Mercurial > repos > jankanis > blast2html
comparison test-data/blast xml example4.xml @ 32:ce8f29efc0a1
fix tests
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Thu, 15 May 2014 17:22:02 +0200 (2014-05-15) |
parents | test-data/Galaxy8-[blastn-short_EUginius_primers_probes.fasta_vs__EUginius_].blastxml@420d0508dcd6 |
children | 0ef071bba164 |
comparison
equal
deleted
inserted
replaced
31:344cd76f6fd2 | 32:ce8f29efc0a1 |
---|---|
1 <?xml version="1.0"?> | |
2 <!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd"> | |
3 <BlastOutput> | |
4 <BlastOutput_program>blastn</BlastOutput_program> | |
5 <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version> | |
6 <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference> | |
7 <BlastOutput_db>/opt/galaxy/blastdbs/EUginius_plasmid_insert</BlastOutput_db> | |
8 <BlastOutput_query-ID>Query_1</BlastOutput_query-ID> | |
9 <BlastOutput_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</BlastOutput_query-def> | |
10 <BlastOutput_query-len>20</BlastOutput_query-len> | |
11 <BlastOutput_param> | |
12 <Parameters> | |
13 <Parameters_expect>0.001</Parameters_expect> | |
14 <Parameters_sc-match>1</Parameters_sc-match> | |
15 <Parameters_sc-mismatch>-3</Parameters_sc-mismatch> | |
16 <Parameters_gap-open>5</Parameters_gap-open> | |
17 <Parameters_gap-extend>2</Parameters_gap-extend> | |
18 <Parameters_filter>L;m;</Parameters_filter> | |
19 </Parameters> | |
20 </BlastOutput_param> | |
21 <BlastOutput_iterations> | |
22 <Iteration> | |
23 <Iteration_iter-num>1</Iteration_iter-num> | |
24 <Iteration_query-ID>Query_1</Iteration_query-ID> | |
25 <Iteration_query-def>Forward_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
26 <Iteration_query-len>20</Iteration_query-len> | |
27 <Iteration_hits> | |
28 <Hit> | |
29 <Hit_num>1</Hit_num> | |
30 <Hit_id>gnl|BL_ORD_ID|5</Hit_id> | |
31 <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def> | |
32 <Hit_accession>5</Hit_accession> | |
33 <Hit_len>2457</Hit_len> | |
34 <Hit_hsps> | |
35 <Hsp> | |
36 <Hsp_num>1</Hsp_num> | |
37 <Hsp_bit-score>40.14</Hsp_bit-score> | |
38 <Hsp_score>20</Hsp_score> | |
39 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
40 <Hsp_query-from>1</Hsp_query-from> | |
41 <Hsp_query-to>20</Hsp_query-to> | |
42 <Hsp_hit-from>2119</Hsp_hit-from> | |
43 <Hsp_hit-to>2138</Hsp_hit-to> | |
44 <Hsp_query-frame>1</Hsp_query-frame> | |
45 <Hsp_hit-frame>1</Hsp_hit-frame> | |
46 <Hsp_identity>20</Hsp_identity> | |
47 <Hsp_positive>20</Hsp_positive> | |
48 <Hsp_gaps>0</Hsp_gaps> | |
49 <Hsp_align-len>20</Hsp_align-len> | |
50 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq> | |
51 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq> | |
52 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
53 </Hsp> | |
54 </Hit_hsps> | |
55 </Hit> | |
56 <Hit> | |
57 <Hit_num>2</Hit_num> | |
58 <Hit_id>gnl|BL_ORD_ID|2</Hit_id> | |
59 <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def> | |
60 <Hit_accession>2</Hit_accession> | |
61 <Hit_len>323</Hit_len> | |
62 <Hit_hsps> | |
63 <Hsp> | |
64 <Hsp_num>1</Hsp_num> | |
65 <Hsp_bit-score>40.14</Hsp_bit-score> | |
66 <Hsp_score>20</Hsp_score> | |
67 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
68 <Hsp_query-from>1</Hsp_query-from> | |
69 <Hsp_query-to>20</Hsp_query-to> | |
70 <Hsp_hit-from>200</Hsp_hit-from> | |
71 <Hsp_hit-to>219</Hsp_hit-to> | |
72 <Hsp_query-frame>1</Hsp_query-frame> | |
73 <Hsp_hit-frame>1</Hsp_hit-frame> | |
74 <Hsp_identity>20</Hsp_identity> | |
75 <Hsp_positive>20</Hsp_positive> | |
76 <Hsp_gaps>0</Hsp_gaps> | |
77 <Hsp_align-len>20</Hsp_align-len> | |
78 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq> | |
79 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq> | |
80 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
81 </Hsp> | |
82 </Hit_hsps> | |
83 </Hit> | |
84 </Iteration_hits> | |
85 <Iteration_stat> | |
86 <Statistics> | |
87 <Statistics_db-num>8</Statistics_db-num> | |
88 <Statistics_db-len>15339</Statistics_db-len> | |
89 <Statistics_hsp-len>8</Statistics_hsp-len> | |
90 <Statistics_eff-space>183300</Statistics_eff-space> | |
91 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
92 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
93 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
94 </Statistics> | |
95 </Iteration_stat> | |
96 </Iteration> | |
97 <Iteration> | |
98 <Iteration_iter-num>2</Iteration_iter-num> | |
99 <Iteration_query-ID>Query_2</Iteration_query-ID> | |
100 <Iteration_query-def>Reverse_Primer|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
101 <Iteration_query-len>20</Iteration_query-len> | |
102 <Iteration_hits> | |
103 </Iteration_hits> | |
104 <Iteration_stat> | |
105 <Statistics> | |
106 <Statistics_db-num>8</Statistics_db-num> | |
107 <Statistics_db-len>15339</Statistics_db-len> | |
108 <Statistics_hsp-len>8</Statistics_hsp-len> | |
109 <Statistics_eff-space>183300</Statistics_eff-space> | |
110 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
111 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
112 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
113 </Statistics> | |
114 </Iteration_stat> | |
115 <Iteration_message>No hits found</Iteration_message> | |
116 </Iteration> | |
117 <Iteration> | |
118 <Iteration_iter-num>3</Iteration_iter-num> | |
119 <Iteration_query-ID>Query_3</Iteration_query-ID> | |
120 <Iteration_query-def>Probe|NOST-Spec_(Genetic_ID)</Iteration_query-def> | |
121 <Iteration_query-len>20</Iteration_query-len> | |
122 <Iteration_hits> | |
123 <Hit> | |
124 <Hit_num>1</Hit_num> | |
125 <Hit_id>gnl|BL_ORD_ID|5</Hit_id> | |
126 <Hit_def>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</Hit_def> | |
127 <Hit_accession>5</Hit_accession> | |
128 <Hit_len>2457</Hit_len> | |
129 <Hit_hsps> | |
130 <Hsp> | |
131 <Hsp_num>1</Hsp_num> | |
132 <Hsp_bit-score>40.14</Hsp_bit-score> | |
133 <Hsp_score>20</Hsp_score> | |
134 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
135 <Hsp_query-from>1</Hsp_query-from> | |
136 <Hsp_query-to>20</Hsp_query-to> | |
137 <Hsp_hit-from>2143</Hsp_hit-from> | |
138 <Hsp_hit-to>2162</Hsp_hit-to> | |
139 <Hsp_query-frame>1</Hsp_query-frame> | |
140 <Hsp_hit-frame>1</Hsp_hit-frame> | |
141 <Hsp_identity>20</Hsp_identity> | |
142 <Hsp_positive>20</Hsp_positive> | |
143 <Hsp_gaps>0</Hsp_gaps> | |
144 <Hsp_align-len>20</Hsp_align-len> | |
145 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq> | |
146 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq> | |
147 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
148 </Hsp> | |
149 </Hit_hsps> | |
150 </Hit> | |
151 <Hit> | |
152 <Hit_num>2</Hit_num> | |
153 <Hit_id>gnl|BL_ORD_ID|2</Hit_id> | |
154 <Hit_def>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</Hit_def> | |
155 <Hit_accession>2</Hit_accession> | |
156 <Hit_len>323</Hit_len> | |
157 <Hit_hsps> | |
158 <Hsp> | |
159 <Hsp_num>1</Hsp_num> | |
160 <Hsp_bit-score>40.14</Hsp_bit-score> | |
161 <Hsp_score>20</Hsp_score> | |
162 <Hsp_evalue>1.51296e-07</Hsp_evalue> | |
163 <Hsp_query-from>1</Hsp_query-from> | |
164 <Hsp_query-to>20</Hsp_query-to> | |
165 <Hsp_hit-from>224</Hsp_hit-from> | |
166 <Hsp_hit-to>243</Hsp_hit-to> | |
167 <Hsp_query-frame>1</Hsp_query-frame> | |
168 <Hsp_hit-frame>1</Hsp_hit-frame> | |
169 <Hsp_identity>20</Hsp_identity> | |
170 <Hsp_positive>20</Hsp_positive> | |
171 <Hsp_gaps>0</Hsp_gaps> | |
172 <Hsp_align-len>20</Hsp_align-len> | |
173 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq> | |
174 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq> | |
175 <Hsp_midline>||||||||||||||||||||</Hsp_midline> | |
176 </Hsp> | |
177 </Hit_hsps> | |
178 </Hit> | |
179 <Hit> | |
180 <Hit_num>3</Hit_num> | |
181 <Hit_id>gnl|BL_ORD_ID|1</Hit_id> | |
182 <Hit_def>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</Hit_def> | |
183 <Hit_accession>1</Hit_accession> | |
184 <Hit_len>1045</Hit_len> | |
185 <Hit_hsps> | |
186 <Hsp> | |
187 <Hsp_num>1</Hsp_num> | |
188 <Hsp_bit-score>34.1929</Hsp_bit-score> | |
189 <Hsp_score>17</Hsp_score> | |
190 <Hsp_evalue>9.33411e-06</Hsp_evalue> | |
191 <Hsp_query-from>4</Hsp_query-from> | |
192 <Hsp_query-to>20</Hsp_query-to> | |
193 <Hsp_hit-from>2</Hsp_hit-from> | |
194 <Hsp_hit-to>18</Hsp_hit-to> | |
195 <Hsp_query-frame>1</Hsp_query-frame> | |
196 <Hsp_hit-frame>1</Hsp_hit-frame> | |
197 <Hsp_identity>17</Hsp_identity> | |
198 <Hsp_positive>17</Hsp_positive> | |
199 <Hsp_gaps>0</Hsp_gaps> | |
200 <Hsp_align-len>17</Hsp_align-len> | |
201 <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq> | |
202 <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq> | |
203 <Hsp_midline>|||||||||||||||||</Hsp_midline> | |
204 </Hsp> | |
205 </Hit_hsps> | |
206 </Hit> | |
207 </Iteration_hits> | |
208 <Iteration_stat> | |
209 <Statistics> | |
210 <Statistics_db-num>8</Statistics_db-num> | |
211 <Statistics_db-len>15339</Statistics_db-len> | |
212 <Statistics_hsp-len>8</Statistics_hsp-len> | |
213 <Statistics_eff-space>183300</Statistics_eff-space> | |
214 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
215 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
216 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
217 </Statistics> | |
218 </Iteration_stat> | |
219 </Iteration> | |
220 <Iteration> | |
221 <Iteration_iter-num>4</Iteration_iter-num> | |
222 <Iteration_query-ID>Query_4</Iteration_query-ID> | |
223 <Iteration_query-def>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
224 <Iteration_query-len>24</Iteration_query-len> | |
225 <Iteration_hits> | |
226 </Iteration_hits> | |
227 <Iteration_stat> | |
228 <Statistics> | |
229 <Statistics_db-num>8</Statistics_db-num> | |
230 <Statistics_db-len>15339</Statistics_db-len> | |
231 <Statistics_hsp-len>9</Statistics_hsp-len> | |
232 <Statistics_eff-space>229005</Statistics_eff-space> | |
233 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
234 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
235 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
236 </Statistics> | |
237 </Iteration_stat> | |
238 <Iteration_message>No hits found</Iteration_message> | |
239 </Iteration> | |
240 <Iteration> | |
241 <Iteration_iter-num>5</Iteration_iter-num> | |
242 <Iteration_query-ID>Query_5</Iteration_query-ID> | |
243 <Iteration_query-def>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
244 <Iteration_query-len>20</Iteration_query-len> | |
245 <Iteration_hits> | |
246 </Iteration_hits> | |
247 <Iteration_stat> | |
248 <Statistics> | |
249 <Statistics_db-num>8</Statistics_db-num> | |
250 <Statistics_db-len>15339</Statistics_db-len> | |
251 <Statistics_hsp-len>8</Statistics_hsp-len> | |
252 <Statistics_eff-space>183300</Statistics_eff-space> | |
253 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
254 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
255 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
256 </Statistics> | |
257 </Iteration_stat> | |
258 <Iteration_message>No hits found</Iteration_message> | |
259 </Iteration> | |
260 <Iteration> | |
261 <Iteration_iter-num>6</Iteration_iter-num> | |
262 <Iteration_query-ID>Query_6</Iteration_query-ID> | |
263 <Iteration_query-def>Probe|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
264 <Iteration_query-len>25</Iteration_query-len> | |
265 <Iteration_hits> | |
266 <Hit> | |
267 <Hit_num>1</Hit_num> | |
268 <Hit_id>gnl|BL_ORD_ID|7</Hit_id> | |
269 <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def> | |
270 <Hit_accession>7</Hit_accession> | |
271 <Hit_len>4983</Hit_len> | |
272 <Hit_hsps> | |
273 <Hsp> | |
274 <Hsp_num>1</Hsp_num> | |
275 <Hsp_bit-score>36.1753</Hsp_bit-score> | |
276 <Hsp_score>18</Hsp_score> | |
277 <Hsp_evalue>3.14801e-06</Hsp_evalue> | |
278 <Hsp_query-from>1</Hsp_query-from> | |
279 <Hsp_query-to>22</Hsp_query-to> | |
280 <Hsp_hit-from>2344</Hsp_hit-from> | |
281 <Hsp_hit-to>2365</Hsp_hit-to> | |
282 <Hsp_query-frame>1</Hsp_query-frame> | |
283 <Hsp_hit-frame>1</Hsp_hit-frame> | |
284 <Hsp_identity>21</Hsp_identity> | |
285 <Hsp_positive>21</Hsp_positive> | |
286 <Hsp_gaps>0</Hsp_gaps> | |
287 <Hsp_align-len>22</Hsp_align-len> | |
288 <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq> | |
289 <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq> | |
290 <Hsp_midline>|||||||||||||| |||||||</Hsp_midline> | |
291 </Hsp> | |
292 </Hit_hsps> | |
293 </Hit> | |
294 <Hit> | |
295 <Hit_num>2</Hit_num> | |
296 <Hit_id>gnl|BL_ORD_ID|6</Hit_id> | |
297 <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def> | |
298 <Hit_accession>6</Hit_accession> | |
299 <Hit_len>4180</Hit_len> | |
300 <Hit_hsps> | |
301 <Hsp> | |
302 <Hsp_num>1</Hsp_num> | |
303 <Hsp_bit-score>36.1753</Hsp_bit-score> | |
304 <Hsp_score>18</Hsp_score> | |
305 <Hsp_evalue>3.14801e-06</Hsp_evalue> | |
306 <Hsp_query-from>1</Hsp_query-from> | |
307 <Hsp_query-to>22</Hsp_query-to> | |
308 <Hsp_hit-from>1541</Hsp_hit-from> | |
309 <Hsp_hit-to>1562</Hsp_hit-to> | |
310 <Hsp_query-frame>1</Hsp_query-frame> | |
311 <Hsp_hit-frame>1</Hsp_hit-frame> | |
312 <Hsp_identity>21</Hsp_identity> | |
313 <Hsp_positive>21</Hsp_positive> | |
314 <Hsp_gaps>0</Hsp_gaps> | |
315 <Hsp_align-len>22</Hsp_align-len> | |
316 <Hsp_qseq>ACATGAACAGCGCCTTGACCAC</Hsp_qseq> | |
317 <Hsp_hseq>ACATGAACAGCGCCCTGACCAC</Hsp_hseq> | |
318 <Hsp_midline>|||||||||||||| |||||||</Hsp_midline> | |
319 </Hsp> | |
320 </Hit_hsps> | |
321 </Hit> | |
322 </Iteration_hits> | |
323 <Iteration_stat> | |
324 <Statistics> | |
325 <Statistics_db-num>8</Statistics_db-num> | |
326 <Statistics_db-len>15339</Statistics_db-len> | |
327 <Statistics_hsp-len>9</Statistics_hsp-len> | |
328 <Statistics_eff-space>244272</Statistics_eff-space> | |
329 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
330 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
331 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
332 </Statistics> | |
333 </Iteration_stat> | |
334 </Iteration> | |
335 <Iteration> | |
336 <Iteration_iter-num>7</Iteration_iter-num> | |
337 <Iteration_query-ID>Query_7</Iteration_query-ID> | |
338 <Iteration_query-def>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def> | |
339 <Iteration_query-len>74</Iteration_query-len> | |
340 <Iteration_hits> | |
341 <Hit> | |
342 <Hit_num>1</Hit_num> | |
343 <Hit_id>gnl|BL_ORD_ID|7</Hit_id> | |
344 <Hit_def>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</Hit_def> | |
345 <Hit_accession>7</Hit_accession> | |
346 <Hit_len>4983</Hit_len> | |
347 <Hit_hsps> | |
348 <Hsp> | |
349 <Hsp_num>1</Hsp_num> | |
350 <Hsp_bit-score>67.8929</Hsp_bit-score> | |
351 <Hsp_score>34</Hsp_score> | |
352 <Hsp_evalue>3.56369e-15</Hsp_evalue> | |
353 <Hsp_query-from>1</Hsp_query-from> | |
354 <Hsp_query-to>74</Hsp_query-to> | |
355 <Hsp_hit-from>2319</Hsp_hit-from> | |
356 <Hsp_hit-to>2392</Hsp_hit-to> | |
357 <Hsp_query-frame>1</Hsp_query-frame> | |
358 <Hsp_hit-frame>1</Hsp_hit-frame> | |
359 <Hsp_identity>64</Hsp_identity> | |
360 <Hsp_positive>64</Hsp_positive> | |
361 <Hsp_gaps>0</Hsp_gaps> | |
362 <Hsp_align-len>74</Hsp_align-len> | |
363 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq> | |
364 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq> | |
365 <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline> | |
366 </Hsp> | |
367 </Hit_hsps> | |
368 </Hit> | |
369 <Hit> | |
370 <Hit_num>2</Hit_num> | |
371 <Hit_id>gnl|BL_ORD_ID|6</Hit_id> | |
372 <Hit_def>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</Hit_def> | |
373 <Hit_accession>6</Hit_accession> | |
374 <Hit_len>4180</Hit_len> | |
375 <Hit_hsps> | |
376 <Hsp> | |
377 <Hsp_num>1</Hsp_num> | |
378 <Hsp_bit-score>67.8929</Hsp_bit-score> | |
379 <Hsp_score>34</Hsp_score> | |
380 <Hsp_evalue>3.56369e-15</Hsp_evalue> | |
381 <Hsp_query-from>1</Hsp_query-from> | |
382 <Hsp_query-to>74</Hsp_query-to> | |
383 <Hsp_hit-from>1516</Hsp_hit-from> | |
384 <Hsp_hit-to>1589</Hsp_hit-to> | |
385 <Hsp_query-frame>1</Hsp_query-frame> | |
386 <Hsp_hit-frame>1</Hsp_hit-frame> | |
387 <Hsp_identity>64</Hsp_identity> | |
388 <Hsp_positive>64</Hsp_positive> | |
389 <Hsp_gaps>0</Hsp_gaps> | |
390 <Hsp_align-len>74</Hsp_align-len> | |
391 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq> | |
392 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq> | |
393 <Hsp_midline>||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | ||||| ||||||||</Hsp_midline> | |
394 </Hsp> | |
395 </Hit_hsps> | |
396 </Hit> | |
397 </Iteration_hits> | |
398 <Iteration_stat> | |
399 <Statistics> | |
400 <Statistics_db-num>8</Statistics_db-num> | |
401 <Statistics_db-len>15339</Statistics_db-len> | |
402 <Statistics_hsp-len>10</Statistics_hsp-len> | |
403 <Statistics_eff-space>976576</Statistics_eff-space> | |
404 <Statistics_kappa>0.710602795216363</Statistics_kappa> | |
405 <Statistics_lambda>1.37406312246009</Statistics_lambda> | |
406 <Statistics_entropy>1.30724660390929</Statistics_entropy> | |
407 </Statistics> | |
408 </Iteration_stat> | |
409 </Iteration> | |
410 </BlastOutput_iterations> | |
411 </BlastOutput> | |
412 |