 77 | 3401 style="background-color: green; width: 100%"></div> |
| 32 | 3402 </div> |
| 3403 </a> | |
| 3404 | |
| 3405 </div> | |
| 3406 </div> | |
| 3407 </div> | |
| 3408 </section> | |
| 3409 | |
| 3410 | |
| 3411 | |
| 3412 <section class=descriptions> | |
| 3413 <h2>Descriptions</h2> | |
| 3414 | |
| 3415 <div class=grey><div class=white> | |
| 3416 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 3417 | |
| 3418 <table class=descriptiontable> | |
| 3419 <col/><col/><col/><col/><col/><col/><col/> | |
| 3420 <tr> | |
| 3421 <th>Description</th> | |
| 3422 <th>Max score</th> | |
| 3423 <th>Total score</th> | |
| 3424 <th>Query cover</th> | |
| 3425 <th>E value</th> | |
| 3426 <th>Ident</th> | |
| 3427 <th>Accession</th> | |
| 3428 </tr> | |
| 3429 <tr> | |
| 59 | 3430 <td><div><a href="#hit56-1" |
| 32 | 3431 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 3432 id="description56-1"> |
| 32 | 3433 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 3434 </a></div></td> | |
| 3435 <td>89.7</td> | |
| 3436 <td>89.7</td> | |
| 3437 <td>100%</td> | |
| 3438 <td>6.629e-23</td> | |
| 3439 <td>86%</td> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3440 <td><a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> |
| 32 | 3441 </tr> |
| 3442 </table> | |
| 3443 | |
| 3444 </div></div> | |
| 3445 </section> | |
| 3446 | |
| 3447 | |
| 3448 | |
| 3449 <section class=alignments> | |
| 3450 <h2>Alignments</h2> | |
| 3451 | |
| 3452 <div class=grey><div class=white> | |
| 59 | 3453 <div class=alignment id=hit56-1> |
| 32 | 3454 |
| 3455 <div class=linkheader> | |
| 59 | 3456 <div class=right><a href="#description56-1">Descriptions</a></div> |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3457 <a class="linkheader" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> |
| 32 | 3458 </div> |
| 3459 | |
| 3460 <div class=title> | |
| 3461 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 3462 <p class=titleinfo> | |
|
98
e780606b7c25
test new command line parameters, fix small bug
Jan Kanis <jan.code@jankanis.nl>
parents:
97
diff
changeset
|
3463 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> |
| 32 | 3464 <span class=b>Length:</span> 4983 |
| 3465 <span class=b>Number of Matches:</span> 1 | |
| 3466 </p> | |
| 3467 </div> | |
| 3468 | |
| 3469 | |
| 59 | 3470 <div class=hotspot id=hotspot56-1-1> |
| 32 | 3471 <p class=range> |
| 3472 <span class=range>Range 1: 2319 to 2392</span> | |
| 3473 </p> | |
| 3474 | |
| 3475 <table class=hotspotstable> | |
| 3476 <tr> | |
| 3477 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3478 </tr> | |
| 3479 <tr> | |
| 3480 <td>89.7 bits(98)</td> | |
| 3481 <td>0.0</td> | |
| 3482 <td>64/74(86%)</td> | |
| 3483 <td>0/74(0%)</td> | |
| 3484 <td>Plus/Plus</td> | |
| 3485 </tr> | |
| 3486 </table> | |
| 3487 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3488 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3489 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3490 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3491 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3492 ||||| |||||||| |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
3493 Subject 2379 TTCGCCGTCCAGAA 2392</pre> |
| 32 | 3494 </div> |
| 3495 | |
| 3496 </div> | |
| 3497 | |
| 3498 </div></div> | |
| 3499 </section> | |
| 3500 </section> | |
| 3501 | |
| 3502 </div> | |
| 3503 | |
| 3504 <footer> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
3505 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. |
| 32 | 3506 </footer> |
| 3507 </body> | |
| 3508 </html> | |
| 3509 |
