Mercurial > repos > jankanis > blast2html
comparison test-data/blast xml example4b.html @ 118:7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Thu, 31 Jul 2014 13:09:30 +0200 |
| parents | 0c2a03f9740b |
| children |
comparison
equal
deleted
inserted
replaced
| 117:8ae714069687 | 118:7f3f8c10f44b |
|---|---|
| 471 <div class=legend><div class=graphicrow> | 471 <div class=legend><div class=graphicrow> |
| 472 <div class=graphicitem style="background-color: black"><40</div> | 472 <div class=graphicitem style="background-color: black"><40</div> |
| 473 <div class=graphicitem style="background-color: blue">40–50</div> | 473 <div class=graphicitem style="background-color: blue">40–50</div> |
| 474 <div class=graphicitem style="background-color: green">50–80</div> | 474 <div class=graphicitem style="background-color: green">50–80</div> |
| 475 <div class=graphicitem style="background-color: magenta">80–200</div> | 475 <div class=graphicitem style="background-color: magenta">80–200</div> |
| 476 <div class=graphicitem style="background-color: red">200≤</div> | 476 <div class=graphicitem style="background-color: red">≥200</div> |
| 477 </div></div> | 477 </div></div> |
| 478 <div style="clear: left"></div> | 478 <div style="clear: left"></div> |
| 479 | 479 |
| 480 <div class=tablewrapper> | 480 <div class=tablewrapper> |
| 481 | 481 |
| 573 <td>40.1</td> | 573 <td>40.1</td> |
| 574 <td>40.1</td> | 574 <td>40.1</td> |
| 575 <td>100%</td> | 575 <td>100%</td> |
| 576 <td>1.513e-07</td> | 576 <td>1.513e-07</td> |
| 577 <td>100%</td> | 577 <td>100%</td> |
| 578 <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td> | 578 <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td> |
| 579 </tr> | 579 </tr> |
| 580 <tr> | 580 <tr> |
| 581 <td><div><a href="#hit1-2" | 581 <td><div><a href="#hit1-2" |
| 582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 583 id="description1-2"> | 583 id="description1-2"> |
| 586 <td>40.1</td> | 586 <td>40.1</td> |
| 587 <td>40.1</td> | 587 <td>40.1</td> |
| 588 <td>100%</td> | 588 <td>100%</td> |
| 589 <td>1.513e-07</td> | 589 <td>1.513e-07</td> |
| 590 <td>100%</td> | 590 <td>100%</td> |
| 591 <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td> | 591 <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td> |
| 592 </tr> | 592 </tr> |
| 593 </table> | 593 </table> |
| 594 | 594 |
| 595 </div></div> | 595 </div></div> |
| 596 </section> | 596 </section> |
| 603 <div class=grey><div class=white> | 603 <div class=grey><div class=white> |
| 604 <div class=alignment id=hit1-1> | 604 <div class=alignment id=hit1-1> |
| 605 | 605 |
| 606 <div class=linkheader> | 606 <div class=linkheader> |
| 607 <div class=right><a href="#description1-1">Descriptions</a></div> | 607 <div class=right><a href="#description1-1">Descriptions</a></div> |
| 608 <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> | 608 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> |
| 609 </div> | 609 </div> |
| 610 | 610 |
| 611 <div class=title> | 611 <div class=title> |
| 612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
| 613 <p class=titleinfo> | 613 <p class=titleinfo> |
| 614 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> | 614 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> |
| 615 <span class=b>Length:</span> 2457 | 615 <span class=b>Length:</span> 2457 |
| 616 <span class=b>Number of Matches:</span> 1 | 616 <span class=b>Number of Matches:</span> 1 |
| 617 </p> | 617 </p> |
| 618 </div> | 618 </div> |
| 619 | 619 |
| 626 <table class=hotspotstable> | 626 <table class=hotspotstable> |
| 627 <tr> | 627 <tr> |
| 628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 629 </tr> | 629 </tr> |
| 630 <tr> | 630 <tr> |
| 631 <td>40.1 bits(20)</td> | 631 <td>40.14 bits (20)</td> |
| 632 <td>0.0</td> | 632 <td>1.51296e-07</td> |
| 633 <td>20/20(100%)</td> | 633 <td>20/20 (100%)</td> |
| 634 <td>0/20(0%)</td> | 634 <td>0/20 (0%)</td> |
| 635 <td>Plus/Plus</td> | 635 <td>Plus/Plus</td> |
| 636 </tr> | 636 </tr> |
| 637 </table> | 637 </table> |
| 638 | 638 |
| 639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
| 645 | 645 |
| 646 <div class=alignment id=hit1-2> | 646 <div class=alignment id=hit1-2> |
| 647 | 647 |
| 648 <div class=linkheader> | 648 <div class=linkheader> |
| 649 <div class=right><a href="#description1-2">Descriptions</a></div> | 649 <div class=right><a href="#description1-2">Descriptions</a></div> |
| 650 <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> | 650 <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> |
| 651 </div> | 651 </div> |
| 652 | 652 |
| 653 <div class=title> | 653 <div class=title> |
| 654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
| 655 <p class=titleinfo> | 655 <p class=titleinfo> |
| 656 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> | 656 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> |
| 657 <span class=b>Length:</span> 323 | 657 <span class=b>Length:</span> 323 |
| 658 <span class=b>Number of Matches:</span> 1 | 658 <span class=b>Number of Matches:</span> 1 |
| 659 </p> | 659 </p> |
| 660 </div> | 660 </div> |
| 661 | 661 |
| 668 <table class=hotspotstable> | 668 <table class=hotspotstable> |
| 669 <tr> | 669 <tr> |
| 670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 671 </tr> | 671 </tr> |
| 672 <tr> | 672 <tr> |
| 673 <td>40.1 bits(20)</td> | 673 <td>40.14 bits (20)</td> |
| 674 <td>0.0</td> | 674 <td>1.51296e-07</td> |
| 675 <td>20/20(100%)</td> | 675 <td>20/20 (100%)</td> |
| 676 <td>0/20(0%)</td> | 676 <td>0/20 (0%)</td> |
| 677 <td>Plus/Plus</td> | 677 <td>Plus/Plus</td> |
| 678 </tr> | 678 </tr> |
| 679 </table> | 679 </table> |
| 680 | 680 |
| 681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
| 745 <div class=legend><div class=graphicrow> | 745 <div class=legend><div class=graphicrow> |
| 746 <div class=graphicitem style="background-color: black"><40</div> | 746 <div class=graphicitem style="background-color: black"><40</div> |
| 747 <div class=graphicitem style="background-color: blue">40–50</div> | 747 <div class=graphicitem style="background-color: blue">40–50</div> |
| 748 <div class=graphicitem style="background-color: green">50–80</div> | 748 <div class=graphicitem style="background-color: green">50–80</div> |
| 749 <div class=graphicitem style="background-color: magenta">80–200</div> | 749 <div class=graphicitem style="background-color: magenta">80–200</div> |
| 750 <div class=graphicitem style="background-color: red">200≤</div> | 750 <div class=graphicitem style="background-color: red">≥200</div> |
| 751 </div></div> | 751 </div></div> |
| 752 <div style="clear: left"></div> | 752 <div style="clear: left"></div> |
| 753 | 753 |
| 754 <div class=tablewrapper> | 754 <div class=tablewrapper> |
| 755 | 755 |
| 860 <td>40.1</td> | 860 <td>40.1</td> |
| 861 <td>40.1</td> | 861 <td>40.1</td> |
| 862 <td>100%</td> | 862 <td>100%</td> |
| 863 <td>1.513e-07</td> | 863 <td>1.513e-07</td> |
| 864 <td>100%</td> | 864 <td>100%</td> |
| 865 <td><a href="http://example.com/example-genebank/AB209952.1/">5</a></td> | 865 <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td> |
| 866 </tr> | 866 </tr> |
| 867 <tr> | 867 <tr> |
| 868 <td><div><a href="#hit3-2" | 868 <td><div><a href="#hit3-2" |
| 869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 870 id="description3-2"> | 870 id="description3-2"> |
| 873 <td>40.1</td> | 873 <td>40.1</td> |
| 874 <td>40.1</td> | 874 <td>40.1</td> |
| 875 <td>100%</td> | 875 <td>100%</td> |
| 876 <td>1.513e-07</td> | 876 <td>1.513e-07</td> |
| 877 <td>100%</td> | 877 <td>100%</td> |
| 878 <td><a href="http://example.com/example-genebank/DJ437711/">2</a></td> | 878 <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td> |
| 879 </tr> | 879 </tr> |
| 880 <tr> | 880 <tr> |
| 881 <td><div><a href="#hit3-3" | 881 <td><div><a href="#hit3-3" |
| 882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | 882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
| 883 id="description3-3"> | 883 id="description3-3"> |
| 886 <td>34.2</td> | 886 <td>34.2</td> |
| 887 <td>34.2</td> | 887 <td>34.2</td> |
| 888 <td>85%</td> | 888 <td>85%</td> |
| 889 <td>9.334e-06</td> | 889 <td>9.334e-06</td> |
| 890 <td>100%</td> | 890 <td>100%</td> |
| 891 <td><a href="http://example.com/example-genebank/AJ308515.1/">1</a></td> | 891 <td><a target="_top" href="http://example.com/example-genebank/AJ308515.1/">1</a></td> |
| 892 </tr> | 892 </tr> |
| 893 </table> | 893 </table> |
| 894 | 894 |
| 895 </div></div> | 895 </div></div> |
| 896 </section> | 896 </section> |
| 903 <div class=grey><div class=white> | 903 <div class=grey><div class=white> |
| 904 <div class=alignment id=hit3-1> | 904 <div class=alignment id=hit3-1> |
| 905 | 905 |
| 906 <div class=linkheader> | 906 <div class=linkheader> |
| 907 <div class=right><a href="#description3-1">Descriptions</a></div> | 907 <div class=right><a href="#description3-1">Descriptions</a></div> |
| 908 <a class="linkheader" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> | 908 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> |
| 909 </div> | 909 </div> |
| 910 | 910 |
| 911 <div class=title> | 911 <div class=title> |
| 912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
| 913 <p class=titleinfo> | 913 <p class=titleinfo> |
| 914 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> | 914 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> |
| 915 <span class=b>Length:</span> 2457 | 915 <span class=b>Length:</span> 2457 |
| 916 <span class=b>Number of Matches:</span> 1 | 916 <span class=b>Number of Matches:</span> 1 |
| 917 </p> | 917 </p> |
| 918 </div> | 918 </div> |
| 919 | 919 |
| 926 <table class=hotspotstable> | 926 <table class=hotspotstable> |
| 927 <tr> | 927 <tr> |
| 928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 929 </tr> | 929 </tr> |
| 930 <tr> | 930 <tr> |
| 931 <td>40.1 bits(20)</td> | 931 <td>40.14 bits (20)</td> |
| 932 <td>0.0</td> | 932 <td>1.51296e-07</td> |
| 933 <td>20/20(100%)</td> | 933 <td>20/20 (100%)</td> |
| 934 <td>0/20(0%)</td> | 934 <td>0/20 (0%)</td> |
| 935 <td>Plus/Plus</td> | 935 <td>Plus/Plus</td> |
| 936 </tr> | 936 </tr> |
| 937 </table> | 937 </table> |
| 938 | 938 |
| 939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
| 945 | 945 |
| 946 <div class=alignment id=hit3-2> | 946 <div class=alignment id=hit3-2> |
| 947 | 947 |
| 948 <div class=linkheader> | 948 <div class=linkheader> |
| 949 <div class=right><a href="#description3-2">Descriptions</a></div> | 949 <div class=right><a href="#description3-2">Descriptions</a></div> |
| 950 <a class="linkheader" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> | 950 <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> |
| 951 </div> | 951 </div> |
| 952 | 952 |
| 953 <div class=title> | 953 <div class=title> |
| 954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
| 955 <p class=titleinfo> | 955 <p class=titleinfo> |
| 956 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> | 956 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> |
| 957 <span class=b>Length:</span> 323 | 957 <span class=b>Length:</span> 323 |
| 958 <span class=b>Number of Matches:</span> 1 | 958 <span class=b>Number of Matches:</span> 1 |
| 959 </p> | 959 </p> |
| 960 </div> | 960 </div> |
| 961 | 961 |
| 968 <table class=hotspotstable> | 968 <table class=hotspotstable> |
| 969 <tr> | 969 <tr> |
| 970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 971 </tr> | 971 </tr> |
| 972 <tr> | 972 <tr> |
| 973 <td>40.1 bits(20)</td> | 973 <td>40.14 bits (20)</td> |
| 974 <td>0.0</td> | 974 <td>1.51296e-07</td> |
| 975 <td>20/20(100%)</td> | 975 <td>20/20 (100%)</td> |
| 976 <td>0/20(0%)</td> | 976 <td>0/20 (0%)</td> |
| 977 <td>Plus/Plus</td> | 977 <td>Plus/Plus</td> |
| 978 </tr> | 978 </tr> |
| 979 </table> | 979 </table> |
| 980 | 980 |
| 981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
| 987 | 987 |
| 988 <div class=alignment id=hit3-3> | 988 <div class=alignment id=hit3-3> |
| 989 | 989 |
| 990 <div class=linkheader> | 990 <div class=linkheader> |
| 991 <div class=right><a href="#description3-3">Descriptions</a></div> | 991 <div class=right><a href="#description3-3">Descriptions</a></div> |
| 992 <a class="linkheader" href="http://example.com/example-genebank/AJ308515.1/">Example Gene Bank</a> | 992 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AJ308515.1/">Example Gene Bank</a> |
| 993 </div> | 993 </div> |
| 994 | 994 |
| 995 <div class=title> | 995 <div class=title> |
| 996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | 996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> |
| 997 <p class=titleinfo> | 997 <p class=titleinfo> |
| 998 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a> | 998 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a> |
| 999 <span class=b>Length:</span> 1045 | 999 <span class=b>Length:</span> 1045 |
| 1000 <span class=b>Number of Matches:</span> 1 | 1000 <span class=b>Number of Matches:</span> 1 |
| 1001 </p> | 1001 </p> |
| 1002 </div> | 1002 </div> |
| 1003 | 1003 |
| 1010 <table class=hotspotstable> | 1010 <table class=hotspotstable> |
| 1011 <tr> | 1011 <tr> |
| 1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 1013 </tr> | 1013 </tr> |
| 1014 <tr> | 1014 <tr> |
| 1015 <td>34.2 bits(17)</td> | 1015 <td>34.1929 bits (17)</td> |
| 1016 <td>0.0</td> | 1016 <td>9.33411e-06</td> |
| 1017 <td>17/17(100%)</td> | 1017 <td>17/17 (100%)</td> |
| 1018 <td>0/17(0%)</td> | 1018 <td>0/17 (0%)</td> |
| 1019 <td>Plus/Plus</td> | 1019 <td>Plus/Plus</td> |
| 1020 </tr> | 1020 </tr> |
| 1021 </table> | 1021 </table> |
| 1022 | 1022 |
| 1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | 1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 |
| 1112 <div class=legend><div class=graphicrow> | 1112 <div class=legend><div class=graphicrow> |
| 1113 <div class=graphicitem style="background-color: black"><40</div> | 1113 <div class=graphicitem style="background-color: black"><40</div> |
| 1114 <div class=graphicitem style="background-color: blue">40–50</div> | 1114 <div class=graphicitem style="background-color: blue">40–50</div> |
| 1115 <div class=graphicitem style="background-color: green">50–80</div> | 1115 <div class=graphicitem style="background-color: green">50–80</div> |
| 1116 <div class=graphicitem style="background-color: magenta">80–200</div> | 1116 <div class=graphicitem style="background-color: magenta">80–200</div> |
| 1117 <div class=graphicitem style="background-color: red">200≤</div> | 1117 <div class=graphicitem style="background-color: red">≥200</div> |
| 1118 </div></div> | 1118 </div></div> |
| 1119 <div style="clear: left"></div> | 1119 <div style="clear: left"></div> |
| 1120 | 1120 |
| 1121 <div class=tablewrapper> | 1121 <div class=tablewrapper> |
| 1122 | 1122 |
| 1215 <td>36.2</td> | 1215 <td>36.2</td> |
| 1216 <td>36.2</td> | 1216 <td>36.2</td> |
| 1217 <td>88%</td> | 1217 <td>88%</td> |
| 1218 <td>3.148e-06</td> | 1218 <td>3.148e-06</td> |
| 1219 <td>95%</td> | 1219 <td>95%</td> |
| 1220 <td><a href="http://example.com/example-genebank/EUG/">7</a></td> | 1220 <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td> |
| 1221 </tr> | 1221 </tr> |
| 1222 <tr> | 1222 <tr> |
| 1223 <td><div><a href="#hit6-2" | 1223 <td><div><a href="#hit6-2" |
| 1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 1225 id="description6-2"> | 1225 id="description6-2"> |
| 1228 <td>36.2</td> | 1228 <td>36.2</td> |
| 1229 <td>36.2</td> | 1229 <td>36.2</td> |
| 1230 <td>88%</td> | 1230 <td>88%</td> |
| 1231 <td>3.148e-06</td> | 1231 <td>3.148e-06</td> |
| 1232 <td>95%</td> | 1232 <td>95%</td> |
| 1233 <td><a href="http://example.com/example-genebank/AY326434/">6</a></td> | 1233 <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td> |
| 1234 </tr> | 1234 </tr> |
| 1235 </table> | 1235 </table> |
| 1236 | 1236 |
| 1237 </div></div> | 1237 </div></div> |
| 1238 </section> | 1238 </section> |
| 1245 <div class=grey><div class=white> | 1245 <div class=grey><div class=white> |
| 1246 <div class=alignment id=hit6-1> | 1246 <div class=alignment id=hit6-1> |
| 1247 | 1247 |
| 1248 <div class=linkheader> | 1248 <div class=linkheader> |
| 1249 <div class=right><a href="#description6-1">Descriptions</a></div> | 1249 <div class=right><a href="#description6-1">Descriptions</a></div> |
| 1250 <a class="linkheader" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> | 1250 <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> |
| 1251 </div> | 1251 </div> |
| 1252 | 1252 |
| 1253 <div class=title> | 1253 <div class=title> |
| 1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
| 1255 <p class=titleinfo> | 1255 <p class=titleinfo> |
| 1256 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> | 1256 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> |
| 1257 <span class=b>Length:</span> 4983 | 1257 <span class=b>Length:</span> 4983 |
| 1258 <span class=b>Number of Matches:</span> 1 | 1258 <span class=b>Number of Matches:</span> 1 |
| 1259 </p> | 1259 </p> |
| 1260 </div> | 1260 </div> |
| 1261 | 1261 |
| 1268 <table class=hotspotstable> | 1268 <table class=hotspotstable> |
| 1269 <tr> | 1269 <tr> |
| 1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 1271 </tr> | 1271 </tr> |
| 1272 <tr> | 1272 <tr> |
| 1273 <td>36.2 bits(18)</td> | 1273 <td>36.1753 bits (18)</td> |
| 1274 <td>0.0</td> | 1274 <td>3.14801e-06</td> |
| 1275 <td>21/22(95%)</td> | 1275 <td>21/22 (95%)</td> |
| 1276 <td>0/22(0%)</td> | 1276 <td>0/22 (0%)</td> |
| 1277 <td>Plus/Plus</td> | 1277 <td>Plus/Plus</td> |
| 1278 </tr> | 1278 </tr> |
| 1279 </table> | 1279 </table> |
| 1280 | 1280 |
| 1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | 1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 |
| 1287 | 1287 |
| 1288 <div class=alignment id=hit6-2> | 1288 <div class=alignment id=hit6-2> |
| 1289 | 1289 |
| 1290 <div class=linkheader> | 1290 <div class=linkheader> |
| 1291 <div class=right><a href="#description6-2">Descriptions</a></div> | 1291 <div class=right><a href="#description6-2">Descriptions</a></div> |
| 1292 <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> | 1292 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> |
| 1293 </div> | 1293 </div> |
| 1294 | 1294 |
| 1295 <div class=title> | 1295 <div class=title> |
| 1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
| 1297 <p class=titleinfo> | 1297 <p class=titleinfo> |
| 1298 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> | 1298 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> |
| 1299 <span class=b>Length:</span> 4180 | 1299 <span class=b>Length:</span> 4180 |
| 1300 <span class=b>Number of Matches:</span> 1 | 1300 <span class=b>Number of Matches:</span> 1 |
| 1301 </p> | 1301 </p> |
| 1302 </div> | 1302 </div> |
| 1303 | 1303 |
| 1310 <table class=hotspotstable> | 1310 <table class=hotspotstable> |
| 1311 <tr> | 1311 <tr> |
| 1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 1313 </tr> | 1313 </tr> |
| 1314 <tr> | 1314 <tr> |
| 1315 <td>36.2 bits(18)</td> | 1315 <td>36.1753 bits (18)</td> |
| 1316 <td>0.0</td> | 1316 <td>3.14801e-06</td> |
| 1317 <td>21/22(95%)</td> | 1317 <td>21/22 (95%)</td> |
| 1318 <td>0/22(0%)</td> | 1318 <td>0/22 (0%)</td> |
| 1319 <td>Plus/Plus</td> | 1319 <td>Plus/Plus</td> |
| 1320 </tr> | 1320 </tr> |
| 1321 </table> | 1321 </table> |
| 1322 | 1322 |
| 1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | 1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 |
| 1362 <div class=legend><div class=graphicrow> | 1362 <div class=legend><div class=graphicrow> |
| 1363 <div class=graphicitem style="background-color: black"><40</div> | 1363 <div class=graphicitem style="background-color: black"><40</div> |
| 1364 <div class=graphicitem style="background-color: blue">40–50</div> | 1364 <div class=graphicitem style="background-color: blue">40–50</div> |
| 1365 <div class=graphicitem style="background-color: green">50–80</div> | 1365 <div class=graphicitem style="background-color: green">50–80</div> |
| 1366 <div class=graphicitem style="background-color: magenta">80–200</div> | 1366 <div class=graphicitem style="background-color: magenta">80–200</div> |
| 1367 <div class=graphicitem style="background-color: red">200≤</div> | 1367 <div class=graphicitem style="background-color: red">≥200</div> |
| 1368 </div></div> | 1368 </div></div> |
| 1369 <div style="clear: left"></div> | 1369 <div style="clear: left"></div> |
| 1370 | 1370 |
| 1371 <div class=tablewrapper> | 1371 <div class=tablewrapper> |
| 1372 | 1372 |
| 1465 <td>67.9</td> | 1465 <td>67.9</td> |
| 1466 <td>67.9</td> | 1466 <td>67.9</td> |
| 1467 <td>100%</td> | 1467 <td>100%</td> |
| 1468 <td>3.564e-15</td> | 1468 <td>3.564e-15</td> |
| 1469 <td>86%</td> | 1469 <td>86%</td> |
| 1470 <td><a href="http://example.com/example-genebank/EUG/">7</a></td> | 1470 <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td> |
| 1471 </tr> | 1471 </tr> |
| 1472 <tr> | 1472 <tr> |
| 1473 <td><div><a href="#hit7-2" | 1473 <td><div><a href="#hit7-2" |
| 1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 1475 id="description7-2"> | 1475 id="description7-2"> |
| 1478 <td>67.9</td> | 1478 <td>67.9</td> |
| 1479 <td>67.9</td> | 1479 <td>67.9</td> |
| 1480 <td>100%</td> | 1480 <td>100%</td> |
| 1481 <td>3.564e-15</td> | 1481 <td>3.564e-15</td> |
| 1482 <td>86%</td> | 1482 <td>86%</td> |
| 1483 <td><a href="http://example.com/example-genebank/AY326434/">6</a></td> | 1483 <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td> |
| 1484 </tr> | 1484 </tr> |
| 1485 </table> | 1485 </table> |
| 1486 | 1486 |
| 1487 </div></div> | 1487 </div></div> |
| 1488 </section> | 1488 </section> |
| 1495 <div class=grey><div class=white> | 1495 <div class=grey><div class=white> |
| 1496 <div class=alignment id=hit7-1> | 1496 <div class=alignment id=hit7-1> |
| 1497 | 1497 |
| 1498 <div class=linkheader> | 1498 <div class=linkheader> |
| 1499 <div class=right><a href="#description7-1">Descriptions</a></div> | 1499 <div class=right><a href="#description7-1">Descriptions</a></div> |
| 1500 <a class="linkheader" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> | 1500 <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> |
| 1501 </div> | 1501 </div> |
| 1502 | 1502 |
| 1503 <div class=title> | 1503 <div class=title> |
| 1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
| 1505 <p class=titleinfo> | 1505 <p class=titleinfo> |
| 1506 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> | 1506 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> |
| 1507 <span class=b>Length:</span> 4983 | 1507 <span class=b>Length:</span> 4983 |
| 1508 <span class=b>Number of Matches:</span> 1 | 1508 <span class=b>Number of Matches:</span> 1 |
| 1509 </p> | 1509 </p> |
| 1510 </div> | 1510 </div> |
| 1511 | 1511 |
| 1518 <table class=hotspotstable> | 1518 <table class=hotspotstable> |
| 1519 <tr> | 1519 <tr> |
| 1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 1521 </tr> | 1521 </tr> |
| 1522 <tr> | 1522 <tr> |
| 1523 <td>67.9 bits(34)</td> | 1523 <td>67.8929 bits (34)</td> |
| 1524 <td>0.0</td> | 1524 <td>3.56369e-15</td> |
| 1525 <td>64/74(86%)</td> | 1525 <td>64/74 (86%)</td> |
| 1526 <td>0/74(0%)</td> | 1526 <td>0/74 (0%)</td> |
| 1527 <td>Plus/Plus</td> | 1527 <td>Plus/Plus</td> |
| 1528 </tr> | 1528 </tr> |
| 1529 </table> | 1529 </table> |
| 1530 | 1530 |
| 1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
| 1540 | 1540 |
| 1541 <div class=alignment id=hit7-2> | 1541 <div class=alignment id=hit7-2> |
| 1542 | 1542 |
| 1543 <div class=linkheader> | 1543 <div class=linkheader> |
| 1544 <div class=right><a href="#description7-2">Descriptions</a></div> | 1544 <div class=right><a href="#description7-2">Descriptions</a></div> |
| 1545 <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> | 1545 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> |
| 1546 </div> | 1546 </div> |
| 1547 | 1547 |
| 1548 <div class=title> | 1548 <div class=title> |
| 1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
| 1550 <p class=titleinfo> | 1550 <p class=titleinfo> |
| 1551 <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> | 1551 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> |
| 1552 <span class=b>Length:</span> 4180 | 1552 <span class=b>Length:</span> 4180 |
| 1553 <span class=b>Number of Matches:</span> 1 | 1553 <span class=b>Number of Matches:</span> 1 |
| 1554 </p> | 1554 </p> |
| 1555 </div> | 1555 </div> |
| 1556 | 1556 |
| 1563 <table class=hotspotstable> | 1563 <table class=hotspotstable> |
| 1564 <tr> | 1564 <tr> |
| 1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
| 1566 </tr> | 1566 </tr> |
| 1567 <tr> | 1567 <tr> |
| 1568 <td>67.9 bits(34)</td> | 1568 <td>67.8929 bits (34)</td> |
| 1569 <td>0.0</td> | 1569 <td>3.56369e-15</td> |
| 1570 <td>64/74(86%)</td> | 1570 <td>64/74 (86%)</td> |
| 1571 <td>0/74(0%)</td> | 1571 <td>0/74 (0%)</td> |
| 1572 <td>Plus/Minus</td> | 1572 <td>Plus/Minus</td> |
| 1573 </tr> | 1573 </tr> |
| 1574 </table> | 1574 </table> |
| 1575 | 1575 |
| 1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
