Mercurial > repos > jankanis > blast2html

changeset 125:8205546ba86c

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
merge 844d121d0485 so Tool Shed doesn't see multiple heads
author Jan Kanis <jan.code@jankanis.nl>
date Tue, 07 Jul 2015 09:28:08 +0200
parents 6719353162b0 (diff) 844d121d0485 (current diff)
children 0fa962dd83b4
files
diffstat 12 files changed, 9899 insertions(+), 5386 deletions(-) [+]
line wrap: on
line diff
--- a/blast2html.html.jinja	Thu Jul 31 16:49:27 2014 +0200
+++ b/blast2html.html.jinja	Tue Jul 07 09:28:08 2015 +0200
@@ -41,20 +41,28 @@
       }
 
       h1 {
+      font-size: 200%;
+      }
+
+      h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
       border-bottom: 1px solid #CCCCCC;
-      font-size: 150%;
       padding-bottom: 0.1em;
       }
 
-      h2 {
+      h3 {
       font-size: 120%;
       font-weight: bold;
       }
 
-      h4.darkHeader {
+      h5.darkHeader {
       color: #4D4D4D;
       letter-spacing: 0;
       font-weight: bold;
+      font-size: 108%;
       }
 
       #nodata {
@@ -378,17 +386,29 @@
       strips all css, breaking this page but making this warning
       visible. This warning contains some ugly old skool tabular html
       layout that is not stripped. -->
-      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
-                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+      <table bgcolor="#FFE5C9" frame="border"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font></font>
                 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
-      </b></font></td></tr></table>
+      </b></td></tr></table>
     </div>
     
     <div id=content>
 
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          {% for param, value in params %}
+          <tr><td class=param>{{param}}:</td><td>{{value}}</td></tr>
+          {% endfor %}
+        </table>
+
+      </section>
+
       {% if not blast.BlastOutput_iterations.findall('Iteration') %}
       <section class=nodata>
-        <h1>No data</h1>
+        <h2>No data</h2>
         <div class=grey>
           No matches
         </div>
@@ -398,13 +418,12 @@
 
       {% if blast.BlastOutput_iterations.findall('Iteration') | length > 1 %}
       <section class=index>
-        <h1>Queries</h1>
+        <h2>Queries</h2>
 
         {% for result in blast.BlastOutput_iterations.Iteration %}
         <div class=indexentry><a href="#match{{result|nodeid}}">
-            {% set hits = result|hits %}
             {{result['Iteration_query-ID']}}: {{result['Iteration_query-def']}}
-            ({{result|len}} letters, {{hits|length}} hits)
+            ({{result|len}} letters, {{result|hits|length}} hits)
         </a></div>
         {% endfor %}
 
@@ -415,12 +434,12 @@
       
       <section class=match id=match{{result|nodeid}}>
       
-        <h1>Nucleotide Sequence ({{result|len}} letters)</h1>
+        <h2>Nucleotide Sequence ({{result|len}} letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            {% for param, value in params %}
+            {% for param, value in result|params %}
             <tr><td class=param>{{param}}:</td><td>{{value}}</td></tr>
             {% endfor %}
           </table>
@@ -430,7 +449,7 @@
         {% set hits = result|hits %}
         {% if not hits %}
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>{{result.Iteration_message}}</td></tr>
@@ -440,23 +459,23 @@
         {% else %}
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of {{result|length}} Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of {{result|length}} Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline{{result|nodeid}}>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: {{colors[0]}}">&lt;40</div>
                   <div class=graphicitem style="background-color: {{colors[1]}}">40–50</div>
                   <div class=graphicitem style="background-color: {{colors[2]}}">50–80</div>
                   <div class=graphicitem style="background-color: {{colors[3]}}">80–200</div>
-                  <div class=graphicitem style="background-color: {{colors[4]}}">200≤</div>
+                  <div class=graphicitem style="background-color: {{colors[4]}}">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -504,10 +523,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -532,7 +551,7 @@
                   <td>{{hit.cover}}</td>
                   <td>{{hit.e_value}}</td>
                   <td>{{hit.ident}}</td>
-                  <td><a href="{{genelink(hit.hit|hitid)}}">{{hit.accession}}</a></td>
+                  <td>{{hit.hit|genelink(hit.hit.Hit_accession)}}</td>
                 </tr>
                 {% endfor %}
               </table>
@@ -543,7 +562,7 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               {% for hit in hits %}
@@ -551,14 +570,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description{{hit|nodeid}}">Descriptions</a></div>
-                  <a class=linkheader href="{{genelink(hit|hitid)}}">GenBank</a>
-                  <a class=linkheader href="{{genelink(hit|hitid, 'graph')}}">Graphics</a>
+                  {{ hit|genelink(text_from='dbname', cssclass='linkheader', display_nolink=False) }}
                 </div>
 
                 <div class=title>
                   <p class=hittitle>{{hit|firsttitle}}</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="{{genelink(hit|hitid)}}">{{hit|seqid}}</a>
+                    <span class=b>Sequence ID:</span> {{ hit|genelink }}
                     <span class=b>Length:</span> {{hit.Hit_len}}
                     <span class=b>Number of Matches:</span> {{hit.Hit_hsps.Hsp|length}}
                   </p>
@@ -572,9 +590,9 @@
                 <div class=moretitles id=moretitles{{hit|nodeid}} style="display: none">
                   {% for title in hit|othertitles %}
                   <div class=title>
-                    <p class=hittitle>{{title.title}}</p>
+                    <p class=hittitle>{{title.Hit_def}}</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="{{genelink(title.hitid)}}">{{title.id}}</a>
+                      <span class=b>Sequence ID:</span> {{ title|genelink }}
                     </p>
                   </div>
                   {% endfor %}
@@ -585,8 +603,6 @@
                 <div class=hotspot id=hotspot{{hsp|nodeid}}>
                   <p class=range>
                     <span class=range>Range {{hsp.Hsp_num}}: {{hsp['Hsp_hit-from']}} to {{hsp['Hsp_hit-to']}}</span>
-                    <a class=range href="{{genelink(hit|hitid, 'genbank', hsp)}}">GenBank</a>
-                    <a class=range href="{{genelink(hit|hitid, 'graph', hsp)}}">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -594,12 +610,12 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>{{hsp['Hsp_bit-score']|fmt('.1f')}} bits({{hsp.Hsp_score}})</td>
-                      <td>{{hsp.Hsp_evalue|fmt('.1f')}}</td>
-                      <td>{{ hsp.Hsp_identity }}/{{ hsp|len }}({{
+                      <td>{{hsp['Hsp_bit-score']}} bits ({{hsp.Hsp_score}})</td>
+                      <td>{{hsp.Hsp_evalue}}</td>
+                      <td>{{ hsp.Hsp_identity }}/{{ hsp|len }} ({{
                         ((hsp.Hsp_identity|float)/hsp|len) | fmt('.0%') }})</td>
                       <td>{{ hsp.Hsp_gaps }}/{{ hsp|len
-                        }}({{ ((hsp.Hsp_gaps|float) / hsp|len) | fmt('.0%') }})</td>
+                        }} ({{ ((hsp.Hsp_gaps|float) / hsp|len) | fmt('.0%') }})</td>
                       <td>{{ hsp['Hsp_query-frame']|asframe }}/{{ hsp['Hsp_hit-frame']|asframe }}</td>
                     </tr>
                   </table>
--- a/blast2html.py	Thu Jul 31 16:49:27 2014 +0200
+++ b/blast2html.py	Tue Jul 07 09:28:08 2015 +0200
@@ -11,14 +11,20 @@
 import sys
 import math
 import warnings
-import six, codecs
+import six, codecs, io
 from six.moves import builtins
 from os import path
 from itertools import repeat
+from collections import defaultdict, namedtuple
+from array import array
+import glob
 import argparse
 from lxml import objectify
 import jinja2
 
+builtin_str = str
+str = six.text_type
+
 
 
 _filters = dict(float='float')
@@ -66,38 +72,25 @@
 
 @filter
 def firsttitle(hit):
-    return hit.Hit_def.text.split('>')[0]
+    return str(hit.Hit_def).split('>')[0]
 
 @filter
 def othertitles(hit):
     """Split a hit.Hit_def that contains multiple titles up, splitting out the hit ids from the titles."""
-    id_titles = hit.Hit_def.text.split('>')
+    id_titles = str(hit.Hit_def).split('>')
 
     titles = []
     for t in id_titles[1:]:
-        fullid, title = t.split(' ', 1)
-        hitid, id = fullid.split('|', 2)[1:3]
-        titles.append(dict(id = id,
-                           hitid = hitid,
-                           fullid = fullid,
-                           title = title))
+        id, title = t.split(' ', 1)
+        titles.append(argparse.Namespace(Hit_id = id,
+                                         Hit_def = title,
+                                         Hit_accession = '',
+                                         getroottree = hit.getroottree))
     return titles
 
 @filter
 def hitid(hit):
-    hitid = hit.Hit_id.text
-    s = hitid.split('|', 2)
-    if len(s) >= 2:
-        return s[1]
-    return hitid
-
-@filter
-def seqid(hit):
-    hitid = hit.Hit_id.text
-    s = hitid.split('|', 2)
-    if len(s) >= 3:
-        return s[2]
-    return hitid
+    return str(hit.Hit_id)
 
 
 @filter
@@ -177,13 +170,13 @@
         return 'Minus'
     raise Exception("frame should be either +1 or -1")
 
-def genelink(hit, type='genbank', hsp=None):
-    if not isinstance(hit, six.string_types):
-        hit = hitid(hit)
-    link = "http://www.ncbi.nlm.nih.gov/nucleotide/{0}?report={1}&log$=nuclalign".format(hit, type)
-    if hsp != None:
-        link += "&from={0}&to={1}".format(hsp['Hsp_hit-from'], hsp['Hsp_hit-to'])
-    return link
+# def genelink(hit, type='genbank', hsp=None):
+#     if not isinstance(hit, six.string_types):
+#         hit = hitid(hit)
+#     link = "http://www.ncbi.nlm.nih.gov/nucleotide/{0}?report={1}&log$=nuclalign".format(hit, type)
+#     if hsp != None:
+#         link += "&from={0}&to={1}".format(hsp['Hsp_hit-from'], hsp['Hsp_hit-to'])
+#     return link
 
 
 # javascript escape filter based on Django's, from https://github.com/dsissitka/khan-website/blob/master/templatefilters.py#L112-139
@@ -218,7 +211,7 @@
     javascript snippets.
     """
 
-    value = six.text_type(value)
+    value = str(value)
 
     for bad, good in _js_escapes:
         value = value.replace(bad, good)
@@ -227,11 +220,15 @@
 
 @filter
 def hits(result):
-    # sort hits by longest hotspot first
-    return sorted(result.Iteration_hits.findall('Hit'),
-                  key=lambda h: max(blastxml_len(hsp) for hsp in h.Hit_hsps.Hsp),
-                  reverse=True)
+    # Use findall so we get an empty list if there are no Hit elements at all
+    return result.Iteration_hits.findall('Hit')
 
+@filter('params')
+def result_params(iteration):
+    return (('Query number', iteration['Iteration_iter-num']),
+            ('Query ID', iteration['Iteration_query-ID']),
+            ('Definition line', iteration['Iteration_query-def']),
+            ('Length', blastxml_len(iteration)))
 
 
 class BlastVisualize:
@@ -240,9 +237,10 @@
 
     max_scale_labels = 10
 
-    def __init__(self, input, templatedir, templatename):
+    def __init__(self, input, templatedir, templatename, genelinks):
         self.input = input
         self.templatename = templatename
+        self.genelinks = genelinks
 
         self.blast = objectify.parse(self.input).getroot()
         self.loader = jinja2.FileSystemLoader(searchpath=templatedir)
@@ -265,21 +263,16 @@
     def render(self, output):
         template = self.environment.get_template(self.templatename)
 
-        params = (('Query ID', self.blast["BlastOutput_query-ID"]),
-                  ('Query definition', self.blast["BlastOutput_query-def"]),
-                  ('Query length', self.blast["BlastOutput_query-len"]),
-                  ('Program', self.blast.BlastOutput_version),
+        params = (('Program', self.blast.BlastOutput_version),
                   ('Database', self.blast.BlastOutput_db),
         )
 
-        result = template.render(blast=self.blast,
+        result = template.stream(blast=self.blast,
                                  iterations=self.blast.BlastOutput_iterations.Iteration,
                                  colors=self.colors,
-                                 genelink=genelink,
                                  params=params)
-        if six.PY2:
-            result = result.encode('utf-8')
-        output.write(result)
+
+        result.dump(output)
 
     @filter
     def match_colors(self, result):
@@ -335,31 +328,97 @@
         for hit in hits(result):
             hsps = hit.Hit_hsps.Hsp
 
-            cover = [False] * query_length
+            # In python 2.6 array doesn't accept unicode type codes, but in 3.4 it requires them
+            typecode_B = builtin_str('B')
+            cover = array(typecode_B, [0]) * query_length
             for hsp in hsps:
-                cover[hsp['Hsp_query-from']-1 : int(hsp['Hsp_query-to'])] = repeat(True, blastxml_len(hsp))
-            cover_count = cover.count(True)
+                cover[hsp['Hsp_query-from']-1 : int(hsp['Hsp_query-to'])] = array(typecode_B, [1]) * blastxml_len(hsp)
+            cover_count = cover.count(1)
 
-            def hsp_val(path):
-                return (float(hsp[path]) for hsp in hsps)
+            best_hsp = max(hsps, key=lambda h: h['Hsp_bit-score'])
 
             yield dict(hit = hit,
                        title = firsttitle(hit),
-                       maxscore = "{0:.1f}".format(max(hsp_val('Hsp_bit-score'))),
-                       totalscore = "{0:.1f}".format(sum(hsp_val('Hsp_bit-score'))),
-                       cover = "{0:.0%}".format(cover_count / query_length),
-                       e_value = "{0:.4g}".format(min(hsp_val('Hsp_evalue'))),
-                       # FIXME: is this the correct formula vv?
+                       maxscore = format(float(best_hsp['Hsp_bit-score']), '.1f'),
+                       e_value = format(float(best_hsp.Hsp_evalue), '.4'),
                        # float(...) because non-flooring division doesn't work with lxml elements in python 2.6
-                       ident = "{0:.0%}".format(float(min(float(hsp.Hsp_identity) / blastxml_len(hsp) for hsp in hsps))),
-                       accession = hit.Hit_accession)
+                       ident = format(float(best_hsp.Hsp_identity) / blastxml_len(best_hsp), '.0%'),
+                       totalscore = format(sum(hsp['Hsp_bit-score'] for hsp in hsps), '.1f'),
+                       cover = format(cover_count / query_length, '.0%'),
+                  )
+
+    @filter
+    def genelink(self, hit, text=None, text_from='hitid', cssclass=None, display_nolink=True):
+        """Create a html link from a hit node to a configured gene bank webpage.
+        text: The text of the link. If not set applies text_from.
+        text_from: string, if text is not specified, take it from specified source. Either 'hitid' (default) or 'dbname'.
+        cssclass: extra css classes that will be added to the <a> element
+        display_nolink: boolean, if false don't display anything if no link can be created. Default True.
+        """
+        
+        db = hit.getroottree().getroot().BlastOutput_db
+
+        template = self.genelinks[db].template
+
+        if text is None:
+            if text_from == 'hitid':
+                text = hitid(hit)
+            elif text_from == 'dbname':
+                text = self.genelinks[db].dbname
+            else:
+                raise ValueError("Unknown value for text_from: '{0}'. Use 'hitid' or 'dbname'.".format(text_from))
+
+        if template is None:
+            return text if display_nolink else ''
+
+        args = dict(id=hitid(hit).split('|'),
+                    fullid=hitid(hit),
+                    defline=str(hit.Hit_def).split(' ', 1)[0].split('|'),
+                    fulldefline=str(hit.Hit_def).split(' ', 1)[0],
+                    accession=str(hit.Hit_accession))
+        try:
+            link = template.format(**args)
+        except Exception as e:
+            warnings.warn('Error in formatting gene bank link {} with {}: {}'.format(template, args, e))
+            return text if display_nolink else ''
+
+        classattr = 'class="{0}" '.format(jinja2.escape(cssclass)) if cssclass is not None else ''
+        return jinja2.Markup("<a {0}target=\"_top\" href=\"{1}\">{2}</a>".format(classattr, jinja2.escape(link), jinja2.escape(text)))
+
+
+genelinks_entry = namedtuple('genelinks_entry', 'dbname template')
+def read_blastdb(dir, default):
+    links = defaultdict(lambda: default)
+    # blastdb.loc, blastdb_p.loc, blastdb_d.loc, etc.
+    files = sorted(glob.glob(path.join(dir, 'blastdb*.loc')))
+    # reversed, so blastdb.loc will take precedence
+    for f in reversed(files):
+        try:
+            f = open(path.join(dir, f))
+            for l in f.readlines():
+                if l.strip().startswith('#'):
+                    continue
+                line = l.rstrip('\n').split('\t')
+                try:
+                    links[line[2]] = genelinks_entry(dbname=line[3] or default.dbname, template=line[4])
+                except IndexError:
+                    continue
+            f.close()
+        except OSError:
+            continue
+    if not links:
+        if not files:
+            warnings.warn("No gene bank link templates found (no blastdb*.loc files found in {0})".format(dir))
+        else:
+            warnings.warn("No gene bank link templates found in {0}".format(', '.join(files)))
+    return links
 
 
 def main():
     default_template = path.join(path.dirname(__file__), 'blast2html.html.jinja')
 
     parser = argparse.ArgumentParser(description="Convert a BLAST XML result into a nicely readable html page",
-                                     usage="{0} [-i] INPUT [-o OUTPUT]".format(sys.argv[0]))
+                                     usage="{0} [-i] INPUT [-o OUTPUT] [--genelink-template URL_TEMPLATE] [--dbname DBNAME]".format(sys.argv[0]))
     input_group = parser.add_mutually_exclusive_group(required=True)
     input_group.add_argument('positional_arg', metavar='INPUT', nargs='?', type=argparse.FileType(mode='r'),
                              help='The input Blast XML file, same as -i/--input')
@@ -375,19 +434,69 @@
     parser.add_argument('--template', type=argparse.FileType(mode='r'), default=default_template,
                         help='The template file to use. Defaults to blast_html.html.jinja')
 
+    parser.add_argument('--dbname', type=str, default='Gene Bank',
+                        help="The link text to use for external links to a gene bank database. Defaults to 'Gene Bank'")
+    parser.add_argument('--genelink-template', metavar='URL_TEMPLATE',
+                        default='http://www.ncbi.nlm.nih.gov/nucleotide/{accession}?report=genbank&log$=nuclalign',
+                        help="""A link template to link hits to a gene bank webpage. The template string is a 
+                        Python format string. It can contain the following replacement elements: {id[N]}, {fullid}, 
+                        {defline[N]}, {fulldefline}, {accession}, where N is a number. id[N] and defline[N] will be 
+                        replaced by the Nth element of the id or defline, where '|' is the field separator. 
+                        
+                        The default is 'http://www.ncbi.nlm.nih.gov/nucleotide/{accession}?report=genbank&log$=nuclalign',
+                        which is a link to the NCBI nucleotide database.""")
+
+    parser.add_argument('--db-config-dir',
+                        help="""The directory where databases are configured in blastdb*.loc files. These files
+                        are consulted for creating a gene bank link. The files should conform to the format that
+                        Galaxy's BLAST expect, i.e. tab-separated tables (with lines starting with '#' ignored),
+                        with two extra fields. The third field of a line should be a database path and the fourth
+                        a genebank link template conforming to the --genelink-template option syntax. Entries in
+                        these config files override links specified using --genelink-template and --dbname.""")
+    
     args = parser.parse_args()
     if args.input == None:
         args.input = args.positional_arg
     if args.input == None:
         parser.error('no input specified')
 
+    if six.PY2:
+        # The argparse.FileType wrapper doesn't support an encoding
+        # argument, so for python 2 we need to wrap or reopen the
+        # output. The input files are already read as utf-8 by the
+        # respective libraries.
+        #
+        # One option is using codecs, but the codecs' writelines()
+        # method doesn't support streaming but collects all output and
+        # writes at once (see Python issues #5445 and #21910). On the
+        # other hand the io module is slower (though not
+        # significantly).
+
+        # args.output = codecs.getwriter('utf-8')(args.output)
+        # def fixed_writelines(iter, self=args.output):
+        #     for i in iter:
+        #         self.write(i)
+        # args.output.writelines = fixed_writelines
+
+        args.output.close()
+        args.output = io.open(args.output.name, 'w', encoding='utf-8')
+
     templatedir, templatename = path.split(args.template.name)
     args.template.close()
     if not templatedir:
         templatedir = '.'
 
-    b = BlastVisualize(args.input, templatedir, templatename)
+    defaultentry = genelinks_entry(args.dbname, args.genelink_template)
+    if args.db_config_dir is None:
+        genelinks = defaultdict(lambda: defaultentry)
+    elif not path.isdir(args.db_config_dir):
+        parser.error('db-config-dir does not exist or is not a directory')
+    else:
+        genelinks = read_blastdb(args.db_config_dir, default=defaultentry)
+
+    b = BlastVisualize(args.input, templatedir, templatename, genelinks=genelinks)
     b.render(args.output)
+    args.output.close()
 
 
 if __name__ == '__main__':
--- a/blast2html.xml	Thu Jul 31 16:49:27 2014 +0200
+++ b/blast2html.xml	Tue Jul 07 09:28:08 2015 +0200
@@ -1,4 +1,4 @@
-<tool id="blast2html" name="blast2html" version="0.0.10">
+<tool id="blast2html" name="blast2html" version="0.0.14">
     
     <description>Convert BLAST XML to HTML</description>
     
@@ -6,7 +6,7 @@
       <requirement name="package" version="0.2">blast2html_venv</requirement>
     </requirements>
     
-    <command interpreter="python">blast2html.py -i "${input}" -o "${output}"</command>
+    <command interpreter="python">blast2html.py -i "${input}" -o "${output}" --db-config-dir "${GALAXY_DATA_INDEX_DIR}"</command>
 
     <stdio>
       <!-- Any exit code other than 0 is an error -->
@@ -25,19 +25,19 @@
     <tests>
         <test>
             <param name="input" value="blast xml example1.xml"/>
-            <output name="out_file1" file="blast xml example1.html"/>
+            <output name="output" file="blast xml example1.html"/>
         </test>
         <test>
             <param name="input" value="blast xml example2.xml"/>
-            <output name="out_file1" file="blast xml example2.html"/>
+            <output name="output" file="blast xml example2.html"/>
         </test>
         <test>
             <param name="input" value="blast xml example3.xml"/>
-            <output name="out_file1" file="blast xml example3.html"/>
+            <output name="output" file="blast xml example3.html"/>
         </test>
         <test>
             <param name="input" value="blast xml example4.xml"/>
-            <output name="out_file1" file="blast xml example4.html"/>
+            <output name="output" file="blast xml example4.html"/>
         </test>
     </tests>
     
--- a/test-data/blast xml example1.html	Thu Jul 31 16:49:27 2014 +0200
+++ b/test-data/blast xml example1.html	Tue Jul 07 09:28:08 2015 +0200
@@ -40,20 +40,28 @@
       }
 
       h1 {
-      border-bottom: 1px solid #CCCCCC;
-      font-size: 150%;
-      padding-bottom: 0.1em;
+      font-size: 200%;
       }
 
       h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
+      border-bottom: 1px solid #CCCCCC;
+      padding-bottom: 0.1em;
+      }
+
+      h3 {
       font-size: 120%;
       font-weight: bold;
       }
 
-      h4.darkHeader {
+      h5.darkHeader {
       color: #4D4D4D;
       letter-spacing: 0;
       font-weight: bold;
+      font-size: 108%;
       }
 
       #nodata {
@@ -385,44 +393,54 @@
     
     <div id=content>
 
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+          <tr><td class=param>Database:</td><td>pdb</td></tr>
+        </table>
+
+      </section>
+
 
 
       
       <section class=match id=match1>
       
-        <h1>Nucleotide Sequence (16 letters)</h1>
+        <h2>Nucleotide Sequence (16 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
             <tr><td class=param>Query ID:</td><td>106397</td></tr>
-            <tr><td class=param>Query definition:</td><td>No definition line</td></tr>
-            <tr><td class=param>Query length:</td><td>16</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>pdb</td></tr>
+            <tr><td class=param>Definition line:</td><td>No definition line</td></tr>
+            <tr><td class=param>Length:</td><td>16</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 1 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 1 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline1>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -739,32 +757,6 @@
                 </a>
 
                 <a class=matchresult
-                   href="#hit1-30"
-                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)"'
-                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
-                   title="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)">
-                  <div class="matchrow graphicrow">
-                    <div class="matchitem graphicitem"
-                         style="background-color: black; width: 81.25%"></div>
-                    <div class="matchitem graphicitem"
-                         style="background-color: transparent; width: 18.75%"></div>
-                  </div>
-                </a>
-
-                <a class=matchresult
-                   href="#hit1-35"
-                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)"'
-                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
-                   title="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)">
-                  <div class="matchrow graphicrow">
-                    <div class="matchitem graphicitem"
-                         style="background-color: black; width: 81.25%"></div>
-                    <div class="matchitem graphicitem"
-                         style="background-color: transparent; width: 18.75%"></div>
-                  </div>
-                </a>
-
-                <a class=matchresult
                    href="#hit1-26"
                    onmouseover='document.getElementById("defline1").innerHTML="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome"'
                    onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
@@ -819,6 +811,19 @@
                 </a>
 
                 <a class=matchresult
+                   href="#hit1-30"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
                    href="#hit1-31"
                    onmouseover='document.getElementById("defline1").innerHTML="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins"'
                    onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
@@ -869,6 +874,19 @@
                 </a>
 
                 <a class=matchresult
+                   href="#hit1-35"
+                   onmouseover='document.getElementById("defline1").innerHTML="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 81.25%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 18.75%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
                    href="#hit1-36"
                    onmouseover='document.getElementById("defline1").innerHTML="Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit"'
                    onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
@@ -1823,10 +1841,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1850,7 +1868,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">3J5K_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5K_A?report=genbank&amp;log$=nuclalign">3J5K_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-2"
@@ -1863,7 +1881,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">3J5I_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5I_A?report=genbank&amp;log$=nuclalign">3J5I_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-3"
@@ -1876,7 +1894,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">3J5G_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5G_A?report=genbank&amp;log$=nuclalign">3J5G_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-4"
@@ -1889,7 +1907,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">3J5E_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5E_A?report=genbank&amp;log$=nuclalign">3J5E_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-5"
@@ -1902,7 +1920,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">3J5C_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5C_A?report=genbank&amp;log$=nuclalign">3J5C_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-6"
@@ -1915,7 +1933,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">3J5A_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5A_A?report=genbank&amp;log$=nuclalign">3J5A_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-7"
@@ -1928,7 +1946,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">3J58_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J58_A?report=genbank&amp;log$=nuclalign">3J58_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-8"
@@ -1941,7 +1959,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">3J56_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J56_A?report=genbank&amp;log$=nuclalign">3J56_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-9"
@@ -1954,7 +1972,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">3J54_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J54_A?report=genbank&amp;log$=nuclalign">3J54_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-10"
@@ -1967,7 +1985,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">3J52_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J52_A?report=genbank&amp;log$=nuclalign">3J52_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-11"
@@ -1980,7 +1998,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">3J51_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J51_A?report=genbank&amp;log$=nuclalign">3J51_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-12"
@@ -1993,7 +2011,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">3J50_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J50_A?report=genbank&amp;log$=nuclalign">3J50_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-13"
@@ -2006,7 +2024,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">3J4X_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J4X_A?report=genbank&amp;log$=nuclalign">3J4X_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-14"
@@ -2019,7 +2037,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">3J37_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J37_A?report=genbank&amp;log$=nuclalign">3J37_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-15"
@@ -2032,7 +2050,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">3IZT_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZT_B?report=genbank&amp;log$=nuclalign">3IZT_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-16"
@@ -2045,7 +2063,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">3FIK_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3FIK_B?report=genbank&amp;log$=nuclalign">3FIK_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-17"
@@ -2058,7 +2076,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">3E1B_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3E1B_B?report=genbank&amp;log$=nuclalign">3E1B_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-18"
@@ -2071,7 +2089,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">2GYC_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYC_0?report=genbank&amp;log$=nuclalign">2GYC_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-19"
@@ -2084,7 +2102,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">2GYA_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYA_0?report=genbank&amp;log$=nuclalign">2GYA_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-20"
@@ -2097,7 +2115,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">2I2V_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2I2V_B?report=genbank&amp;log$=nuclalign">2I2V_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-21"
@@ -2110,7 +2128,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">2AW4_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AW4_B?report=genbank&amp;log$=nuclalign">2AW4_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-22"
@@ -2123,7 +2141,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">2AWB_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AWB_B?report=genbank&amp;log$=nuclalign">2AWB_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-23"
@@ -2136,7 +2154,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">1VS6_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1VS6_B?report=genbank&amp;log$=nuclalign">1VS6_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-24"
@@ -2149,7 +2167,7 @@
                   <td>100%</td>
                   <td>0.0007913</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">1P85_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1P85_0?report=genbank&amp;log$=nuclalign">1P85_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-25"
@@ -2162,7 +2180,59 @@
                   <td>81%</td>
                   <td>0.04882</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">1C2W_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1C2W_B?report=genbank&amp;log$=nuclalign">1C2W_B</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-26"
+                              title="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome"
+                              id="description1-26">
+                        Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>77.8</td>
+                  <td>88%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J62_AA?report=genbank&amp;log$=nuclalign">3J62_AA</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-27"
+                              title="Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome"
+                              id="description1-27">
+                        Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>18.3</td>
+                  <td>56%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4CE4_A?report=genbank&amp;log$=nuclalign">4CE4_A</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-28"
+                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
+                              id="description1-28">
+                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYP_5?report=genbank&amp;log$=nuclalign">4BYP_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-29"
+                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
+                              id="description1-29">
+                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>79.8</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYW_5?report=genbank&amp;log$=nuclalign">4BYW_5</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-30"
@@ -2175,7 +2245,59 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>92%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">3J44_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J44_1?report=genbank&amp;log$=nuclalign">3J44_1</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-31"
+                              title="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins"
+                              id="description1-31">
+                        Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>51.0</td>
+                  <td>75%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4HUB_0?report=genbank&amp;log$=nuclalign">4HUB_0</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-32"
+                              title="Chain 5, Structure Of The H. Sapiens 60s Rrna"
+                              id="description1-32">
+                        Chain 5, Structure Of The H. Sapiens 60s Rrna
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>128.8</td>
+                  <td>100%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3F_5?report=genbank&amp;log$=nuclalign">3J3F_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-33"
+                              title="Chain 5, Structure Of The D. Melanogaster 60s Rrna"
+                              id="description1-33">
+                        Chain 5, Structure Of The D. Melanogaster 60s Rrna
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>63.4</td>
+                  <td>100%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3E_5?report=genbank&amp;log$=nuclalign">3J3E_5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-34"
+                              title="Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome"
+                              id="description1-34">
+                        Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome
+                  </a></div></td>
+                  <td>18.3</td>
+                  <td>32.7</td>
+                  <td>81%</td>
+                  <td>11.9</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3ZEX_B?report=genbank&amp;log$=nuclalign">3ZEX_B</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-35"
@@ -2188,111 +2310,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>92%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">3J2L_1</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-26"
-                              title="Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome"
-                              id="description1-26">
-                        Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>77.8</td>
-                  <td>88%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">3J62_AA</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-27"
-                              title="Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome"
-                              id="description1-27">
-                        Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>18.3</td>
-                  <td>56%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">4CE4_A</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-28"
-                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
-                              id="description1-28">
-                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>79.8</td>
-                  <td>81%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">4BYP_5</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-29"
-                              title="Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex"
-                              id="description1-29">
-                        Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>79.8</td>
-                  <td>81%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">4BYW_5</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-31"
-                              title="Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins"
-                              id="description1-31">
-                        Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>51.0</td>
-                  <td>75%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">4HUB_0</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-32"
-                              title="Chain 5, Structure Of The H. Sapiens 60s Rrna"
-                              id="description1-32">
-                        Chain 5, Structure Of The H. Sapiens 60s Rrna
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>128.8</td>
-                  <td>100%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">3J3F_5</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-33"
-                              title="Chain 5, Structure Of The D. Melanogaster 60s Rrna"
-                              id="description1-33">
-                        Chain 5, Structure Of The D. Melanogaster 60s Rrna
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>63.4</td>
-                  <td>100%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">3J3E_5</a></td>
-                </tr>
-                <tr>
-                  <td><div><a href="#hit1-34"
-                              title="Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome"
-                              id="description1-34">
-                        Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome
-                  </a></div></td>
-                  <td>18.3</td>
-                  <td>32.7</td>
-                  <td>81%</td>
-                  <td>11.9</td>
-                  <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">3ZEX_B</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J2L_1?report=genbank&amp;log$=nuclalign">3J2L_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-36"
@@ -2305,7 +2323,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">3OW2_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3OW2_0?report=genbank&amp;log$=nuclalign">3OW2_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-37"
@@ -2318,7 +2336,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">4ADX_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4ADX_0?report=genbank&amp;log$=nuclalign">4ADX_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-38"
@@ -2331,7 +2349,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">3U5F_6</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5F_6?report=genbank&amp;log$=nuclalign">3U5F_6</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-39"
@@ -2344,7 +2362,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">3U5B_2</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5B_2?report=genbank&amp;log$=nuclalign">3U5B_2</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-40"
@@ -2357,7 +2375,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">4A1D_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1D_1?report=genbank&amp;log$=nuclalign">4A1D_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-41"
@@ -2370,7 +2388,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">4A18_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A18_1?report=genbank&amp;log$=nuclalign">4A18_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-42"
@@ -2383,7 +2401,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">4A1B_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1B_1?report=genbank&amp;log$=nuclalign">4A1B_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-43"
@@ -2396,7 +2414,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">3J0L_8</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0L_8?report=genbank&amp;log$=nuclalign">3J0L_8</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-44"
@@ -2409,7 +2427,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">3J0O_8</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0O_8?report=genbank&amp;log$=nuclalign">3J0O_8</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-45"
@@ -2422,7 +2440,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">3O58_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O58_1?report=genbank&amp;log$=nuclalign">3O58_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-46"
@@ -2435,7 +2453,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">3O5H_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O5H_1?report=genbank&amp;log$=nuclalign">3O5H_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-47"
@@ -2448,7 +2466,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">3O2Z_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O2Z_1?report=genbank&amp;log$=nuclalign">3O2Z_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-48"
@@ -2461,7 +2479,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">3O30_1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O30_1?report=genbank&amp;log$=nuclalign">3O30_1</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-49"
@@ -2474,7 +2492,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">3IZF_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZF_A?report=genbank&amp;log$=nuclalign">3IZF_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-50"
@@ -2487,7 +2505,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">3IZE_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZE_A?report=genbank&amp;log$=nuclalign">3IZE_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-51"
@@ -2500,7 +2518,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">3KO2_I</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_I?report=genbank&amp;log$=nuclalign">3KO2_I</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-52"
@@ -2513,7 +2531,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">3KO2_H</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_H?report=genbank&amp;log$=nuclalign">3KO2_H</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-53"
@@ -2526,7 +2544,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">3KO2_D</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_D?report=genbank&amp;log$=nuclalign">3KO2_D</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-54"
@@ -2539,7 +2557,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">3KO2_C</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_C?report=genbank&amp;log$=nuclalign">3KO2_C</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-55"
@@ -2552,7 +2570,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">3I56_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3I56_0?report=genbank&amp;log$=nuclalign">3I56_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-56"
@@ -2565,7 +2583,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">3JYX_5</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYX_5?report=genbank&amp;log$=nuclalign">3JYX_5</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-57"
@@ -2578,7 +2596,7 @@
                   <td>88%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">3JYV_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYV_A?report=genbank&amp;log$=nuclalign">3JYV_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-58"
@@ -2591,7 +2609,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">1S1I_3</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S1I_3?report=genbank&amp;log$=nuclalign">1S1I_3</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-59"
@@ -2604,7 +2622,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">2QEX_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QEX_0?report=genbank&amp;log$=nuclalign">2QEX_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-60"
@@ -2617,7 +2635,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">3CPW_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CPW_0?report=genbank&amp;log$=nuclalign">3CPW_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-61"
@@ -2630,7 +2648,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">3CCV_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCV_0?report=genbank&amp;log$=nuclalign">3CCV_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-62"
@@ -2643,7 +2661,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">3CCU_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCU_0?report=genbank&amp;log$=nuclalign">3CCU_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-63"
@@ -2656,7 +2674,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">3CCS_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCS_0?report=genbank&amp;log$=nuclalign">3CCS_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-64"
@@ -2669,7 +2687,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">3CCR_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCR_0?report=genbank&amp;log$=nuclalign">3CCR_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-65"
@@ -2682,7 +2700,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">3CCQ_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCQ_0?report=genbank&amp;log$=nuclalign">3CCQ_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-66"
@@ -2695,7 +2713,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">3CCM_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCM_0?report=genbank&amp;log$=nuclalign">3CCM_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-67"
@@ -2708,7 +2726,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">3CCL_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCL_0?report=genbank&amp;log$=nuclalign">3CCL_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-68"
@@ -2721,7 +2739,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">3CCJ_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCJ_0?report=genbank&amp;log$=nuclalign">3CCJ_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-69"
@@ -2734,7 +2752,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">3CCE_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCE_0?report=genbank&amp;log$=nuclalign">3CCE_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-70"
@@ -2747,7 +2765,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">3CC7_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC7_0?report=genbank&amp;log$=nuclalign">3CC7_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-71"
@@ -2760,7 +2778,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">3CC2_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC2_0?report=genbank&amp;log$=nuclalign">3CC2_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-72"
@@ -2773,7 +2791,7 @@
                   <td>81%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">2ZKR_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2ZKR_0?report=genbank&amp;log$=nuclalign">2ZKR_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-73"
@@ -2786,7 +2804,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">2QA4_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QA4_0?report=genbank&amp;log$=nuclalign">2QA4_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-74"
@@ -2799,7 +2817,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">2FTC_R</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2FTC_R?report=genbank&amp;log$=nuclalign">2FTC_R</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-75"
@@ -2812,7 +2830,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">1S72_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S72_0?report=genbank&amp;log$=nuclalign">1S72_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-76"
@@ -2825,7 +2843,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">1YIT_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YIT_0?report=genbank&amp;log$=nuclalign">1YIT_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-77"
@@ -2838,7 +2856,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">1YHQ_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YHQ_0?report=genbank&amp;log$=nuclalign">1YHQ_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-78"
@@ -2851,7 +2869,7 @@
                   <td>75%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">1YJW_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YJW_0?report=genbank&amp;log$=nuclalign">1YJW_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-79"
@@ -2864,7 +2882,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">1Q86_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1Q86_A?report=genbank&amp;log$=nuclalign">1Q86_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-80"
@@ -2877,7 +2895,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">1JJ2_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1JJ2_0?report=genbank&amp;log$=nuclalign">1JJ2_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-81"
@@ -2890,7 +2908,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">1KC8_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1KC8_A?report=genbank&amp;log$=nuclalign">1KC8_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-82"
@@ -2903,7 +2921,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">1FFK_0</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFK_0?report=genbank&amp;log$=nuclalign">1FFK_0</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-83"
@@ -2916,7 +2934,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">1FG0_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FG0_A?report=genbank&amp;log$=nuclalign">1FG0_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-84"
@@ -2929,7 +2947,7 @@
                   <td>56%</td>
                   <td>11.9</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">1FFZ_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFZ_A?report=genbank&amp;log$=nuclalign">1FFZ_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-85"
@@ -2942,7 +2960,7 @@
                   <td>50%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">4LGT_F</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_F?report=genbank&amp;log$=nuclalign">4LGT_F</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-86"
@@ -2955,7 +2973,7 @@
                   <td>50%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">4LGT_E</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_E?report=genbank&amp;log$=nuclalign">4LGT_E</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-87"
@@ -2968,7 +2986,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">4BTD_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BTD_A?report=genbank&amp;log$=nuclalign">4BTD_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-88"
@@ -2981,7 +2999,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">4L6J_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4L6J_A?report=genbank&amp;log$=nuclalign">4L6J_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-89"
@@ -2994,7 +3012,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">4KFI_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4KFI_A?report=genbank&amp;log$=nuclalign">4KFI_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-90"
@@ -3007,7 +3025,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">4K0Q_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0Q_A?report=genbank&amp;log$=nuclalign">4K0Q_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-91"
@@ -3020,7 +3038,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">4K0M_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0M_A?report=genbank&amp;log$=nuclalign">4K0M_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-92"
@@ -3033,7 +3051,7 @@
                   <td>88%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">3J3V_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3V_A?report=genbank&amp;log$=nuclalign">3J3V_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-93"
@@ -3046,7 +3064,7 @@
                   <td>88%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">3J3W_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3W_A?report=genbank&amp;log$=nuclalign">3J3W_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-94"
@@ -3059,7 +3077,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">3V6X_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6X_A?report=genbank&amp;log$=nuclalign">3V6X_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-95"
@@ -3072,7 +3090,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">3V6W_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6W_A?report=genbank&amp;log$=nuclalign">3V6W_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-96"
@@ -3085,7 +3103,7 @@
                   <td>50%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">2YMI_DD</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMI_DD?report=genbank&amp;log$=nuclalign">2YMI_DD</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-97"
@@ -3098,7 +3116,7 @@
                   <td>56%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">2YMF_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMF_A?report=genbank&amp;log$=nuclalign">2YMF_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-98"
@@ -3111,7 +3129,7 @@
                   <td>69%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">2J01_A</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2J01_A?report=genbank&amp;log$=nuclalign">2J01_A</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-99"
@@ -3124,7 +3142,7 @@
                   <td>50%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">4AQX_C</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQX_C?report=genbank&amp;log$=nuclalign">4AQX_C</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-100"
@@ -3137,7 +3155,7 @@
                   <td>50%</td>
                   <td>47.03</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">4AQU_C</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQU_C?report=genbank&amp;log$=nuclalign">4AQU_C</a></td>
                 </tr>
               </table>
 
@@ -3147,21 +3165,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit1-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5K_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval Post-translocation Complex (post4, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign">pdb|3J5K|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5K_A?report=genbank&amp;log$=nuclalign">gi|557804730|pdb|3J5K|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3171,19 +3188,17 @@
                 <div class=hotspot id=hotspot1-1-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3195,19 +3210,17 @@
                 <div class=hotspot id=hotspot1-1-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3219,19 +3232,17 @@
                 <div class=hotspot id=hotspot1-1-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3243,19 +3254,17 @@
                 <div class=hotspot id=hotspot1-1-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804730?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3271,14 +3280,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-2">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5I_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3b, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign">pdb|3J5I|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5I_A?report=genbank&amp;log$=nuclalign">gi|557804675|pdb|3J5I|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3288,19 +3296,17 @@
                 <div class=hotspot id=hotspot1-2-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3312,19 +3318,17 @@
                 <div class=hotspot id=hotspot1-2-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3336,19 +3340,17 @@
                 <div class=hotspot id=hotspot1-2-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3360,19 +3362,17 @@
                 <div class=hotspot id=hotspot1-2-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804675?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3388,14 +3388,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-3">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5G_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post3a, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign">pdb|3J5G|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5G_A?report=genbank&amp;log$=nuclalign">gi|557804619|pdb|3J5G|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3405,19 +3404,17 @@
                 <div class=hotspot id=hotspot1-3-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3429,19 +3426,17 @@
                 <div class=hotspot id=hotspot1-3-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3453,19 +3448,17 @@
                 <div class=hotspot id=hotspot1-3-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3477,19 +3470,17 @@
                 <div class=hotspot id=hotspot1-3-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804619?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3505,14 +3496,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-4">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5E_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2b, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign">pdb|3J5E|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5E_A?report=genbank&amp;log$=nuclalign">gi|557804563|pdb|3J5E|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3522,19 +3512,17 @@
                 <div class=hotspot id=hotspot1-4-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3546,19 +3534,17 @@
                 <div class=hotspot id=hotspot1-4-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3570,19 +3556,17 @@
                 <div class=hotspot id=hotspot1-4-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3594,19 +3578,17 @@
                 <div class=hotspot id=hotspot1-4-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804563?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3622,14 +3604,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-5">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5C_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Post- Translocation State (post2a, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign">pdb|3J5C|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5C_A?report=genbank&amp;log$=nuclalign">gi|557804507|pdb|3J5C|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3639,19 +3620,17 @@
                 <div class=hotspot id=hotspot1-5-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3663,19 +3642,17 @@
                 <div class=hotspot id=hotspot1-5-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3687,19 +3664,17 @@
                 <div class=hotspot id=hotspot1-5-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3711,19 +3686,17 @@
                 <div class=hotspot id=hotspot1-5-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804507?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3739,14 +3712,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-6">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5A_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Post- Translocation State (post1, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign">pdb|3J5A|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J5A_A?report=genbank&amp;log$=nuclalign">gi|557804451|pdb|3J5A|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3756,19 +3728,17 @@
                 <div class=hotspot id=hotspot1-6-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3780,19 +3750,17 @@
                 <div class=hotspot id=hotspot1-6-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3804,19 +3772,17 @@
                 <div class=hotspot id=hotspot1-6-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3828,19 +3794,17 @@
                 <div class=hotspot id=hotspot1-6-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804451?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3856,14 +3820,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-7">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J58_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5b, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign">pdb|3J58|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J58_A?report=genbank&amp;log$=nuclalign">gi|557804395|pdb|3J58|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3873,19 +3836,17 @@
                 <div class=hotspot id=hotspot1-7-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3897,19 +3858,17 @@
                 <div class=hotspot id=hotspot1-7-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3921,19 +3880,17 @@
                 <div class=hotspot id=hotspot1-7-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3945,19 +3902,17 @@
                 <div class=hotspot id=hotspot1-7-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804395?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3973,14 +3928,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-8">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J56_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre5a, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign">pdb|3J56|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J56_A?report=genbank&amp;log$=nuclalign">gi|557804339|pdb|3J56|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -3990,19 +3944,17 @@
                 <div class=hotspot id=hotspot1-8-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4014,19 +3966,17 @@
                 <div class=hotspot id=hotspot1-8-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4038,19 +3988,17 @@
                 <div class=hotspot id=hotspot1-8-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4062,19 +4010,17 @@
                 <div class=hotspot id=hotspot1-8-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804339?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4090,14 +4036,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-9">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J54_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Hybrid Pre- Translocation State (pre4, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign">pdb|3J54|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J54_A?report=genbank&amp;log$=nuclalign">gi|557804283|pdb|3J54|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4107,19 +4052,17 @@
                 <div class=hotspot id=hotspot1-9-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4131,19 +4074,17 @@
                 <div class=hotspot id=hotspot1-9-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4155,19 +4096,17 @@
                 <div class=hotspot id=hotspot1-9-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4179,19 +4118,17 @@
                 <div class=hotspot id=hotspot1-9-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804283?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4207,14 +4144,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-10">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J52_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1a, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign">pdb|3J52|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J52_A?report=genbank&amp;log$=nuclalign">gi|557804227|pdb|3J52|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4224,19 +4160,17 @@
                 <div class=hotspot id=hotspot1-10-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4248,19 +4182,17 @@
                 <div class=hotspot id=hotspot1-10-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4272,19 +4204,17 @@
                 <div class=hotspot id=hotspot1-10-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4296,19 +4226,17 @@
                 <div class=hotspot id=hotspot1-10-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804227?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4324,14 +4252,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-11">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J51_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre3, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign">pdb|3J51|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J51_A?report=genbank&amp;log$=nuclalign">gi|557804195|pdb|3J51|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4341,19 +4268,17 @@
                 <div class=hotspot id=hotspot1-11-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4365,19 +4290,17 @@
                 <div class=hotspot id=hotspot1-11-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4389,19 +4312,17 @@
                 <div class=hotspot id=hotspot1-11-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4413,19 +4334,17 @@
                 <div class=hotspot id=hotspot1-11-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804195?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4441,14 +4360,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-12">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J50_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Intermediate Pre- Translocation State (pre2, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign">pdb|3J50|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J50_A?report=genbank&amp;log$=nuclalign">gi|557804163|pdb|3J50|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4458,19 +4376,17 @@
                 <div class=hotspot id=hotspot1-12-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4482,19 +4398,17 @@
                 <div class=hotspot id=hotspot1-12-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4506,19 +4420,17 @@
                 <div class=hotspot id=hotspot1-12-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4530,19 +4442,17 @@
                 <div class=hotspot id=hotspot1-12-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804163?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4558,14 +4468,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-13">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J4X_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, E. Coli 70s-fmetval-trnaval-trnafmet Complex In Classic Pre- Translocation State (pre1b, 50s Subunit)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign">pdb|3J4X|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J4X_A?report=genbank&amp;log$=nuclalign">gi|557804083|pdb|3J4X|A</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4575,19 +4484,17 @@
                 <div class=hotspot id=hotspot1-13-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4599,19 +4506,17 @@
                 <div class=hotspot id=hotspot1-13-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4623,19 +4528,17 @@
                 <div class=hotspot id=hotspot1-13-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4647,19 +4550,17 @@
                 <div class=hotspot id=hotspot1-13-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/557804083?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4675,14 +4576,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-14">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J37_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Tetracycline Resistance Protein Tet(o) Bound To The Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign">pdb|3J37|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J37_A?report=genbank&amp;log$=nuclalign">gi|474452808|pdb|3J37|A</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -4692,19 +4592,17 @@
                 <div class=hotspot id=hotspot1-14-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4716,19 +4614,17 @@
                 <div class=hotspot id=hotspot1-14-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4740,19 +4636,17 @@
                 <div class=hotspot id=hotspot1-14-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/474452808?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4768,14 +4662,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-15">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZT_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Near-Cognate Codon. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign">pdb|3IZT|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZT_B?report=genbank&amp;log$=nuclalign">gi|326634210|pdb|3IZT|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -4789,43 +4682,43 @@
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Insights Into Cognate Vs. Near-Cognate Discrimination During Decoding. This Entry Contains The Large Subunit Of A Ribosome Programmed With A Cognate Codon </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/326634243?report=genbank&amp;log$=nuclalign">pdb|3IZU|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|326634243|pdb|3IZU|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class2 Of The Six Classes) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763703?report=genbank&amp;log$=nuclalign">pdb|3J0T|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380763703|pdb|3J0T|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 4a Of The Six Classes) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763785?report=genbank&amp;log$=nuclalign">pdb|3J0W|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380763785|pdb|3J0W|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 4b Of The Six Classes) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763843?report=genbank&amp;log$=nuclalign">pdb|3J0Y|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380763843|pdb|3J0Y|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 3 Of The Six Classes) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763925?report=genbank&amp;log$=nuclalign">pdb|3J11|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380763925|pdb|3J11|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 5 Of The Six Classes) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380763959?report=genbank&amp;log$=nuclalign">pdb|3J12|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380763959|pdb|3J12|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structural Characterization Of Mrna-Trna Translocation Intermediates (50s Ribosome Of Class 6 Of The Six Classes)</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/380764016?report=genbank&amp;log$=nuclalign">pdb|3J14|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|380764016|pdb|3J14|B</a>
                     </p>
                   </div>
                 </div>
@@ -4833,19 +4726,17 @@
                 <div class=hotspot id=hotspot1-15-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4857,19 +4748,17 @@
                 <div class=hotspot id=hotspot1-15-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4881,19 +4770,17 @@
                 <div class=hotspot id=hotspot1-15-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/326634210?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -4909,14 +4796,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-16">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3FIK_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Ternary Complex-Bound E.Coli 70s Ribosome. This Entry Consists Of The 50s Subunit. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign">pdb|3FIK|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3FIK_B?report=genbank&amp;log$=nuclalign">gi|224510767|pdb|3FIK|B</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -4930,115 +4816,115 @@
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097373?report=genbank&amp;log$=nuclalign">pdb|3I1N|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097373|pdb|3I1N|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097425?report=genbank&amp;log$=nuclalign">pdb|3I1P|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097425|pdb|3I1P|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097479?report=genbank&amp;log$=nuclalign">pdb|3I1R|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097479|pdb|3I1R|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097533?report=genbank&amp;log$=nuclalign">pdb|3I1T|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097533|pdb|3I1T|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097588?report=genbank&amp;log$=nuclalign">pdb|3I20|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097588|pdb|3I20|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli 70s Ribosome In An Intermediate State Of Ratcheting </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/257097643?report=genbank&amp;log$=nuclalign">pdb|3I22|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|257097643|pdb|3I22|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, E.Coli 70s Ribosome Stalled During Translation Of Tnac Leader Peptide. This File Contains The 50s, The P-Site Trna And The Tnac Leader Peptide (Part 2 Of 2). </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/294662251?report=genbank&amp;log$=nuclalign">pdb|2WWQ|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|294662251|pdb|2WWQ|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Chloramphenicol. This File Contains The 50s Subunit Of The First 70s Ribosome With Chloramphenicol Bound. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320065?report=genbank&amp;log$=nuclalign">pdb|3OFC|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|309320065|pdb|3OFC|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Clindamycin. This File Contains The 50s Subunit Of The First 70s Ribosome Bound To Clindamycin. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320169?report=genbank&amp;log$=nuclalign">pdb|3OFZ|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|309320169|pdb|3OFZ|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Clindamycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320200?report=genbank&amp;log$=nuclalign">pdb|3OG0|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|309320200|pdb|3OG0|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Telithromycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113654?report=genbank&amp;log$=nuclalign">pdb|3OAS|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|315113654|pdb|3OAS|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Telithromycin. This File Contains The 50s Subunit Of The First 70s Ribosome With Telithromycin Bound. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113685?report=genbank&amp;log$=nuclalign">pdb|3OAT|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|315113685|pdb|3OAT|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structures Of The Bacterial Ribosome In Classical And Hybrid States Of Trna Binding </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/334359437?report=genbank&amp;log$=nuclalign">pdb|3R8S|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|334359437|pdb|3R8S|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structures Of The Bacterial Ribosome In Classical And Hybrid States Of Trna Binding </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/334359468?report=genbank&amp;log$=nuclalign">pdb|3R8T|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|334359468|pdb|3R8T|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Release Factor Rf3 Trapped In The Gtp State On A Rotated Conformation Of The Ribosome </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/371927526?report=genbank&amp;log$=nuclalign">pdb|3SGF|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|371927526|pdb|3SGF|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Release Factor Rf3 Trapped In The Gtp State On A Rotated Conformation Of The Ribosome (Without Viomycin) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/371927651?report=genbank&amp;log$=nuclalign">pdb|3UOS|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|371927651|pdb|3UOS|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of The Bacterial Ribosome Complexed By Tmrna-Smpb And Ef-G During Translocation And Mld-Loading (50s Subunit) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/386783121?report=genbank&amp;log$=nuclalign">pdb|3J19|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|386783121|pdb|3J19|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of The Ribosome With Elongation Factor G Trapped In The Pre- Translocation State (pre-translocation 70s*trna Structure, 50s Subunit) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567754995?report=genbank&amp;log$=nuclalign">pdb|3J5U|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|567754995|pdb|3J5U|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of The Ribosome With Elongation Factor G Trapped In The Pre- Translocation State (pre-translocation 70s*trna*ef-g Structure, 50s Subunit)</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755029?report=genbank&amp;log$=nuclalign">pdb|3J5W|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|567755029|pdb|3J5W|A</a>
                     </p>
                   </div>
                 </div>
@@ -5046,19 +4932,17 @@
                 <div class=hotspot id=hotspot1-16-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5070,19 +4954,17 @@
                 <div class=hotspot id=hotspot1-16-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5094,19 +4976,17 @@
                 <div class=hotspot id=hotspot1-16-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5118,19 +4998,17 @@
                 <div class=hotspot id=hotspot1-16-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/224510767?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5146,14 +5024,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-17">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3E1B_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Pre-Accommodation State </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign">pdb|3E1B|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3E1B_B?report=genbank&amp;log$=nuclalign">gi|256032374|pdb|3E1B|B</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5167,7 +5044,7 @@
                   <div class=title>
                     <p class=hittitle>Chain B, Structure Of The 50s Subunit Of E. Coli Ribosome In Post-Accommodation State</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/256032431?report=genbank&amp;log$=nuclalign">pdb|3E1D|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|256032431|pdb|3E1D|B</a>
                     </p>
                   </div>
                 </div>
@@ -5175,19 +5052,17 @@
                 <div class=hotspot id=hotspot1-17-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5199,19 +5074,17 @@
                 <div class=hotspot id=hotspot1-17-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5223,19 +5096,17 @@
                 <div class=hotspot id=hotspot1-17-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5247,19 +5118,17 @@
                 <div class=hotspot id=hotspot1-17-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/256032374?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5275,14 +5144,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-18">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYC_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of The 50s Subunit Of A Secm-Stalled E. Coli Ribosome Complex Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1143</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign">pdb|2GYC|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYC_0?report=genbank&amp;log$=nuclalign">gi|157883716|pdb|2GYC|0</a>
                     <span class=b>Length:</span> 2740
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5292,19 +5160,17 @@
                 <div class=hotspot id=hotspot1-18-1>
                   <p class=range>
                     <span class=range>Range 1: 889 to 904</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=889&amp;to=904">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=889&amp;to=904">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5316,19 +5182,17 @@
                 <div class=hotspot id=hotspot1-18-2>
                   <p class=range>
                     <span class=range>Range 2: 2453 to 2460</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=2453&amp;to=2460">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=2453&amp;to=2460">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5340,19 +5204,17 @@
                 <div class=hotspot id=hotspot1-18-3>
                   <p class=range>
                     <span class=range>Range 3: 776 to 782</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=776&amp;to=782">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=776&amp;to=782">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5364,19 +5226,17 @@
                 <div class=hotspot id=hotspot1-18-4>
                   <p class=range>
                     <span class=range>Range 4: 1910 to 1916</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=genbank&amp;log$=nuclalign&amp;from=1910&amp;to=1916">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883716?report=graph&amp;log$=nuclalign&amp;from=1910&amp;to=1916">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5392,14 +5252,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-19">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYA_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of The 50s Subunit Of A Pre-Translocational E. Coli Ribosome Obtained By Fitting Atomic Models For Rna And Protein Components Into Cryo-Em Map Emd-1056</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign">pdb|2GYA|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2GYA_0?report=genbank&amp;log$=nuclalign">gi|157883710|pdb|2GYA|0</a>
                     <span class=b>Length:</span> 2740
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5409,19 +5268,17 @@
                 <div class=hotspot id=hotspot1-19-1>
                   <p class=range>
                     <span class=range>Range 1: 889 to 904</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=889&amp;to=904">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=889&amp;to=904">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5433,19 +5290,17 @@
                 <div class=hotspot id=hotspot1-19-2>
                   <p class=range>
                     <span class=range>Range 2: 2453 to 2460</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=2453&amp;to=2460">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=2453&amp;to=2460">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5457,19 +5312,17 @@
                 <div class=hotspot id=hotspot1-19-3>
                   <p class=range>
                     <span class=range>Range 3: 776 to 782</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=776&amp;to=782">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=776&amp;to=782">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5481,19 +5334,17 @@
                 <div class=hotspot id=hotspot1-19-4>
                   <p class=range>
                     <span class=range>Range 4: 1910 to 1916</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=genbank&amp;log$=nuclalign&amp;from=1910&amp;to=1916">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157883710?report=graph&amp;log$=nuclalign&amp;from=1910&amp;to=1916">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5509,14 +5360,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-20">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2I2V_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign">pdb|2I2V|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2I2V_B?report=genbank&amp;log$=nuclalign">gi|122922257|pdb|2I2V|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5526,19 +5376,17 @@
                 <div class=hotspot id=hotspot1-20-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5550,19 +5398,17 @@
                 <div class=hotspot id=hotspot1-20-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5574,19 +5420,17 @@
                 <div class=hotspot id=hotspot1-20-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5598,19 +5442,17 @@
                 <div class=hotspot id=hotspot1-20-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/122922257?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5626,14 +5468,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-21">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AW4_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign">pdb|2AW4|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AW4_B?report=genbank&amp;log$=nuclalign">gi|83754062|pdb|2AW4|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5647,229 +5488,229 @@
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of Ribosome With Messenger Rna And The Anticodon Stem-Loop Of P-Site Trna. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/122922241?report=genbank&amp;log$=nuclalign">pdb|2I2T|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|122922241|pdb|2I2T|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin. This File Contains The 50s Subunit Of The First 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836046?report=genbank&amp;log$=nuclalign">pdb|2QOV|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157836046|pdb|2QOV|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836098?report=genbank&amp;log$=nuclalign">pdb|2QOX|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157836098|pdb|2QOX|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin And Neomycin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836150?report=genbank&amp;log$=nuclalign">pdb|2QOZ|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157836150|pdb|2QOZ|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Spectinomycin And Neomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157836202?report=genbank&amp;log$=nuclalign">pdb|2QP1|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157836202|pdb|2QP1|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Neomycin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429721?report=genbank&amp;log$=nuclalign">pdb|2QAM|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429721|pdb|2QAM|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Neomycin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Neomycin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429773?report=genbank&amp;log$=nuclalign">pdb|2QAO|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429773|pdb|2QAO|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin. This File Contains The 50s Subunit Of The First 70s Ribosome, With Gentamicin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429831?report=genbank&amp;log$=nuclalign">pdb|2QBA|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429831|pdb|2QBA|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin. This File Contains The 50s Subunit Of The Second 70s Ribosome, With Gentamicin Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429883?report=genbank&amp;log$=nuclalign">pdb|2QBC|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429883|pdb|2QBC|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429935?report=genbank&amp;log$=nuclalign">pdb|2QBE|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429935|pdb|2QBE|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158429988?report=genbank&amp;log$=nuclalign">pdb|2QBG|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158429988|pdb|2QBG|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Gentamicin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158430041?report=genbank&amp;log$=nuclalign">pdb|2QBI|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158430041|pdb|2QBI|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Gentamicin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Gentamicin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158430094?report=genbank&amp;log$=nuclalign">pdb|2QBK|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158430094|pdb|2QBK|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Paromomycin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The First 70s Ribosome, With Paromomycin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158431394?report=genbank&amp;log$=nuclalign">pdb|2Z4L|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158431394|pdb|2Z4L|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Paromomycin And Ribosome Recycling Factor (Rrf). This File Contains The 50s Subunit Of The Second 70s Ribosome, With Paromomycin And Rrf Bound. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/158431447?report=genbank&amp;log$=nuclalign">pdb|2Z4N|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|158431447|pdb|2Z4N|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structure Of Pdf Binding Helix In Complex With The Ribosome (Part 1 Of 4) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/168988732?report=genbank&amp;log$=nuclalign">pdb|2VHM|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|168988732|pdb|2VHM|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Structure Of Pdf Binding Helix In Complex With The Ribosome. (Part 2 Of 4) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/168988763?report=genbank&amp;log$=nuclalign">pdb|2VHN|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|168988763|pdb|2VHN|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, 50s Subunit With Ef-G(Gdpnp) And Rrf Bound </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/169404603?report=genbank&amp;log$=nuclalign">pdb|2RDO|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|169404603|pdb|2RDO|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Hygromycin B. This File Contains The 50s Subunit Of The First 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/197107301?report=genbank&amp;log$=nuclalign">pdb|3DF2|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|197107301|pdb|3DF2|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With Hygromycin B. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/197107353?report=genbank&amp;log$=nuclalign">pdb|3DF4|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|197107353|pdb|3DF4|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 8, Ribosome-Secy Complex. This Entry 3kcr Contains 50s Ribosomal Subnit. The 30s Ribosomal Subunit Can Be Found In Pdb Entry 3kc4 </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290560329?report=genbank&amp;log$=nuclalign">pdb|3KCR|8</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|290560329|pdb|3KCR|8</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Cem-101. This File Contains The 50s Subunit Of The First 70s Ribosome Bound To Cem-101. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308198729?report=genbank&amp;log$=nuclalign">pdb|3ORB|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|308198729|pdb|3ORB|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Erythromycin. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308388007?report=genbank&amp;log$=nuclalign">pdb|3OFQ|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|308388007|pdb|3OFQ|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Erythromycin. This File Contains The 50s Subunit Of The First 70s Ribosome With Erthromycin Bound. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308388038?report=genbank&amp;log$=nuclalign">pdb|3OFR|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|308388038|pdb|3OFR|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Chloramphenicol. This File Contains The 50s Subunit Of The Second 70s Ribosome. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/309320096?report=genbank&amp;log$=nuclalign">pdb|3OFD|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|309320096|pdb|3OFD|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 8, Structure Of The Ribosome-Secye Complex In The Membrane Environment </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/329666014?report=genbank&amp;log$=nuclalign">pdb|3J01|8</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|329666014|pdb|3J01|8</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Allosteric Control Of The Ribosome By Small-Molecule Antibiotics </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/402550607?report=genbank&amp;log$=nuclalign">pdb|4GAR|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|402550607|pdb|4GAR|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Allosteric Control Of The Ribosome By Small-Molecule Antibiotics </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/402550662?report=genbank&amp;log$=nuclalign">pdb|4GAU|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|402550662|pdb|4GAU|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934273?report=genbank&amp;log$=nuclalign">pdb|4KIX|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934273|pdb|4KIX|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934341?report=genbank&amp;log$=nuclalign">pdb|4KIZ|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934341|pdb|4KIZ|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934404?report=genbank&amp;log$=nuclalign">pdb|4KJ1|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934404|pdb|4KJ1|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934483?report=genbank&amp;log$=nuclalign">pdb|4KJ3|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934483|pdb|4KJ3|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934551?report=genbank&amp;log$=nuclalign">pdb|4KJ5|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934551|pdb|4KJ5|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934613?report=genbank&amp;log$=nuclalign">pdb|4KJ7|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934613|pdb|4KJ7|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934678?report=genbank&amp;log$=nuclalign">pdb|4KJ9|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934678|pdb|4KJ9|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Control Of Ribosomal Subunit Rotation By Elongation Factor G </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/524934740?report=genbank&amp;log$=nuclalign">pdb|4KJB|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|524934740|pdb|4KJB|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Visualization Of Two Trnas Trapped In Transit During Ef-g-mediated Translocation (50s Subunit) </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/564730763?report=genbank&amp;log$=nuclalign">pdb|3J5O|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|564730763|pdb|3J5O|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of The E. Coli 50s Subunit With Ermbl Nascent Chain</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/597959819?report=genbank&amp;log$=nuclalign">pdb|3J5L|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|597959819|pdb|3J5L|A</a>
                     </p>
                   </div>
                 </div>
@@ -5877,19 +5718,17 @@
                 <div class=hotspot id=hotspot1-21-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5901,19 +5740,17 @@
                 <div class=hotspot id=hotspot1-21-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5925,19 +5762,17 @@
                 <div class=hotspot id=hotspot1-21-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5949,19 +5784,17 @@
                 <div class=hotspot id=hotspot1-21-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754062?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -5977,14 +5810,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-22">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AWB_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli At 3.5 A Resolution. This File Contains The 50s Subunit Of The Second 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign">pdb|2AWB|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2AWB_B?report=genbank&amp;log$=nuclalign">gi|83754118|pdb|2AWB|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -5998,13 +5830,13 @@
                   <div class=title>
                     <p class=hittitle>Chain B, Model Of E. Coli Srp Bound To 70s Rncs </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/126031747?report=genbank&amp;log$=nuclalign">pdb|2J28|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|126031747|pdb|2J28|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400.</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880574?report=genbank&amp;log$=nuclalign">pdb|1VS8|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157880574|pdb|1VS8|B</a>
                     </p>
                   </div>
                 </div>
@@ -6012,19 +5844,17 @@
                 <div class=hotspot id=hotspot1-22-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6036,19 +5866,17 @@
                 <div class=hotspot id=hotspot1-22-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6060,19 +5888,17 @@
                 <div class=hotspot id=hotspot1-22-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6084,19 +5910,17 @@
                 <div class=hotspot id=hotspot1-22-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/83754118?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6112,14 +5936,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-23">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1VS6_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, Crystal Structure Of The Bacterial Ribosome From Escherichia Coli In Complex With The Antibiotic Kasugamyin At 3.5a Resolution. This File Contains The 50s Subunit Of One 70s Ribosome. The Entire Crystal Structure Contains Two 70s Ribosomes And Is Described In Remark 400. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign">pdb|1VS6|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1VS6_B?report=genbank&amp;log$=nuclalign">gi|157880571|pdb|1VS6|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -6133,37 +5956,37 @@
                   <div class=title>
                     <p class=hittitle>Chain B, The Hsp15 Protein Fitted Into The Low Resolution Cryo-Em Map 50s.Nc-Trna.Hsp15 Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/209870354?report=genbank&amp;log$=nuclalign">pdb|3BBX|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|209870354|pdb|3BBX|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Ef-G-Bound Translocation Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447037?report=genbank&amp;log$=nuclalign">pdb|3DG0|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|222447037|pdb|3DG0|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of A Pretranslocation Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447039?report=genbank&amp;log$=nuclalign">pdb|3DG2|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|222447039|pdb|3DG2|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Rf1-Bound Termination Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447041?report=genbank&amp;log$=nuclalign">pdb|3DG4|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|222447041|pdb|3DG4|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain B, Coordinates Of 16s And 23s Rrnas Fitted Into The Cryo-Em Map Of Rf3-Bound Termination Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/222447043?report=genbank&amp;log$=nuclalign">pdb|3DG5|B</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|222447043|pdb|3DG5|B</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The E. Coli Ribosome Bound To Cem-101. This File Contains The 50s Subunit Of The Second 70s Ribosome.</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/308198355?report=genbank&amp;log$=nuclalign">pdb|1VT2|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|308198355|pdb|1VT2|A</a>
                     </p>
                   </div>
                 </div>
@@ -6171,19 +5994,17 @@
                 <div class=hotspot id=hotspot1-23-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6195,19 +6016,17 @@
                 <div class=hotspot id=hotspot1-23-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6219,19 +6038,17 @@
                 <div class=hotspot id=hotspot1-23-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6243,19 +6060,17 @@
                 <div class=hotspot id=hotspot1-23-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/157880571?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6271,14 +6086,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-24">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1P85_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Ef-G.Gtp State Of E. Coli 70s Ribosome </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign">pdb|1P85|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1P85_0?report=genbank&amp;log$=nuclalign">gi|33357900|pdb|1P85|0</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -6292,7 +6106,7 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, Real Space Refined Coordinates Of The 50s Subunit Fitted Into The Low Resolution Cryo-Em Map Of The Initiation-Like State Of E. Coli 70s Ribosome</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/33357927?report=genbank&amp;log$=nuclalign">pdb|1P86|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|33357927|pdb|1P86|0</a>
                     </p>
                   </div>
                 </div>
@@ -6300,19 +6114,17 @@
                 <div class=hotspot id=hotspot1-24-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 976</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=976">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=976">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>32.2 bits(16)</td>
-                      <td>0.0</td>
-                      <td>16/16(100%)</td>
-                      <td>0/16(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>32.2105 bits (16)</td>
+                      <td>0.000791334</td>
+                      <td>16/16 (100%)</td>
+                      <td>0/16 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6324,19 +6136,17 @@
                 <div class=hotspot id=hotspot1-24-2>
                   <p class=range>
                     <span class=range>Range 2: 2591 to 2598</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=2591&amp;to=2598">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=2591&amp;to=2598">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6348,19 +6158,17 @@
                 <div class=hotspot id=hotspot1-24-3>
                   <p class=range>
                     <span class=range>Range 3: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6372,19 +6180,17 @@
                 <div class=hotspot id=hotspot1-24-4>
                   <p class=range>
                     <span class=range>Range 4: 2027 to 2033</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=genbank&amp;log$=nuclalign&amp;from=2027&amp;to=2033">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/33357900?report=graph&amp;log$=nuclalign&amp;from=2027&amp;to=2033">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6400,14 +6206,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-25">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1C2W_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, 23s Rrna Structure Fitted To A Cryo-Electron Microscopic Map At 7.5 Angstroms Resolution</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign">pdb|1C2W|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1C2W_B?report=genbank&amp;log$=nuclalign">gi|7767146|pdb|1C2W|B</a>
                     <span class=b>Length:</span> 2904
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -6417,19 +6222,17 @@
                 <div class=hotspot id=hotspot1-25-1>
                   <p class=range>
                     <span class=range>Range 1: 961 to 973</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign&amp;from=961&amp;to=973">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign&amp;from=961&amp;to=973">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>26.3 bits(13)</td>
-                      <td>0.0</td>
-                      <td>13/13(100%)</td>
-                      <td>0/13(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>26.2635 bits (13)</td>
+                      <td>0.0488207</td>
+                      <td>13/13 (100%)</td>
+                      <td>0/13 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6441,19 +6244,17 @@
                 <div class=hotspot id=hotspot1-25-2>
                   <p class=range>
                     <span class=range>Range 2: 839 to 845</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=genbank&amp;log$=nuclalign&amp;from=839&amp;to=845">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/7767146?report=graph&amp;log$=nuclalign&amp;from=839&amp;to=845">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6465,156 +6266,17 @@
 
               </div>
 
-              <div class=alignment id=hit1-30>
-
-                <div class=linkheader>
-                  <div class=right><a href="#description1-30">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign">Graphics</a>
-                </div>
-
-                <div class=title>
-                  <p class=hittitle>Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)</p>
-                  <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign">pdb|3J44|1</a>
-                    <span class=b>Length:</span> 3049
-                    <span class=b>Number of Matches:</span> 2
-                  </p>
-                </div>
-
-
-                <div class=hotspot id=hotspot1-30-1>
-                  <p class=range>
-                    <span class=range>Range 1: 651 to 663</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign&amp;from=651&amp;to=663">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign&amp;from=651&amp;to=663">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>12/13(92%)</td>
-                      <td>0/13(0%)</td>
-                      <td>Plus/Plus</td>
-                    </tr>
-                  </table>
-
-                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
-                |||||||| ||||
-Subject    651  CGTCCGTCTTGAA  663</pre>
-                </div>
-                <div class=hotspot id=hotspot1-30-2>
-                  <p class=range>
-                    <span class=range>Range 2: 2705 to 2713</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=genbank&amp;log$=nuclalign&amp;from=2705&amp;to=2713">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/551701574?report=graph&amp;log$=nuclalign&amp;from=2705&amp;to=2713">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
-                      <td>Plus/Plus</td>
-                    </tr>
-                  </table>
-
-                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
-                |||||||||
-Subject   2705  CCGTCGTGA  2713</pre>
-                </div>
-
-              </div>
-
-              <div class=alignment id=hit1-35>
-
-                <div class=linkheader>
-                  <div class=right><a href="#description1-35">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign">Graphics</a>
-                </div>
-
-                <div class=title>
-                  <p class=hittitle>Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)</p>
-                  <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign">pdb|3J2L|1</a>
-                    <span class=b>Length:</span> 3049
-                    <span class=b>Number of Matches:</span> 2
-                  </p>
-                </div>
-
-
-                <div class=hotspot id=hotspot1-35-1>
-                  <p class=range>
-                    <span class=range>Range 1: 651 to 663</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign&amp;from=651&amp;to=663">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign&amp;from=651&amp;to=663">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>12/13(92%)</td>
-                      <td>0/13(0%)</td>
-                      <td>Plus/Plus</td>
-                    </tr>
-                  </table>
-
-                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
-                |||||||| ||||
-Subject    651  CGTCCGTCTTGAA  663</pre>
-                </div>
-                <div class=hotspot id=hotspot1-35-2>
-                  <p class=range>
-                    <span class=range>Range 2: 2705 to 2713</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=genbank&amp;log$=nuclalign&amp;from=2705&amp;to=2713">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697991?report=graph&amp;log$=nuclalign&amp;from=2705&amp;to=2713">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
-                      <td>Plus/Plus</td>
-                    </tr>
-                  </table>
-
-                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
-                |||||||||
-Subject   2705  CCGTCGTGA  2713</pre>
-                </div>
-
-              </div>
-
               <div class=alignment id=hit1-26>
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-26">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J62_AA?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain a, Model Of The Large Subunit Rna Based On A 5.5 A Cryo-em Map Of Triticum Aestivum Translating 80s Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign">pdb|3J62|AA</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J62_AA?report=genbank&amp;log$=nuclalign">gi|582044940|pdb|3J62|AA</a>
                     <span class=b>Length:</span> 3391
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -6624,19 +6286,17 @@
                 <div class=hotspot id=hotspot1-26-1>
                   <p class=range>
                     <span class=range>Range 1: 2961 to 2969</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2961&amp;to=2969">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2961&amp;to=2969">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6648,19 +6308,17 @@
                 <div class=hotspot id=hotspot1-26-2>
                   <p class=range>
                     <span class=range>Range 2: 177 to 170</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=177&amp;to=170">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=177&amp;to=170">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -6672,19 +6330,17 @@
                 <div class=hotspot id=hotspot1-26-3>
                   <p class=range>
                     <span class=range>Range 3: 553 to 559</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=553&amp;to=559">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=553&amp;to=559">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6696,19 +6352,17 @@
                 <div class=hotspot id=hotspot1-26-4>
                   <p class=range>
                     <span class=range>Range 4: 2048 to 2042</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2042">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2042">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -6720,19 +6374,17 @@
                 <div class=hotspot id=hotspot1-26-5>
                   <p class=range>
                     <span class=range>Range 5: 2211 to 2217</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=genbank&amp;log$=nuclalign&amp;from=2211&amp;to=2217">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/582044940?report=graph&amp;log$=nuclalign&amp;from=2211&amp;to=2217">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6748,14 +6400,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-27">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4CE4_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, 39s Large Subunit Of The Porcine Mitochondrial Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign">pdb|4CE4|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4CE4_A?report=genbank&amp;log$=nuclalign">gi|567755268|pdb|4CE4|A</a>
                     <span class=b>Length:</span> 1570
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -6765,19 +6416,17 @@
                 <div class=hotspot id=hotspot1-27-1>
                   <p class=range>
                     <span class=range>Range 1: 1020 to 1028</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=genbank&amp;log$=nuclalign&amp;from=1020&amp;to=1028">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/567755268?report=graph&amp;log$=nuclalign&amp;from=1020&amp;to=1028">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6793,14 +6442,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-28">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYP_5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign">pdb|4BYP|5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYP_5?report=genbank&amp;log$=nuclalign">gi|558704783|pdb|4BYP|5</a>
                     <span class=b>Length:</span> 3396
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -6810,19 +6458,17 @@
                 <div class=hotspot id=hotspot1-28-1>
                   <p class=range>
                     <span class=range>Range 1: 2959 to 2967</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6834,19 +6480,17 @@
                 <div class=hotspot id=hotspot1-28-2>
                   <p class=range>
                     <span class=range>Range 2: 1634 to 1627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -6858,19 +6502,17 @@
                 <div class=hotspot id=hotspot1-28-3>
                   <p class=range>
                     <span class=range>Range 3: 2435 to 2442</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6882,19 +6524,17 @@
                 <div class=hotspot id=hotspot1-28-4>
                   <p class=range>
                     <span class=range>Range 4: 1100 to 1106</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6906,19 +6546,17 @@
                 <div class=hotspot id=hotspot1-28-5>
                   <p class=range>
                     <span class=range>Range 5: 2216 to 2222</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704783?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6934,14 +6572,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-29">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYW_5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 5, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign">pdb|4BYW|5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BYW_5?report=genbank&amp;log$=nuclalign">gi|558704825|pdb|4BYW|5</a>
                     <span class=b>Length:</span> 3396
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -6951,19 +6588,17 @@
                 <div class=hotspot id=hotspot1-29-1>
                   <p class=range>
                     <span class=range>Range 1: 2959 to 2967</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -6975,19 +6610,17 @@
                 <div class=hotspot id=hotspot1-29-2>
                   <p class=range>
                     <span class=range>Range 2: 1634 to 1627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -6999,19 +6632,17 @@
                 <div class=hotspot id=hotspot1-29-3>
                   <p class=range>
                     <span class=range>Range 3: 2435 to 2442</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7023,19 +6654,17 @@
                 <div class=hotspot id=hotspot1-29-4>
                   <p class=range>
                     <span class=range>Range 4: 1100 to 1106</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7047,19 +6676,17 @@
                 <div class=hotspot id=hotspot1-29-5>
                   <p class=range>
                     <span class=range>Range 5: 2216 to 2222</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558704825?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7071,18 +6698,81 @@
 
               </div>
 
+              <div class=alignment id=hit1-30>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1-30">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J44_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Structure Of The Methanococcus Jannaschii Ribosome-secyebeta Channel Complex (50s Ribosomal Subunit)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J44_1?report=genbank&amp;log$=nuclalign">gi|551701574|pdb|3J44|1</a>
+                    <span class=b>Length:</span> 3049
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot1-30-1>
+                  <p class=range>
+                    <span class=range>Range 1: 651 to 663</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>12/13 (92%)</td>
+                      <td>0/13 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
+                |||||||| ||||
+Subject    651  CGTCCGTCTTGAA  663</pre>
+                </div>
+                <div class=hotspot id=hotspot1-30-2>
+                  <p class=range>
+                    <span class=range>Range 2: 2705 to 2713</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2705  CCGTCGTGA  2713</pre>
+                </div>
+
+              </div>
+
               <div class=alignment id=hit1-31>
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-31">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4HUB_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, The Re-refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution: More Complete Structure Of The L7/l12 And L1 Stalk, L5 And Lx Proteins</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign">pdb|4HUB|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4HUB_0?report=genbank&amp;log$=nuclalign">gi|508123724|pdb|4HUB|0</a>
                     <span class=b>Length:</span> 2910
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -7092,19 +6782,17 @@
                 <div class=hotspot id=hotspot1-31-1>
                   <p class=range>
                     <span class=range>Range 1: 298 to 290</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=298&amp;to=290">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=298&amp;to=290">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -7116,19 +6804,17 @@
                 <div class=hotspot id=hotspot1-31-2>
                   <p class=range>
                     <span class=range>Range 2: 2618 to 2626</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=2618&amp;to=2626">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=2618&amp;to=2626">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7140,19 +6826,17 @@
                 <div class=hotspot id=hotspot1-31-3>
                   <p class=range>
                     <span class=range>Range 3: 2599 to 2605</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=genbank&amp;log$=nuclalign&amp;from=2599&amp;to=2605">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/508123724?report=graph&amp;log$=nuclalign&amp;from=2599&amp;to=2605">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7168,14 +6852,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-32">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3F_5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 5, Structure Of The H. Sapiens 60s Rrna</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign">pdb|3J3F|5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3F_5?report=genbank&amp;log$=nuclalign">gi|485601478|pdb|3J3F|5</a>
                     <span class=b>Length:</span> 5070
                     <span class=b>Number of Matches:</span> 8
                   </p>
@@ -7185,19 +6868,17 @@
                 <div class=hotspot id=hotspot1-32-1>
                   <p class=range>
                     <span class=range>Range 1: 4536 to 4544</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=4536&amp;to=4544">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=4536&amp;to=4544">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7209,19 +6890,17 @@
                 <div class=hotspot id=hotspot1-32-2>
                   <p class=range>
                     <span class=range>Range 2: 765 to 772</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=765&amp;to=772">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=765&amp;to=772">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7233,19 +6912,17 @@
                 <div class=hotspot id=hotspot1-32-3>
                   <p class=range>
                     <span class=range>Range 3: 769 to 776</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=769&amp;to=776">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=769&amp;to=776">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7257,19 +6934,17 @@
                 <div class=hotspot id=hotspot1-32-4>
                   <p class=range>
                     <span class=range>Range 4: 773 to 780</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=773&amp;to=780">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=773&amp;to=780">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7281,19 +6956,17 @@
                 <div class=hotspot id=hotspot1-32-5>
                   <p class=range>
                     <span class=range>Range 5: 777 to 784</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=777&amp;to=784">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=777&amp;to=784">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7305,19 +6978,17 @@
                 <div class=hotspot id=hotspot1-32-6>
                   <p class=range>
                     <span class=range>Range 6: 3939 to 3946</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=3939&amp;to=3946">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=3939&amp;to=3946">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7329,19 +7000,17 @@
                 <div class=hotspot id=hotspot1-32-7>
                   <p class=range>
                     <span class=range>Range 7: 393 to 399</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=393&amp;to=399">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=393&amp;to=399">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7353,19 +7022,17 @@
                 <div class=hotspot id=hotspot1-32-8>
                   <p class=range>
                     <span class=range>Range 8: 3720 to 3726</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=genbank&amp;log$=nuclalign&amp;from=3720&amp;to=3726">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601478?report=graph&amp;log$=nuclalign&amp;from=3720&amp;to=3726">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7381,14 +7048,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-33">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3E_5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 5, Structure Of The D. Melanogaster 60s Rrna</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign">pdb|3J3E|5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3E_5?report=genbank&amp;log$=nuclalign">gi|485601474|pdb|3J3E|5</a>
                     <span class=b>Length:</span> 3970
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -7398,19 +7064,17 @@
                 <div class=hotspot id=hotspot1-33-1>
                   <p class=range>
                     <span class=range>Range 1: 3490 to 3498</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=3490&amp;to=3498">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=3490&amp;to=3498">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7422,19 +7086,17 @@
                 <div class=hotspot id=hotspot1-33-2>
                   <p class=range>
                     <span class=range>Range 2: 2177 to 2184</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=2177&amp;to=2184">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=2177&amp;to=2184">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7446,19 +7108,17 @@
                 <div class=hotspot id=hotspot1-33-3>
                   <p class=range>
                     <span class=range>Range 3: 2594 to 2600</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=2594&amp;to=2600">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=2594&amp;to=2600">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7470,19 +7130,17 @@
                 <div class=hotspot id=hotspot1-33-4>
                   <p class=range>
                     <span class=range>Range 4: 3627 to 3633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=genbank&amp;log$=nuclalign&amp;from=3627&amp;to=3633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/485601474?report=graph&amp;log$=nuclalign&amp;from=3627&amp;to=3633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7498,14 +7156,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-34">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3ZEX_B?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain B, High_resolution Cryo-electron Microscopy Structure Of The Trypanosoma Brucei Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign">pdb|3ZEX|B</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3ZEX_B?report=genbank&amp;log$=nuclalign">gi|449802187|pdb|3ZEX|B</a>
                     <span class=b>Length:</span> 1465
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -7515,19 +7172,17 @@
                 <div class=hotspot id=hotspot1-34-1>
                   <p class=range>
                     <span class=range>Range 1: 1334 to 1342</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign&amp;from=1334&amp;to=1342">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign&amp;from=1334&amp;to=1342">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7539,19 +7194,17 @@
                 <div class=hotspot id=hotspot1-34-2>
                   <p class=range>
                     <span class=range>Range 2: 705 to 711</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=genbank&amp;log$=nuclalign&amp;from=705&amp;to=711">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/449802187?report=graph&amp;log$=nuclalign&amp;from=705&amp;to=711">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7563,18 +7216,81 @@
 
               </div>
 
+              <div class=alignment id=hit1-35>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1-35">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J2L_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>Chain 1, Promiscuous Behavior Of Proteins In Archaeal Ribosomes Revealed By Cryo-em: Implications For Evolution Of Eukaryotic Ribosomes (50s Ribosomal Rna)</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J2L_1?report=genbank&amp;log$=nuclalign">gi|428697991|pdb|3J2L|1</a>
+                    <span class=b>Length:</span> 3049
+                    <span class=b>Number of Matches:</span> 2
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot1-35-1>
+                  <p class=range>
+                    <span class=range>Range 1: 651 to 663</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>12/13 (92%)</td>
+                      <td>0/13 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGTCCGTCGTGAA  13
+                |||||||| ||||
+Subject    651  CGTCCGTCTTGAA  663</pre>
+                </div>
+                <div class=hotspot id=hotspot1-35-2>
+                  <p class=range>
+                    <span class=range>Range 2: 2705 to 2713</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  CCGTCGTGA  12
+                |||||||||
+Subject   2705  CCGTCGTGA  2713</pre>
+                </div>
+
+              </div>
+
               <div class=alignment id=hit1-36>
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-36">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3OW2_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Crystal Structure Of Enhanced Macrolide Bound To 50s Ribosomal Subunit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign">pdb|3OW2|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3OW2_0?report=genbank&amp;log$=nuclalign">gi|392311504|pdb|3OW2|0</a>
                     <span class=b>Length:</span> 2902
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -7584,19 +7300,17 @@
                 <div class=hotspot id=hotspot1-36-1>
                   <p class=range>
                     <span class=range>Range 1: 2613 to 2621</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign&amp;from=2613&amp;to=2621">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign&amp;from=2613&amp;to=2621">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7608,19 +7322,17 @@
                 <div class=hotspot id=hotspot1-36-2>
                   <p class=range>
                     <span class=range>Range 2: 2594 to 2600</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=genbank&amp;log$=nuclalign&amp;from=2594&amp;to=2600">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/392311504?report=graph&amp;log$=nuclalign&amp;from=2594&amp;to=2600">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7636,14 +7348,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-37">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4ADX_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, The Cryo-em Structure Of The Archaeal 50s Ribosomal Subunit In Complex With Initiation Factor 6</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign">pdb|4ADX|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4ADX_0?report=genbank&amp;log$=nuclalign">gi|374977932|pdb|4ADX|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -7653,19 +7364,17 @@
                 <div class=hotspot id=hotspot1-37-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -7677,19 +7386,17 @@
                 <div class=hotspot id=hotspot1-37-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7701,19 +7408,17 @@
                 <div class=hotspot id=hotspot1-37-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/374977932?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7729,14 +7434,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-38">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5F_6?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 6, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome B</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign">pdb|3U5F|6</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5F_6?report=genbank&amp;log$=nuclalign">gi|364506133|pdb|3U5F|6</a>
                     <span class=b>Length:</span> 1800
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -7746,19 +7450,17 @@
                 <div class=hotspot id=hotspot1-38-1>
                   <p class=range>
                     <span class=range>Range 1: 1528 to 1536</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7770,19 +7472,17 @@
                 <div class=hotspot id=hotspot1-38-2>
                   <p class=range>
                     <span class=range>Range 2: 1006 to 1012</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7794,19 +7494,17 @@
                 <div class=hotspot id=hotspot1-38-3>
                   <p class=range>
                     <span class=range>Range 3: 1569 to 1563</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506133?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -7822,14 +7520,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-39">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5B_2?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 2, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 40s Subunit, Ribosome A </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign">pdb|3U5B|2</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3U5B_2?report=genbank&amp;log$=nuclalign">gi|364506095|pdb|3U5B|2</a>
                     <span class=b>Length:</span> 1800
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -7843,13 +7540,13 @@
                   <div class=title>
                     <p class=hittitle>Chain 2, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704782?report=genbank&amp;log$=nuclalign">pdb|4BYO|2</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|558704782|pdb|4BYO|2</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 2, Cryo-em Reconstruction Of The 80s-eif5b-met-itrnamet Eukaryotic Translation Initiation Complex</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558704824?report=genbank&amp;log$=nuclalign">pdb|4BYV|2</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|558704824|pdb|4BYV|2</a>
                     </p>
                   </div>
                 </div>
@@ -7857,19 +7554,17 @@
                 <div class=hotspot id=hotspot1-39-1>
                   <p class=range>
                     <span class=range>Range 1: 1528 to 1536</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7881,19 +7576,17 @@
                 <div class=hotspot id=hotspot1-39-2>
                   <p class=range>
                     <span class=range>Range 2: 1006 to 1012</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7905,19 +7598,17 @@
                 <div class=hotspot id=hotspot1-39-3>
                   <p class=range>
                     <span class=range>Range 3: 1569 to 1563</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/364506095?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -7933,14 +7624,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-40">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1D_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 4.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign">pdb|4A1D|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1D_1?report=genbank&amp;log$=nuclalign">gi|358440203|pdb|4A1D|1</a>
                     <span class=b>Length:</span> 3119
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -7950,19 +7640,17 @@
                 <div class=hotspot id=hotspot1-40-1>
                   <p class=range>
                     <span class=range>Range 1: 2280 to 2288</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2280&amp;to=2288">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2280&amp;to=2288">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7974,19 +7662,17 @@
                 <div class=hotspot id=hotspot1-40-2>
                   <p class=range>
                     <span class=range>Range 2: 2714 to 2722</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2714&amp;to=2722">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2714&amp;to=2722">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -7998,19 +7684,17 @@
                 <div class=hotspot id=hotspot1-40-3>
                   <p class=range>
                     <span class=range>Range 3: 2838 to 2844</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=genbank&amp;log$=nuclalign&amp;from=2838&amp;to=2844">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440203?report=graph&amp;log$=nuclalign&amp;from=2838&amp;to=2844">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8026,14 +7710,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-41">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A18_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 1</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign">pdb|4A18|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A18_1?report=genbank&amp;log$=nuclalign">gi|358440111|pdb|4A18|1</a>
                     <span class=b>Length:</span> 3354
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -8043,19 +7726,17 @@
                 <div class=hotspot id=hotspot1-41-1>
                   <p class=range>
                     <span class=range>Range 1: 2513 to 2521</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=2513&amp;to=2521">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=2513&amp;to=2521">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8067,19 +7748,17 @@
                 <div class=hotspot id=hotspot1-41-2>
                   <p class=range>
                     <span class=range>Range 2: 2947 to 2955</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=2947&amp;to=2955">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=2947&amp;to=2955">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8091,19 +7770,17 @@
                 <div class=hotspot id=hotspot1-41-3>
                   <p class=range>
                     <span class=range>Range 3: 3071 to 3077</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=genbank&amp;log$=nuclalign&amp;from=3071&amp;to=3077">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440111?report=graph&amp;log$=nuclalign&amp;from=3071&amp;to=3077">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8119,14 +7796,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-42">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1B_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 3. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign">pdb|4A1B|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4A1B_1?report=genbank&amp;log$=nuclalign">gi|358440157|pdb|4A1B|1</a>
                     <span class=b>Length:</span> 3354
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -8140,7 +7816,7 @@
                   <div class=title>
                     <p class=hittitle>Chain 1, T.Thermophila 60s Ribosomal Subunit In Complex With Initiation Factor 6. This File Contains 26s Rrna And Proteins Of Molecule 2.</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/359807703?report=genbank&amp;log$=nuclalign">pdb|4A19|1</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|359807703|pdb|4A19|1</a>
                     </p>
                   </div>
                 </div>
@@ -8148,19 +7824,17 @@
                 <div class=hotspot id=hotspot1-42-1>
                   <p class=range>
                     <span class=range>Range 1: 2513 to 2521</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=2513&amp;to=2521">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=2513&amp;to=2521">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8172,19 +7846,17 @@
                 <div class=hotspot id=hotspot1-42-2>
                   <p class=range>
                     <span class=range>Range 2: 2947 to 2955</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=2947&amp;to=2955">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=2947&amp;to=2955">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8196,19 +7868,17 @@
                 <div class=hotspot id=hotspot1-42-3>
                   <p class=range>
                     <span class=range>Range 3: 3071 to 3077</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=genbank&amp;log$=nuclalign&amp;from=3071&amp;to=3077">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/358440157?report=graph&amp;log$=nuclalign&amp;from=3071&amp;to=3077">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8224,14 +7894,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-43">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0L_8?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9.8a Cryo-Em Map: Classic Pre State 1</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign">pdb|3J0L|8</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0L_8?report=genbank&amp;log$=nuclalign">gi|357380452|pdb|3J0L|8</a>
                     <span class=b>Length:</span> 20
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -8241,19 +7910,17 @@
                 <div class=hotspot id=hotspot1-43-1>
                   <p class=range>
                     <span class=range>Range 1: 3 to 11</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=genbank&amp;log$=nuclalign&amp;from=3&amp;to=11">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380452?report=graph&amp;log$=nuclalign&amp;from=3&amp;to=11">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8269,14 +7936,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-44">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0O_8?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 8, Core Of Mammalian 80s Pre-Ribosome In Complex With Trnas Fitted To A 9a Cryo-Em Map: Classic Pre State 2</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign">pdb|3J0O|8</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J0O_8?report=genbank&amp;log$=nuclalign">gi|357380483|pdb|3J0O|8</a>
                     <span class=b>Length:</span> 20
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -8286,19 +7952,17 @@
                 <div class=hotspot id=hotspot1-44-1>
                   <p class=range>
                     <span class=range>Range 1: 3 to 11</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=genbank&amp;log$=nuclalign&amp;from=3&amp;to=11">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/357380483?report=graph&amp;log$=nuclalign&amp;from=3&amp;to=11">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8314,14 +7978,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-45">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O58_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The First 80s In The Asymmetric Unit. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign">pdb|3O58|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O58_1?report=genbank&amp;log$=nuclalign">gi|315113523|pdb|3O58|1</a>
                     <span class=b>Length:</span> 3396
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -8335,13 +7998,13 @@
                   <div class=title>
                     <p class=hittitle>Chain 5, Cryo-Em Structure Of The 60s Ribosomal Subunit In Complex With Arx1 And Rei1 </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/418837761?report=genbank&amp;log$=nuclalign">pdb|4B6B|5</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|418837761|pdb|4B6B|5</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 1, Arx1 Pre-60s Particle. This Entry Contains The Rrna.</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/597959861?report=genbank&amp;log$=nuclalign">pdb|3J64|1</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|597959861|pdb|3J64|1</a>
                     </p>
                   </div>
                 </div>
@@ -8349,19 +8012,17 @@
                 <div class=hotspot id=hotspot1-45-1>
                   <p class=range>
                     <span class=range>Range 1: 2959 to 2967</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8373,19 +8034,17 @@
                 <div class=hotspot id=hotspot1-45-2>
                   <p class=range>
                     <span class=range>Range 2: 1634 to 1627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -8397,19 +8056,17 @@
                 <div class=hotspot id=hotspot1-45-3>
                   <p class=range>
                     <span class=range>Range 3: 2435 to 2442</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8421,19 +8078,17 @@
                 <div class=hotspot id=hotspot1-45-4>
                   <p class=range>
                     <span class=range>Range 4: 1100 to 1106</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8445,19 +8100,17 @@
                 <div class=hotspot id=hotspot1-45-5>
                   <p class=range>
                     <span class=range>Range 5: 2216 to 2222</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113523?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8473,14 +8126,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-46">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O5H_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 60s Subunit Of The Second 80s In The Asymmetric Unit. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign">pdb|3O5H|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O5H_1?report=genbank&amp;log$=nuclalign">gi|315113568|pdb|3O5H|1</a>
                     <span class=b>Length:</span> 3396
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -8494,13 +8146,13 @@
                   <div class=title>
                     <p class=hittitle>Chain 1, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 60s Subunit, Ribosome A </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506130?report=genbank&amp;log$=nuclalign">pdb|3U5D|1</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|364506130|pdb|3U5D|1</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 5, The Structure Of The Eukaryotic Ribosome At 3.0 A Resolution. This Entry Contains Ribosomal Rna And Ions Of The 60s Subunit, Ribosome B</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/364506168?report=genbank&amp;log$=nuclalign">pdb|3U5H|5</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|364506168|pdb|3U5H|5</a>
                     </p>
                   </div>
                 </div>
@@ -8508,19 +8160,17 @@
                 <div class=hotspot id=hotspot1-46-1>
                   <p class=range>
                     <span class=range>Range 1: 2959 to 2967</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8532,19 +8182,17 @@
                 <div class=hotspot id=hotspot1-46-2>
                   <p class=range>
                     <span class=range>Range 2: 1634 to 1627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -8556,19 +8204,17 @@
                 <div class=hotspot id=hotspot1-46-3>
                   <p class=range>
                     <span class=range>Range 3: 2435 to 2442</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8580,19 +8226,17 @@
                 <div class=hotspot id=hotspot1-46-4>
                   <p class=range>
                     <span class=range>Range 4: 1100 to 1106</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8604,19 +8248,17 @@
                 <div class=hotspot id=hotspot1-46-5>
                   <p class=range>
                     <span class=range>Range 5: 2216 to 2222</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113568?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8632,14 +8274,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-47">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O2Z_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The First 80s In The Asymmetric Unit.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign">pdb|3O2Z|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O2Z_1?report=genbank&amp;log$=nuclalign">gi|315113447|pdb|3O2Z|1</a>
                     <span class=b>Length:</span> 1800
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -8649,19 +8290,17 @@
                 <div class=hotspot id=hotspot1-47-1>
                   <p class=range>
                     <span class=range>Range 1: 1528 to 1536</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8673,19 +8312,17 @@
                 <div class=hotspot id=hotspot1-47-2>
                   <p class=range>
                     <span class=range>Range 2: 1006 to 1012</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8697,19 +8334,17 @@
                 <div class=hotspot id=hotspot1-47-3>
                   <p class=range>
                     <span class=range>Range 3: 1569 to 1563</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113447?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -8725,14 +8360,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-48">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O30_1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 1, Yeast 80s Ribosome. This Entry Consists Of The 40s Subunit Of The Second 80s In The Asymmetric Unit.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign">pdb|3O30|1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3O30_1?report=genbank&amp;log$=nuclalign">gi|315113475|pdb|3O30|1</a>
                     <span class=b>Length:</span> 1800
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -8742,19 +8376,17 @@
                 <div class=hotspot id=hotspot1-48-1>
                   <p class=range>
                     <span class=range>Range 1: 1528 to 1536</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8766,19 +8398,17 @@
                 <div class=hotspot id=hotspot1-48-2>
                   <p class=range>
                     <span class=range>Range 2: 1006 to 1012</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8790,19 +8420,17 @@
                 <div class=hotspot id=hotspot1-48-3>
                   <p class=range>
                     <span class=range>Range 3: 1569 to 1563</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/315113475?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -8818,14 +8446,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-49">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZF_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Model Of The Large Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome (With Es27l-In Conformation)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign">pdb|3IZF|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZF_A?report=genbank&amp;log$=nuclalign">gi|313103747|pdb|3IZF|A</a>
                     <span class=b>Length:</span> 3396
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -8835,19 +8462,17 @@
                 <div class=hotspot id=hotspot1-49-1>
                   <p class=range>
                     <span class=range>Range 1: 2959 to 2967</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2959&amp;to=2967">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2959&amp;to=2967">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8859,19 +8484,17 @@
                 <div class=hotspot id=hotspot1-49-2>
                   <p class=range>
                     <span class=range>Range 2: 1634 to 1627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=1634&amp;to=1627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=1634&amp;to=1627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -8883,19 +8506,17 @@
                 <div class=hotspot id=hotspot1-49-3>
                   <p class=range>
                     <span class=range>Range 3: 2435 to 2442</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2435&amp;to=2442">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2435&amp;to=2442">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8907,19 +8528,17 @@
                 <div class=hotspot id=hotspot1-49-4>
                   <p class=range>
                     <span class=range>Range 4: 1100 to 1106</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=1100&amp;to=1106">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=1100&amp;to=1106">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8931,19 +8550,17 @@
                 <div class=hotspot id=hotspot1-49-5>
                   <p class=range>
                     <span class=range>Range 5: 2216 to 2222</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=genbank&amp;log$=nuclalign&amp;from=2216&amp;to=2222">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103747?report=graph&amp;log$=nuclalign&amp;from=2216&amp;to=2222">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -8959,14 +8576,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-50">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZE_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Model Of The Small Subunit Rna Based On A 6.1 A Cryo-Em Map Of Saccharomyces Cerevisiae Translating 80s Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign">pdb|3IZE|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3IZE_A?report=genbank&amp;log$=nuclalign">gi|313103744|pdb|3IZE|A</a>
                     <span class=b>Length:</span> 1800
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -8976,19 +8592,17 @@
                 <div class=hotspot id=hotspot1-50-1>
                   <p class=range>
                     <span class=range>Range 1: 1528 to 1536</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1528&amp;to=1536">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1528&amp;to=1536">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9000,19 +8614,17 @@
                 <div class=hotspot id=hotspot1-50-2>
                   <p class=range>
                     <span class=range>Range 2: 1006 to 1012</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1006&amp;to=1012">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1006&amp;to=1012">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9024,19 +8636,17 @@
                 <div class=hotspot id=hotspot1-50-3>
                   <p class=range>
                     <span class=range>Range 3: 1569 to 1563</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=genbank&amp;log$=nuclalign&amp;from=1569&amp;to=1563">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/313103744?report=graph&amp;log$=nuclalign&amp;from=1569&amp;to=1563">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9052,14 +8662,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-51">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_I?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain I, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign">pdb|3KO2|I</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_I?report=genbank&amp;log$=nuclalign">gi|296278448|pdb|3KO2|I</a>
                     <span class=b>Length:</span> 24
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -9069,19 +8678,17 @@
                 <div class=hotspot id=hotspot1-51-1>
                   <p class=range>
                     <span class=range>Range 1: 19 to 11</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=genbank&amp;log$=nuclalign&amp;from=19&amp;to=11">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278448?report=graph&amp;log$=nuclalign&amp;from=19&amp;to=11">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9097,14 +8704,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-52">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_H?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain H, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign">pdb|3KO2|H</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_H?report=genbank&amp;log$=nuclalign">gi|296278447|pdb|3KO2|H</a>
                     <span class=b>Length:</span> 24
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -9114,19 +8720,17 @@
                 <div class=hotspot id=hotspot1-52-1>
                   <p class=range>
                     <span class=range>Range 1: 6 to 14</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=genbank&amp;log$=nuclalign&amp;from=6&amp;to=14">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278447?report=graph&amp;log$=nuclalign&amp;from=6&amp;to=14">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9142,14 +8746,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-53">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_D?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain D, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign">pdb|3KO2|D</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_D?report=genbank&amp;log$=nuclalign">gi|296278444|pdb|3KO2|D</a>
                     <span class=b>Length:</span> 24
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -9159,19 +8762,17 @@
                 <div class=hotspot id=hotspot1-53-1>
                   <p class=range>
                     <span class=range>Range 1: 19 to 11</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=genbank&amp;log$=nuclalign&amp;from=19&amp;to=11">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278444?report=graph&amp;log$=nuclalign&amp;from=19&amp;to=11">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9187,14 +8788,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-54">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_C?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain C, I-Msoi Re-Designed For Altered Dna Cleavage Specificity (-7c)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign">pdb|3KO2|C</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3KO2_C?report=genbank&amp;log$=nuclalign">gi|296278443|pdb|3KO2|C</a>
                     <span class=b>Length:</span> 24
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -9204,19 +8804,17 @@
                 <div class=hotspot id=hotspot1-54-1>
                   <p class=range>
                     <span class=range>Range 1: 6 to 14</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=genbank&amp;log$=nuclalign&amp;from=6&amp;to=14">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/296278443?report=graph&amp;log$=nuclalign&amp;from=6&amp;to=14">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9232,14 +8830,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-55">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3I56_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Co-Crystal Structure Of Triacetyloleandomcyin Bound To The Large Ribosomal Subunit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign">pdb|3I56|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3I56_0?report=genbank&amp;log$=nuclalign">gi|290790096|pdb|3I56|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -9249,19 +8846,17 @@
                 <div class=hotspot id=hotspot1-55-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9273,19 +8868,17 @@
                 <div class=hotspot id=hotspot1-55-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9297,19 +8890,17 @@
                 <div class=hotspot id=hotspot1-55-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/290790096?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9325,14 +8916,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-56">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYX_5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 5, Structure Of The 60s Rrna For Eukaryotic Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign">pdb|3JYX|5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYX_5?report=genbank&amp;log$=nuclalign">gi|281500859|pdb|3JYX|5</a>
                     <span class=b>Length:</span> 3170
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -9342,19 +8932,17 @@
                 <div class=hotspot id=hotspot1-56-1>
                   <p class=range>
                     <span class=range>Range 1: 2740 to 2748</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2740&amp;to=2748">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2740&amp;to=2748">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9366,19 +8954,17 @@
                 <div class=hotspot id=hotspot1-56-2>
                   <p class=range>
                     <span class=range>Range 2: 1587 to 1580</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=1587&amp;to=1580">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=1587&amp;to=1580">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9390,19 +8976,17 @@
                 <div class=hotspot id=hotspot1-56-3>
                   <p class=range>
                     <span class=range>Range 3: 2222 to 2229</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2222&amp;to=2229">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2222&amp;to=2229">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9414,19 +8998,17 @@
                 <div class=hotspot id=hotspot1-56-4>
                   <p class=range>
                     <span class=range>Range 4: 1344 to 1350</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=1344&amp;to=1350">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=1344&amp;to=1350">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9438,19 +9020,17 @@
                 <div class=hotspot id=hotspot1-56-5>
                   <p class=range>
                     <span class=range>Range 5: 2003 to 2009</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=genbank&amp;log$=nuclalign&amp;from=2003&amp;to=2009">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500859?report=graph&amp;log$=nuclalign&amp;from=2003&amp;to=2009">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9466,14 +9046,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-57">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYV_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Structure Of The 40s Rrna And Proteins And PE TRNA FOR EUKARYOTIC Ribosome Based On Cryo-Em Map Of Thermomyces Lanuginosus Ribosome At 8.9a Resolution</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign">pdb|3JYV|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3JYV_A?report=genbank&amp;log$=nuclalign">gi|281500807|pdb|3JYV|A</a>
                     <span class=b>Length:</span> 1761
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -9483,19 +9062,17 @@
                 <div class=hotspot id=hotspot1-57-1>
                   <p class=range>
                     <span class=range>Range 1: 1492 to 1500</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=1492&amp;to=1500">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=1492&amp;to=1500">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9507,19 +9084,17 @@
                 <div class=hotspot id=hotspot1-57-2>
                   <p class=range>
                     <span class=range>Range 2: 981 to 987</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=981&amp;to=987">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=981&amp;to=987">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9531,19 +9106,17 @@
                 <div class=hotspot id=hotspot1-57-3>
                   <p class=range>
                     <span class=range>Range 3: 1533 to 1527</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=genbank&amp;log$=nuclalign&amp;from=1533&amp;to=1527">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/281500807?report=graph&amp;log$=nuclalign&amp;from=1533&amp;to=1527">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9559,14 +9132,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-58">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S1I_3?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 3, Structure Of The Ribosomal 80s-Eef2-Sordarin Complex From Yeast Obtained By Docking Atomic Models For Rna And Protein Components Into A 11.7 A Cryo-Em Map. This File, 1s1i, Contains 60s Subunit. The 40s Ribosomal Subunit Is In File 1s1h.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign">pdb|1S1I|3</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S1I_3?report=genbank&amp;log$=nuclalign">gi|259090425|pdb|1S1I|3</a>
                     <span class=b>Length:</span> 2999
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -9576,19 +9148,17 @@
                 <div class=hotspot id=hotspot1-58-1>
                   <p class=range>
                     <span class=range>Range 1: 2710 to 2718</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign&amp;from=2710&amp;to=2718">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign&amp;from=2710&amp;to=2718">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9600,19 +9170,17 @@
                 <div class=hotspot id=hotspot1-58-2>
                   <p class=range>
                     <span class=range>Range 2: 2691 to 2697</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=genbank&amp;log$=nuclalign&amp;from=2691&amp;to=2697">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/259090425?report=graph&amp;log$=nuclalign&amp;from=2691&amp;to=2697">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9628,14 +9196,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-59">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QEX_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Negamycin Binds To The Wall Of The Nascent Chain Exit Tunnel Of The 50s Ribosomal Subunit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign">pdb|2QEX|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QEX_0?report=genbank&amp;log$=nuclalign">gi|208435493|pdb|2QEX|0</a>
                     <span class=b>Length:</span> 2772
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -9645,19 +9212,17 @@
                 <div class=hotspot id=hotspot1-59-1>
                   <p class=range>
                     <span class=range>Range 1: 2476 to 2484</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign&amp;from=2476&amp;to=2484">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign&amp;from=2476&amp;to=2484">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9669,19 +9234,17 @@
                 <div class=hotspot id=hotspot1-59-2>
                   <p class=range>
                     <span class=range>Range 2: 2457 to 2463</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=genbank&amp;log$=nuclalign&amp;from=2457&amp;to=2463">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/208435493?report=graph&amp;log$=nuclalign&amp;from=2457&amp;to=2463">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9697,14 +9260,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-60">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CPW_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, The Structure Of The Antibiotic Linezolid Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign">pdb|3CPW|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CPW_0?report=genbank&amp;log$=nuclalign">gi|194368703|pdb|3CPW|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -9714,19 +9276,17 @@
                 <div class=hotspot id=hotspot1-60-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9738,19 +9298,17 @@
                 <div class=hotspot id=hotspot1-60-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/194368703?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9766,14 +9324,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-61">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCV_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2616a </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign">pdb|3CCV|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCV_0?report=genbank&amp;log$=nuclalign">gi|188596372|pdb|3CCV|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -9787,7 +9344,7 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-cystal Of Large Ribosomal Subunit Mutant G2616a With Cc-puromycin</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596403?report=genbank&amp;log$=nuclalign">pdb|3CD6|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|188596403|pdb|3CD6|0</a>
                     </p>
                   </div>
                 </div>
@@ -9795,19 +9352,17 @@
                 <div class=hotspot id=hotspot1-61-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9819,19 +9374,17 @@
                 <div class=hotspot id=hotspot1-61-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9843,19 +9396,17 @@
                 <div class=hotspot id=hotspot1-61-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596372?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9871,14 +9422,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-62">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCU_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482c</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign">pdb|3CCU|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCU_0?report=genbank&amp;log$=nuclalign">gi|188596341|pdb|3CCU|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -9888,19 +9438,17 @@
                 <div class=hotspot id=hotspot1-62-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -9912,19 +9460,17 @@
                 <div class=hotspot id=hotspot1-62-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9936,19 +9482,17 @@
                 <div class=hotspot id=hotspot1-62-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596341?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -9964,14 +9508,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-63">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCS_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2482a</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign">pdb|3CCS|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCS_0?report=genbank&amp;log$=nuclalign">gi|188596310|pdb|3CCS|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -9981,19 +9524,17 @@
                 <div class=hotspot id=hotspot1-63-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10005,19 +9546,17 @@
                 <div class=hotspot id=hotspot1-63-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10029,19 +9568,17 @@
                 <div class=hotspot id=hotspot1-63-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596310?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10057,14 +9594,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-64">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCR_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488c. Density For Anisomycin Is Visible But Not Included In The Model.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign">pdb|3CCR|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCR_0?report=genbank&amp;log$=nuclalign">gi|188596279|pdb|3CCR|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10074,19 +9610,17 @@
                 <div class=hotspot id=hotspot1-64-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10098,19 +9632,17 @@
                 <div class=hotspot id=hotspot1-64-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10122,19 +9654,17 @@
                 <div class=hotspot id=hotspot1-64-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596279?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10150,14 +9680,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-65">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCQ_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation A2488u</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign">pdb|3CCQ|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCQ_0?report=genbank&amp;log$=nuclalign">gi|188596248|pdb|3CCQ|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10167,19 +9696,17 @@
                 <div class=hotspot id=hotspot1-65-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10191,19 +9718,17 @@
                 <div class=hotspot id=hotspot1-65-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10215,19 +9740,17 @@
                 <div class=hotspot id=hotspot1-65-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596248?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10243,14 +9766,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-66">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCM_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation G2611u</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign">pdb|3CCM|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCM_0?report=genbank&amp;log$=nuclalign">gi|188596217|pdb|3CCM|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -10260,19 +9782,17 @@
                 <div class=hotspot id=hotspot1-66-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10284,19 +9804,17 @@
                 <div class=hotspot id=hotspot1-66-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596217?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10312,14 +9830,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-67">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCL_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535c. Density For Anisomycin Is Visible But Not Included In Model.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign">pdb|3CCL|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCL_0?report=genbank&amp;log$=nuclalign">gi|188596186|pdb|3CCL|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10329,19 +9846,17 @@
                 <div class=hotspot id=hotspot1-67-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10353,19 +9868,17 @@
                 <div class=hotspot id=hotspot1-67-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10377,19 +9890,17 @@
                 <div class=hotspot id=hotspot1-67-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596186?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10405,14 +9916,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-68">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCJ_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2534u</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign">pdb|3CCJ|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCJ_0?report=genbank&amp;log$=nuclalign">gi|188596155|pdb|3CCJ|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10422,19 +9932,17 @@
                 <div class=hotspot id=hotspot1-68-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10446,19 +9954,17 @@
                 <div class=hotspot id=hotspot1-68-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10470,19 +9976,17 @@
                 <div class=hotspot id=hotspot1-68-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596155?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10498,14 +10002,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-69">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCE_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation U2535a</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign">pdb|3CCE|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CCE_0?report=genbank&amp;log$=nuclalign">gi|188596124|pdb|3CCE|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10515,19 +10018,17 @@
                 <div class=hotspot id=hotspot1-69-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10539,19 +10040,17 @@
                 <div class=hotspot id=hotspot1-69-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10563,19 +10062,17 @@
                 <div class=hotspot id=hotspot1-69-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596124?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10591,14 +10088,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-70">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC7_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of Anisomycin Resistant 50s Ribosomal Subunit: 23s Rrna Mutation C2487u</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign">pdb|3CC7|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC7_0?report=genbank&amp;log$=nuclalign">gi|188596093|pdb|3CC7|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10608,19 +10104,17 @@
                 <div class=hotspot id=hotspot1-70-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10632,19 +10126,17 @@
                 <div class=hotspot id=hotspot1-70-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10656,19 +10148,17 @@
                 <div class=hotspot id=hotspot1-70-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596093?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10684,14 +10174,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-71">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC2_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, The Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution With Rrna Sequence For The 23s Rrna And Genome-Derived Sequences For R-Proteins </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign">pdb|3CC2|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3CC2_0?report=genbank&amp;log$=nuclalign">gi|188596031|pdb|3CC2|0</a>
                     <span class=b>Length:</span> 2923
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -10705,43 +10194,43 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-Crystal Structure Of Anisomycin Bound To The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/188596062?report=genbank&amp;log$=nuclalign">pdb|3CC4|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|188596062|pdb|3CC4|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Cca And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/206581937?report=genbank&amp;log$=nuclalign">pdb|3CMA|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|206581937|pdb|3CMA|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Ca And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/206581970?report=genbank&amp;log$=nuclalign">pdb|3CME|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|206581970|pdb|3CME|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-Crystal Structure Of Tiamulin Bound To The Large Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312141?report=genbank&amp;log$=nuclalign">pdb|3G4S|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|228312141|pdb|3G4S|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-Crystal Structure Of Homoharringtonine Bound To The Large Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312197?report=genbank&amp;log$=nuclalign">pdb|3G6E|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|228312197|pdb|3G6E|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-crystal Structure Of Bruceantin Bound To The Large Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228312233?report=genbank&amp;log$=nuclalign">pdb|3G71|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|228312233|pdb|3G71|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Co-Crystal Structure Of Mycalamide A Bound To The Large Ribosomal Subunit</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/290790035?report=genbank&amp;log$=nuclalign">pdb|3I55|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|290790035|pdb|3I55|0</a>
                     </p>
                   </div>
                 </div>
@@ -10749,19 +10238,17 @@
                 <div class=hotspot id=hotspot1-71-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -10773,19 +10260,17 @@
                 <div class=hotspot id=hotspot1-71-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10797,19 +10282,17 @@
                 <div class=hotspot id=hotspot1-71-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/188596031?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10825,14 +10308,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-72">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2ZKR_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Structure Of A Mammalian Ribosomal 60s Subunit Within An 80s Complex Obtained By Docking Homology Models Of The Rna And Proteins Into An 8.7 A Cryo-Em Map</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign">pdb|2ZKR|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2ZKR_0?report=genbank&amp;log$=nuclalign">gi|187609272|pdb|2ZKR|0</a>
                     <span class=b>Length:</span> 2903
                     <span class=b>Number of Matches:</span> 4
                   </p>
@@ -10842,19 +10324,17 @@
                 <div class=hotspot id=hotspot1-72-1>
                   <p class=range>
                     <span class=range>Range 1: 2623 to 2631</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=2623&amp;to=2631">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=2623&amp;to=2631">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10866,19 +10346,17 @@
                 <div class=hotspot id=hotspot1-72-2>
                   <p class=range>
                     <span class=range>Range 2: 2111 to 2118</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=2111&amp;to=2118">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=2111&amp;to=2118">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10890,19 +10368,17 @@
                 <div class=hotspot id=hotspot1-72-3>
                   <p class=range>
                     <span class=range>Range 3: 353 to 359</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=353&amp;to=359">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=353&amp;to=359">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10914,19 +10390,17 @@
                 <div class=hotspot id=hotspot1-72-4>
                   <p class=range>
                     <span class=range>Range 4: 1892 to 1898</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=genbank&amp;log$=nuclalign&amp;from=1892&amp;to=1898">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/187609272?report=graph&amp;log$=nuclalign&amp;from=1892&amp;to=1898">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10942,14 +10416,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-73">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QA4_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, A More Complete Structure Of The The L7L12 STALK OF THE Haloarcula Marismortui 50s Large Ribosomal Subunit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign">pdb|2QA4|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2QA4_0?report=genbank&amp;log$=nuclalign">gi|171848835|pdb|2QA4|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -10959,19 +10432,17 @@
                 <div class=hotspot id=hotspot1-73-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -10983,19 +10454,17 @@
                 <div class=hotspot id=hotspot1-73-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/171848835?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11011,14 +10480,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-74">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2FTC_R?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain R, Structural Model For The Large Subunit Of The Mammalian Mitochondrial Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign">pdb|2FTC|R</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2FTC_R?report=genbank&amp;log$=nuclalign">gi|99032306|pdb|2FTC|R</a>
                     <span class=b>Length:</span> 1568
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -11028,19 +10496,17 @@
                 <div class=hotspot id=hotspot1-74-1>
                   <p class=range>
                     <span class=range>Range 1: 1032 to 1040</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=genbank&amp;log$=nuclalign&amp;from=1032&amp;to=1040">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/99032306?report=graph&amp;log$=nuclalign&amp;from=1032&amp;to=1040">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11056,14 +10522,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-75">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S72_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign">pdb|1S72|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1S72_0?report=genbank&amp;log$=nuclalign">gi|50513468|pdb|1S72|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11077,85 +10542,85 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;daa&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753123?report=genbank&amp;log$=nuclalign">pdb|1VQ4|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753123|pdb|1VQ4|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;raa&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753155?report=genbank&amp;log$=nuclalign">pdb|1VQ5|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753155|pdb|1VQ5|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of C-Hpmn And Cca-Phe-Cap-Bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753187?report=genbank&amp;log$=nuclalign">pdb|1VQ6|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753187|pdb|1VQ6|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dca&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753219?report=genbank&amp;log$=nuclalign">pdb|1VQ7|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753219|pdb|1VQ7|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Ccda-Phe-Cap-Bio And The Antibiotic Sparsomycin Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753251?report=genbank&amp;log$=nuclalign">pdb|1VQ8|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753251|pdb|1VQ8|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Cca-Phe-Cap-Bio And The Antibiotic Sparsomycin Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753282?report=genbank&amp;log$=nuclalign">pdb|1VQ9|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753282|pdb|1VQ9|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Ccda-Phe-Cap-Bio Bound To The A Site Of The Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753314?report=genbank&amp;log$=nuclalign">pdb|1VQK|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753314|pdb|1VQK|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dcsn&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753345?report=genbank&amp;log$=nuclalign">pdb|1VQL|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753345|pdb|1VQL|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;dan&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753376?report=genbank&amp;log$=nuclalign">pdb|1VQM|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753376|pdb|1VQM|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Cc-hpmn And Cca-phe-cap-bio Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753407?report=genbank&amp;log$=nuclalign">pdb|1VQN|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753407|pdb|1VQN|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of Ccpmn Bound To The Large Ribosomal Subunit Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753439?report=genbank&amp;log$=nuclalign">pdb|1VQO|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753439|pdb|1VQO|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of The Transition State Analogue &#34;rap&#34; Bound To The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/83753470?report=genbank&amp;log$=nuclalign">pdb|1VQP|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|83753470|pdb|1VQP|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, 13-Deoxytedanolide Bound To The Large Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/145580171?report=genbank&amp;log$=nuclalign">pdb|2OTJ|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|145580171|pdb|2OTJ|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Girodazole Bound To The Large Subunit Of Haloarcula Marismortui</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/145580202?report=genbank&amp;log$=nuclalign">pdb|2OTL|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|145580202|pdb|2OTL|0</a>
                     </p>
                   </div>
                 </div>
@@ -11163,19 +10628,17 @@
                 <div class=hotspot id=hotspot1-75-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11187,19 +10650,17 @@
                 <div class=hotspot id=hotspot1-75-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/50513468?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11215,14 +10676,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-76">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YIT_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Crystal Structure Of Virginiamycin M And S Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign">pdb|1YIT|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YIT_0?report=genbank&amp;log$=nuclalign">gi|66360881|pdb|1YIT|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -11236,7 +10696,7 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, Crystal Structure Of The Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui Containing A Three Residue Deletion In L22</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360914?report=genbank&amp;log$=nuclalign">pdb|1YJ9|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|66360914|pdb|1YJ9|0</a>
                     </p>
                   </div>
                 </div>
@@ -11244,19 +10704,17 @@
                 <div class=hotspot id=hotspot1-76-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -11268,19 +10726,17 @@
                 <div class=hotspot id=hotspot1-76-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11292,19 +10748,17 @@
                 <div class=hotspot id=hotspot1-76-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360881?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11320,14 +10774,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-77">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YHQ_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Crystal Structure Of Azithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign">pdb|1YHQ|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YHQ_0?report=genbank&amp;log$=nuclalign">gi|66360782|pdb|1YHQ|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -11341,19 +10794,19 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, Crystal Structure Of Erythromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360815?report=genbank&amp;log$=nuclalign">pdb|1YI2|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|66360815|pdb|1YI2|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Crystal Structure Of Telithromycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360848?report=genbank&amp;log$=nuclalign">pdb|1YIJ|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|66360848|pdb|1YIJ|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Crystal Structure Of Clindamycin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360947?report=genbank&amp;log$=nuclalign">pdb|1YJN|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|66360947|pdb|1YJN|0</a>
                     </p>
                   </div>
                 </div>
@@ -11361,19 +10814,17 @@
                 <div class=hotspot id=hotspot1-77-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -11385,19 +10836,17 @@
                 <div class=hotspot id=hotspot1-77-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11409,19 +10858,17 @@
                 <div class=hotspot id=hotspot1-77-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360782?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11437,14 +10884,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-78">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YJW_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Crystal Structure Of Quinupristin Bound To The G2099a Mutant 50s Ribosomal Subunit Of Haloarcula Marismortui</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign">pdb|1YJW|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1YJW_0?report=genbank&amp;log$=nuclalign">gi|66360980|pdb|1YJW|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 3
                   </p>
@@ -11454,19 +10900,17 @@
                 <div class=hotspot id=hotspot1-78-1>
                   <p class=range>
                     <span class=range>Range 1: 305 to 297</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=305&amp;to=297">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=305&amp;to=297">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -11478,19 +10922,17 @@
                 <div class=hotspot id=hotspot1-78-2>
                   <p class=range>
                     <span class=range>Range 2: 2625 to 2633</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=2625&amp;to=2633">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=2625&amp;to=2633">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11502,19 +10944,17 @@
                 <div class=hotspot id=hotspot1-78-3>
                   <p class=range>
                     <span class=range>Range 3: 2606 to 2612</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=genbank&amp;log$=nuclalign&amp;from=2606&amp;to=2612">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/66360980?report=graph&amp;log$=nuclalign&amp;from=2606&amp;to=2612">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11530,14 +10970,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-79">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1Q86_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of Cca-Phe-Cap-Biotin Bound Simultaneously At Half Occupancy To Both The A-Site And P- Site Of The The 50s Ribosomal Subunit.</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign">pdb|1Q86|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1Q86_A?report=genbank&amp;log$=nuclalign">gi|37928006|pdb|1Q86|A</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11547,19 +10986,17 @@
                 <div class=hotspot id=hotspot1-79-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11571,19 +11008,17 @@
                 <div class=hotspot id=hotspot1-79-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/37928006?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11599,14 +11034,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-80">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1JJ2_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Fully Refined Crystal Structure Of The Haloarcula Marismortui Large Ribosomal Subunit At 2.4 Angstrom Resolution </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign">pdb|1JJ2|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1JJ2_0?report=genbank&amp;log$=nuclalign">gi|15825941|pdb|1JJ2|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11620,97 +11054,97 @@
                   <div class=title>
                     <p class=hittitle>Chain 0, The Haloarcula Marismortui 50s Complexed With A Pretranslocational Intermediate In Protein Synthesis </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/20150986?report=genbank&amp;log$=nuclalign">pdb|1KQS|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|20150986|pdb|1KQS|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-Crystal Structure Of Azithromycin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/22219324?report=genbank&amp;log$=nuclalign">pdb|1M1K|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|22219324|pdb|1M1K|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-Crystal Structure Of Cca-Phe-Caproic Acid-Biotin And Sparsomycin Bound To The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/24159019?report=genbank&amp;log$=nuclalign">pdb|1M90|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|24159019|pdb|1M90|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-Crystal Structure Of Anisomycin Bound To The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811116?report=genbank&amp;log$=nuclalign">pdb|1K73|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|34811116|pdb|1K73|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of Large Ribosomal Subunit In Complex With Virginiamycin M </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811185?report=genbank&amp;log$=nuclalign">pdb|1N8R|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|34811185|pdb|1N8R|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of Chloramphenicol Bound To The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811215?report=genbank&amp;log$=nuclalign">pdb|1NJI|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|34811215|pdb|1NJI|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Ccdap-puromycin Bound At The Peptidyl Transferase Center Of The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927899?report=genbank&amp;log$=nuclalign">pdb|1Q7Y|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|37927899|pdb|1Q7Y|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Minihelix With 3&#39; Puromycin Bound To A- Site Of The 50s Ribosomal Subunit. </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927934?report=genbank&amp;log$=nuclalign">pdb|1Q81|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|37927934|pdb|1Q81|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Cc-Puromycin Bound To The A-Site Of The 50s Ribosomal Subunit </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/37927970?report=genbank&amp;log$=nuclalign">pdb|1Q82|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|37927970|pdb|1Q82|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Structure Of A Deacylated Trna Minihelix Bound To The E Site Of The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/39654670?report=genbank&amp;log$=nuclalign">pdb|1QVF|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|39654670|pdb|1QVF|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Structure Of Cca Oligonucleotide Bound To The Trna Binding Sites Of The Large Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/39654701?report=genbank&amp;log$=nuclalign">pdb|1QVG|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|39654701|pdb|1QVG|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-Crystal Structure Of Carbomycin A Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878615?report=genbank&amp;log$=nuclalign">pdb|1K8A|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157878615|pdb|1K8A|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-Crystal Structure Of Tylosin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878625?report=genbank&amp;log$=nuclalign">pdb|1K9M|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157878625|pdb|1K9M|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain A, Co-crystal Structure Of Spiramycin Bound To The 50s Ribosomal Subunit Of Haloarcula Marismortui </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157878639?report=genbank&amp;log$=nuclalign">pdb|1KD1|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157878639|pdb|1KD1|A</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, Trigger Factor Ribosome Binding Domain In Complex With 50s </p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/157880605?report=genbank&amp;log$=nuclalign">pdb|1W2B|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|157880605|pdb|1W2B|0</a>
                     </p>
                   </div>
                   <div class=title>
                     <p class=hittitle>Chain 0, The Structure Of An Enhanced Oxazolidinone Inhibitor Bound To The 50s Ribosomal Subunit Of H. Marismortui</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/228311909?report=genbank&amp;log$=nuclalign">pdb|3CXC|0</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|228311909|pdb|3CXC|0</a>
                     </p>
                   </div>
                 </div>
@@ -11718,19 +11152,17 @@
                 <div class=hotspot id=hotspot1-80-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11742,19 +11174,17 @@
                 <div class=hotspot id=hotspot1-80-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/15825941?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11770,14 +11200,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-81">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1KC8_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Co-Crystal Structure Of Blasticidin S Bound To The 50s Ribosomal Subunit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign">pdb|1KC8|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1KC8_A?report=genbank&amp;log$=nuclalign">gi|34811146|pdb|1KC8|A</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11787,19 +11216,17 @@
                 <div class=hotspot id=hotspot1-81-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11811,19 +11238,17 @@
                 <div class=hotspot id=hotspot1-81-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/34811146?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11839,14 +11264,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-82">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFK_0?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain 0, Crystal Structure Of The Large Ribosomal Subunit From Haloarcula Marismortui At 2.4 Angstrom Resolution</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign">pdb|1FFK|0</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFK_0?report=genbank&amp;log$=nuclalign">gi|10120918|pdb|1FFK|0</a>
                     <span class=b>Length:</span> 2922
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11856,19 +11280,17 @@
                 <div class=hotspot id=hotspot1-82-1>
                   <p class=range>
                     <span class=range>Range 1: 2624 to 2632</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign&amp;from=2624&amp;to=2632">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign&amp;from=2624&amp;to=2632">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11880,19 +11302,17 @@
                 <div class=hotspot id=hotspot1-82-2>
                   <p class=range>
                     <span class=range>Range 2: 2605 to 2611</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=genbank&amp;log$=nuclalign&amp;from=2605&amp;to=2611">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120918?report=graph&amp;log$=nuclalign&amp;from=2605&amp;to=2611">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11908,14 +11328,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-83">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FG0_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Large Ribosomal Subunit Complexed With A 13 Bp Minihelix- Puromycin Compound</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign">pdb|1FG0|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FG0_A?report=genbank&amp;log$=nuclalign">gi|10120728|pdb|1FG0|A</a>
                     <span class=b>Length:</span> 602
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11925,19 +11344,17 @@
                 <div class=hotspot id=hotspot1-83-1>
                   <p class=range>
                     <span class=range>Range 1: 563 to 571</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign&amp;from=563&amp;to=571">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign&amp;from=563&amp;to=571">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11949,19 +11366,17 @@
                 <div class=hotspot id=hotspot1-83-2>
                   <p class=range>
                     <span class=range>Range 2: 544 to 550</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=genbank&amp;log$=nuclalign&amp;from=544&amp;to=550">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120728?report=graph&amp;log$=nuclalign&amp;from=544&amp;to=550">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -11977,14 +11392,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-84">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFZ_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Large Ribosomal Subunit Complexed With R(Cc)-Da-Puromycin</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign">pdb|1FFZ|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1FFZ_A?report=genbank&amp;log$=nuclalign">gi|10120727|pdb|1FFZ|A</a>
                     <span class=b>Length:</span> 602
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -11994,19 +11408,17 @@
                 <div class=hotspot id=hotspot1-84-1>
                   <p class=range>
                     <span class=range>Range 1: 563 to 571</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign&amp;from=563&amp;to=571">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign&amp;from=563&amp;to=571">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>18.3 bits(9)</td>
-                      <td>11.9</td>
-                      <td>9/9(100%)</td>
-                      <td>0/9(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>18.3341 bits (9)</td>
+                      <td>11.9013</td>
+                      <td>9/9 (100%)</td>
+                      <td>0/9 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12018,19 +11430,17 @@
                 <div class=hotspot id=hotspot1-84-2>
                   <p class=range>
                     <span class=range>Range 2: 544 to 550</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=genbank&amp;log$=nuclalign&amp;from=544&amp;to=550">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/10120727?report=graph&amp;log$=nuclalign&amp;from=544&amp;to=550">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12046,14 +11456,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-85">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_F?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain F, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign">pdb|4LGT|F</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_F?report=genbank&amp;log$=nuclalign">gi|558705015|pdb|4LGT|F</a>
                     <span class=b>Length:</span> 21
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -12063,19 +11472,17 @@
                 <div class=hotspot id=hotspot1-85-1>
                   <p class=range>
                     <span class=range>Range 1: 5 to 12</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=genbank&amp;log$=nuclalign&amp;from=5&amp;to=12">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705015?report=graph&amp;log$=nuclalign&amp;from=5&amp;to=12">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12091,14 +11498,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-86">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_E?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain E, Crystal Structure Of The Catalytic Domain Of Rlub In Complex With A 21-nucleotide Rna Substrate</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign">pdb|4LGT|E</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4LGT_E?report=genbank&amp;log$=nuclalign">gi|558705013|pdb|4LGT|E</a>
                     <span class=b>Length:</span> 21
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -12108,19 +11514,17 @@
                 <div class=hotspot id=hotspot1-86-1>
                   <p class=range>
                     <span class=range>Range 1: 5 to 12</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=genbank&amp;log$=nuclalign&amp;from=5&amp;to=12">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/558705013?report=graph&amp;log$=nuclalign&amp;from=5&amp;to=12">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12136,14 +11540,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-87">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BTD_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Thermus Thermophilus Ribosome</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign">pdb|4BTD|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4BTD_A?report=genbank&amp;log$=nuclalign">gi|529280935|pdb|4BTD|A</a>
                     <span class=b>Length:</span> 2915
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12153,19 +11556,17 @@
                 <div class=hotspot id=hotspot1-87-1>
                   <p class=range>
                     <span class=range>Range 1: 2048 to 2055</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12177,19 +11578,17 @@
                 <div class=hotspot id=hotspot1-87-2>
                   <p class=range>
                     <span class=range>Range 2: 2603 to 2610</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/529280935?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12205,14 +11604,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-88">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4L6J_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The First 70s Ribosome. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign">pdb|4L6J|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4L6J_A?report=genbank&amp;log$=nuclalign">gi|528082310|pdb|4L6J|A</a>
                     <span class=b>Length:</span> 2879
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12226,7 +11624,7 @@
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of Blasticidin S Bound To Thermus Thermophilus 70s Ribosome. This File Contains The 50s Subunit And Blasticidin S Molecule From The Second 70s Ribosome</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/528082364?report=genbank&amp;log$=nuclalign">pdb|4L6L|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|528082364|pdb|4L6L|A</a>
                     </p>
                   </div>
                 </div>
@@ -12234,19 +11632,17 @@
                 <div class=hotspot id=hotspot1-88-1>
                   <p class=range>
                     <span class=range>Range 1: 2021 to 2028</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign&amp;from=2021&amp;to=2028">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign&amp;from=2021&amp;to=2028">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12258,19 +11654,17 @@
                 <div class=hotspot id=hotspot1-88-2>
                   <p class=range>
                     <span class=range>Range 2: 2576 to 2583</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=genbank&amp;log$=nuclalign&amp;from=2576&amp;to=2583">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/528082310?report=graph&amp;log$=nuclalign&amp;from=2576&amp;to=2583">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12286,14 +11680,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-89">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4KFI_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The A Subunit </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign">pdb|4KFI|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4KFI_A?report=genbank&amp;log$=nuclalign">gi|520729408|pdb|4KFI|A</a>
                     <span class=b>Length:</span> 2879
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12307,7 +11700,7 @@
                   <div class=title>
                     <p class=hittitle>Chain A, Crystal Structure Of The 70s Ribosome Bound With The Q253p Mutant Of Release Factor Rf2. 50s Of The B Subunit</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520729463?report=genbank&amp;log$=nuclalign">pdb|4KFL|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|520729463|pdb|4KFL|A</a>
                     </p>
                   </div>
                 </div>
@@ -12315,19 +11708,17 @@
                 <div class=hotspot id=hotspot1-89-1>
                   <p class=range>
                     <span class=range>Range 1: 2021 to 2028</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign&amp;from=2021&amp;to=2028">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign&amp;from=2021&amp;to=2028">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12339,19 +11730,17 @@
                 <div class=hotspot id=hotspot1-89-2>
                   <p class=range>
                     <span class=range>Range 2: 2576 to 2583</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=genbank&amp;log$=nuclalign&amp;from=2576&amp;to=2583">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520729408?report=graph&amp;log$=nuclalign&amp;from=2576&amp;to=2583">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12367,14 +11756,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-90">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0Q_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign">pdb|4K0Q|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0Q_A?report=genbank&amp;log$=nuclalign">gi|520728860|pdb|4K0Q|A</a>
                     <span class=b>Length:</span> 2915
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12384,19 +11772,17 @@
                 <div class=hotspot id=hotspot1-90-1>
                   <p class=range>
                     <span class=range>Range 1: 2048 to 2055</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12408,19 +11794,17 @@
                 <div class=hotspot id=hotspot1-90-2>
                   <p class=range>
                     <span class=range>Range 2: 2603 to 2610</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728860?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12436,14 +11820,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-91">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0M_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of Thermus Thermophilus 70s Containing Trnas And Mrna Stop Codon With Pseudouridine</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign">pdb|4K0M|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4K0M_A?report=genbank&amp;log$=nuclalign">gi|520728802|pdb|4K0M|A</a>
                     <span class=b>Length:</span> 2915
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12453,19 +11836,17 @@
                 <div class=hotspot id=hotspot1-91-1>
                   <p class=range>
                     <span class=range>Range 1: 2048 to 2055</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12477,19 +11858,17 @@
                 <div class=hotspot id=hotspot1-91-2>
                   <p class=range>
                     <span class=range>Range 2: 2603 to 2610</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/520728802?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12505,14 +11884,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-92">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3V_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state I-a)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign">pdb|3J3V|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3V_A?report=genbank&amp;log$=nuclalign">gi|512125286|pdb|3J3V|A</a>
                     <span class=b>Length:</span> 2927
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -12522,19 +11900,17 @@
                 <div class=hotspot id=hotspot1-92-1>
                   <p class=range>
                     <span class=range>Range 1: 2620 to 2627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2620&amp;to=2627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2620&amp;to=2627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12546,19 +11922,17 @@
                 <div class=hotspot id=hotspot1-92-2>
                   <p class=range>
                     <span class=range>Range 2: 340 to 346</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=340&amp;to=346">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=340&amp;to=346">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12570,19 +11944,17 @@
                 <div class=hotspot id=hotspot1-92-3>
                   <p class=range>
                     <span class=range>Range 3: 440 to 446</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=440&amp;to=446">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=440&amp;to=446">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12594,19 +11966,17 @@
                 <div class=hotspot id=hotspot1-92-4>
                   <p class=range>
                     <span class=range>Range 4: 2056 to 2062</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2056&amp;to=2062">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2056&amp;to=2062">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12618,19 +11988,17 @@
                 <div class=hotspot id=hotspot1-92-5>
                   <p class=range>
                     <span class=range>Range 5: 2644 to 2650</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=genbank&amp;log$=nuclalign&amp;from=2644&amp;to=2650">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125286?report=graph&amp;log$=nuclalign&amp;from=2644&amp;to=2650">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12646,14 +12014,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-93">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3W_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Atomic Model Of The Immature 50s Subunit From Bacillus Subtilis (state Ii-a)</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign">pdb|3J3W|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3J3W_A?report=genbank&amp;log$=nuclalign">gi|512125306|pdb|3J3W|A</a>
                     <span class=b>Length:</span> 2927
                     <span class=b>Number of Matches:</span> 5
                   </p>
@@ -12663,19 +12030,17 @@
                 <div class=hotspot id=hotspot1-93-1>
                   <p class=range>
                     <span class=range>Range 1: 2620 to 2627</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2620&amp;to=2627">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2620&amp;to=2627">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12687,19 +12052,17 @@
                 <div class=hotspot id=hotspot1-93-2>
                   <p class=range>
                     <span class=range>Range 2: 340 to 346</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=340&amp;to=346">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=340&amp;to=346">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12711,19 +12074,17 @@
                 <div class=hotspot id=hotspot1-93-3>
                   <p class=range>
                     <span class=range>Range 3: 440 to 446</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=440&amp;to=446">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=440&amp;to=446">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12735,19 +12096,17 @@
                 <div class=hotspot id=hotspot1-93-4>
                   <p class=range>
                     <span class=range>Range 4: 2056 to 2062</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2056&amp;to=2062">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2056&amp;to=2062">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12759,19 +12118,17 @@
                 <div class=hotspot id=hotspot1-93-5>
                   <p class=range>
                     <span class=range>Range 5: 2644 to 2650</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=genbank&amp;log$=nuclalign&amp;from=2644&amp;to=2650">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/512125306?report=graph&amp;log$=nuclalign&amp;from=2644&amp;to=2650">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12787,14 +12144,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-94">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6X_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The Second 70s Molecule In The Asymmetric Unit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign">pdb|3V6X|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6X_A?report=genbank&amp;log$=nuclalign">gi|482676744|pdb|3V6X|A</a>
                     <span class=b>Length:</span> 2916
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12804,19 +12160,17 @@
                 <div class=hotspot id=hotspot1-94-1>
                   <p class=range>
                     <span class=range>Range 1: 2048 to 2055</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12828,19 +12182,17 @@
                 <div class=hotspot id=hotspot1-94-2>
                   <p class=range>
                     <span class=range>Range 2: 2603 to 2610</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676744?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12856,14 +12208,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-95">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6W_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Crystal Structure Of The Bacterial Ribosome Ram Mutation G347u. This Entry Contains The 50s Ribosomal Subunit Of The First 70s Molecule In The Asymmetric Unit</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign">pdb|3V6W|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/3V6W_A?report=genbank&amp;log$=nuclalign">gi|482676712|pdb|3V6W|A</a>
                     <span class=b>Length:</span> 2916
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12873,19 +12224,17 @@
                 <div class=hotspot id=hotspot1-95-1>
                   <p class=range>
                     <span class=range>Range 1: 2048 to 2055</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign&amp;from=2048&amp;to=2055">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign&amp;from=2048&amp;to=2055">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12897,19 +12246,17 @@
                 <div class=hotspot id=hotspot1-95-2>
                   <p class=range>
                     <span class=range>Range 2: 2603 to 2610</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=genbank&amp;log$=nuclalign&amp;from=2603&amp;to=2610">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/482676712?report=graph&amp;log$=nuclalign&amp;from=2603&amp;to=2610">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -12925,14 +12272,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-96">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMI_DD?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain d, The Cryo-Em Structure Of A 3d Dna-Origami Object</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign">pdb|2YMI|DD</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMI_DD?report=genbank&amp;log$=nuclalign">gi|428697829|pdb|2YMI|DD</a>
                     <span class=b>Length:</span> 56
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -12942,19 +12288,17 @@
                 <div class=hotspot id=hotspot1-96-1>
                   <p class=range>
                     <span class=range>Range 1: 52 to 45</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=genbank&amp;log$=nuclalign&amp;from=52&amp;to=45">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697829?report=graph&amp;log$=nuclalign&amp;from=52&amp;to=45">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
@@ -12970,14 +12314,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-97">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMF_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, The Cryo-Em Structure Of A 3d Dna-Origami Object</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign">pdb|2YMF|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2YMF_A?report=genbank&amp;log$=nuclalign">gi|428697789|pdb|2YMF|A</a>
                     <span class=b>Length:</span> 4896
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -12987,19 +12330,17 @@
                 <div class=hotspot id=hotspot1-97-1>
                   <p class=range>
                     <span class=range>Range 1: 575 to 582</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign&amp;from=575&amp;to=582">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign&amp;from=575&amp;to=582">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -13011,19 +12352,17 @@
                 <div class=hotspot id=hotspot1-97-2>
                   <p class=range>
                     <span class=range>Range 2: 561 to 567</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=genbank&amp;log$=nuclalign&amp;from=561&amp;to=567">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/428697789?report=graph&amp;log$=nuclalign&amp;from=561&amp;to=567">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>14.4 bits(7)</td>
-                      <td>185.8</td>
-                      <td>7/7(100%)</td>
-                      <td>0/7(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>14.3694 bits (7)</td>
+                      <td>185.82</td>
+                      <td>7/7 (100%)</td>
+                      <td>0/7 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -13039,14 +12378,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-98">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2J01_A?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 2 Of 4). This File Contains The 50s Subunit From Molecule I. </p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign">pdb|2J01|A</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2J01_A?report=genbank&amp;log$=nuclalign">gi|396639330|pdb|2J01|A</a>
                     <span class=b>Length:</span> 2787
                     <span class=b>Number of Matches:</span> 2
                   </p>
@@ -13060,7 +12398,7 @@
                   <div class=title>
                     <p class=hittitle>Chain A, Structure Of The Thermus Thermophilus 70s Ribosome Complexed With Mrna, Trna And Paromomycin (Part 4 Of 4). This File Contains The 50s Subunit From Molecule Ii.</p>
                     <p class=titleinfo>
-                      <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/396639355?report=genbank&amp;log$=nuclalign">pdb|2J03|A</a>
+                      <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/?report=genbank&amp;log$=nuclalign">gi|396639355|pdb|2J03|A</a>
                     </p>
                   </div>
                 </div>
@@ -13068,19 +12406,17 @@
                 <div class=hotspot id=hotspot1-98-1>
                   <p class=range>
                     <span class=range>Range 1: 1948 to 1955</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign&amp;from=1948&amp;to=1955">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign&amp;from=1948&amp;to=1955">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -13092,19 +12428,17 @@
                 <div class=hotspot id=hotspot1-98-2>
                   <p class=range>
                     <span class=range>Range 2: 2474 to 2481</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=genbank&amp;log$=nuclalign&amp;from=2474&amp;to=2481">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/396639330?report=graph&amp;log$=nuclalign&amp;from=2474&amp;to=2481">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -13120,14 +12454,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-99">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQX_C?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Magnesium</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign">pdb|4AQX|C</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQX_C?report=genbank&amp;log$=nuclalign">gi|393715375|pdb|4AQX|C</a>
                     <span class=b>Length:</span> 14
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -13137,19 +12470,17 @@
                 <div class=hotspot id=hotspot1-99-1>
                   <p class=range>
                     <span class=range>Range 1: 7 to 14</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=genbank&amp;log$=nuclalign&amp;from=7&amp;to=14">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715375?report=graph&amp;log$=nuclalign&amp;from=7&amp;to=14">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -13165,14 +12496,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-100">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQU_C?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>Chain C, Crystal Structure Of I-Crei Complexed With Its Target Methylated At Position Plus 2 (In The B Strand) In The Presence Of Calcium</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign">pdb|4AQU|C</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/4AQU_C?report=genbank&amp;log$=nuclalign">gi|393715371|pdb|4AQU|C</a>
                     <span class=b>Length:</span> 24
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -13182,19 +12512,17 @@
                 <div class=hotspot id=hotspot1-100-1>
                   <p class=range>
                     <span class=range>Range 1: 7 to 14</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=genbank&amp;log$=nuclalign&amp;from=7&amp;to=14">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/393715371?report=graph&amp;log$=nuclalign&amp;from=7&amp;to=14">Graphics</a>
-                  </p>
-
-                  <table class=hotspotstable>
-                    <tr>
-                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
-                    </tr>
-                    <tr>
-                      <td>16.4 bits(8)</td>
-                      <td>47.0</td>
-                      <td>8/8(100%)</td>
-                      <td>0/8(0%)</td>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>16.3517 bits (8)</td>
+                      <td>47.0266</td>
+                      <td>8/8 (100%)</td>
+                      <td>0/8 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
--- a/test-data/blast xml example2.html	Thu Jul 31 16:49:27 2014 +0200
+++ b/test-data/blast xml example2.html	Tue Jul 07 09:28:08 2015 +0200
@@ -40,20 +40,28 @@
       }
 
       h1 {
+      font-size: 200%;
+      }
+
+      h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
       border-bottom: 1px solid #CCCCCC;
-      font-size: 150%;
       padding-bottom: 0.1em;
       }
 
-      h2 {
+      h3 {
       font-size: 120%;
       font-weight: bold;
       }
 
-      h4.darkHeader {
+      h5.darkHeader {
       color: #4D4D4D;
       letter-spacing: 0;
       font-weight: bold;
+      font-size: 108%;
       }
 
       #nodata {
@@ -385,27 +393,37 @@
     
     <div id=content>
 
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.28+</td></tr>
+          <tr><td class=param>Database:</td><td>/share/BlastDB/nt</td></tr>
+        </table>
+
+      </section>
+
 
 
       
       <section class=match id=match1>
       
-        <h1>Nucleotide Sequence (16 letters)</h1>
+        <h2>Nucleotide Sequence (16 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>No definition line</td></tr>
-            <tr><td class=param>Query length:</td><td>16</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.28+</td></tr>
-            <tr><td class=param>Database:</td><td>/share/BlastDB/nt</td></tr>
+            <tr><td class=param>Definition line:</td><td>No definition line</td></tr>
+            <tr><td class=param>Length:</td><td>16</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
--- a/test-data/blast xml example3.html	Thu Jul 31 16:49:27 2014 +0200
+++ b/test-data/blast xml example3.html	Tue Jul 07 09:28:08 2015 +0200
@@ -40,20 +40,28 @@
       }
 
       h1 {
-      border-bottom: 1px solid #CCCCCC;
-      font-size: 150%;
-      padding-bottom: 0.1em;
+      font-size: 200%;
       }
 
       h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
+      border-bottom: 1px solid #CCCCCC;
+      padding-bottom: 0.1em;
+      }
+
+      h3 {
       font-size: 120%;
       font-weight: bold;
       }
 
-      h4.darkHeader {
+      h5.darkHeader {
       color: #4D4D4D;
       letter-spacing: 0;
       font-weight: bold;
+      font-size: 108%;
       }
 
       #nodata {
@@ -385,9 +393,20 @@
     
     <div id=content>
 
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+          <tr><td class=param>Database:</td><td></td></tr>
+        </table>
+
+      </section>
+
 
       <section class=index>
-        <h1>Queries</h1>
+        <h2>Queries</h2>
 
         <div class=indexentry><a href="#match1">
             Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
@@ -619,22 +638,21 @@
       
       <section class=match id=match1>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -645,22 +663,21 @@
       
       <section class=match id=match2>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>2</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -671,39 +688,38 @@
       
       <section class=match id=match3>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>3</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline3>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -767,10 +783,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -794,7 +810,7 @@
                   <td>100%</td>
                   <td>7.011e-08</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
                 </tr>
               </table>
 
@@ -804,21 +820,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit3-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description3-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
                     <span class=b>Length:</span> 323
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -828,8 +843,6 @@
                 <div class=hotspot id=hotspot3-1-1>
                   <p class=range>
                     <span class=range>Range 1: 200 to 219</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign&amp;from=200&amp;to=219">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign&amp;from=200&amp;to=219">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -837,10 +850,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -858,22 +871,21 @@
       
       <section class=match id=match4>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>4</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -884,22 +896,21 @@
       
       <section class=match id=match5>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>5</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -910,39 +921,38 @@
       
       <section class=match id=match6>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>6</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline6>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1006,10 +1016,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1033,7 +1043,7 @@
                   <td>100%</td>
                   <td>7.011e-08</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
                 </tr>
               </table>
 
@@ -1043,21 +1053,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit6-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description6-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
                     <span class=b>Length:</span> 2457
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1067,8 +1076,6 @@
                 <div class=hotspot id=hotspot6-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2119 to 2138</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign&amp;from=2119&amp;to=2138">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign&amp;from=2119&amp;to=2138">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1076,10 +1083,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1097,22 +1104,21 @@
       
       <section class=match id=match7>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>7</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1123,22 +1129,21 @@
       
       <section class=match id=match8>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>8</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1149,22 +1154,21 @@
       
       <section class=match id=match9>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>9</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1175,22 +1179,21 @@
       
       <section class=match id=match10>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>10</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1201,22 +1204,21 @@
       
       <section class=match id=match11>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>11</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1227,22 +1229,21 @@
       
       <section class=match id=match12>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>12</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1253,22 +1254,21 @@
       
       <section class=match id=match13>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>13</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1279,22 +1279,21 @@
       
       <section class=match id=match14>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>14</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1305,22 +1304,21 @@
       
       <section class=match id=match15>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>15</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1331,22 +1329,21 @@
       
       <section class=match id=match16>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>16</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1357,22 +1354,21 @@
       
       <section class=match id=match17>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>17</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1383,39 +1379,38 @@
       
       <section class=match id=match18>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>18</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline18>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1481,10 +1476,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1508,7 +1503,7 @@
                   <td>85%</td>
                   <td>2.981e-06</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a></td>
                 </tr>
               </table>
 
@@ -1518,21 +1513,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit18-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description18-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign">Subject_2</a>
                     <span class=b>Length:</span> 1045
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1542,8 +1536,6 @@
                 <div class=hotspot id=hotspot18-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2 to 18</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&amp;log$=nuclalign&amp;from=2&amp;to=18">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=graph&amp;log$=nuclalign&amp;from=2&amp;to=18">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1551,10 +1543,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>31.9 bits(34)</td>
-                      <td>0.0</td>
-                      <td>17/17(100%)</td>
-                      <td>0/17(0%)</td>
+                      <td>31.9436 bits (34)</td>
+                      <td>2.98095e-06</td>
+                      <td>17/17 (100%)</td>
+                      <td>0/17 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1572,39 +1564,38 @@
       
       <section class=match id=match19>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>19</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline19>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1668,10 +1659,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1695,7 +1686,7 @@
                   <td>100%</td>
                   <td>7.011e-08</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a></td>
                 </tr>
               </table>
 
@@ -1705,21 +1696,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit19-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description19-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign">Subject_3</a>
                     <span class=b>Length:</span> 323
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1729,8 +1719,6 @@
                 <div class=hotspot id=hotspot19-1-1>
                   <p class=range>
                     <span class=range>Range 1: 224 to 243</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&amp;log$=nuclalign&amp;from=224&amp;to=243">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=graph&amp;log$=nuclalign&amp;from=224&amp;to=243">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1738,10 +1726,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1759,22 +1747,21 @@
       
       <section class=match id=match20>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>20</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1785,22 +1772,21 @@
       
       <section class=match id=match21>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>21</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1811,39 +1797,38 @@
       
       <section class=match id=match22>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>22</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline22>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1907,10 +1892,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1934,7 +1919,7 @@
                   <td>100%</td>
                   <td>7.011e-08</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a></td>
                 </tr>
               </table>
 
@@ -1944,21 +1929,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit22-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description22-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign">Subject_6</a>
                     <span class=b>Length:</span> 2457
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1968,8 +1952,6 @@
                 <div class=hotspot id=hotspot22-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2143 to 2162</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&amp;log$=nuclalign&amp;from=2143&amp;to=2162">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=graph&amp;log$=nuclalign&amp;from=2143&amp;to=2162">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1977,10 +1959,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1998,22 +1980,21 @@
       
       <section class=match id=match23>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>23</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2024,22 +2005,21 @@
       
       <section class=match id=match24>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>24</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2050,22 +2030,21 @@
       
       <section class=match id=match25>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>25</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2076,22 +2055,21 @@
       
       <section class=match id=match26>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>26</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2102,22 +2080,21 @@
       
       <section class=match id=match27>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>27</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2128,22 +2105,21 @@
       
       <section class=match id=match28>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>28</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2154,22 +2130,21 @@
       
       <section class=match id=match29>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>29</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2180,22 +2155,21 @@
       
       <section class=match id=match30>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>30</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2206,22 +2180,21 @@
       
       <section class=match id=match31>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>31</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2232,22 +2205,21 @@
       
       <section class=match id=match32>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>32</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2258,22 +2230,21 @@
       
       <section class=match id=match33>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>33</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2284,22 +2255,21 @@
       
       <section class=match id=match34>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>34</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2310,22 +2280,21 @@
       
       <section class=match id=match35>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>35</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2336,22 +2305,21 @@
       
       <section class=match id=match36>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>36</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2362,22 +2330,21 @@
       
       <section class=match id=match37>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>37</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2388,22 +2355,21 @@
       
       <section class=match id=match38>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>38</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2414,22 +2380,21 @@
       
       <section class=match id=match39>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>39</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2440,22 +2405,21 @@
       
       <section class=match id=match40>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>40</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2466,22 +2430,21 @@
       
       <section class=match id=match41>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>41</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2492,22 +2455,21 @@
       
       <section class=match id=match42>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>42</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2518,22 +2480,21 @@
       
       <section class=match id=match43>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>43</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2544,22 +2505,21 @@
       
       <section class=match id=match44>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>44</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2570,22 +2530,21 @@
       
       <section class=match id=match45>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>45</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2596,22 +2555,21 @@
       
       <section class=match id=match46>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>46</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -2622,39 +2580,38 @@
       
       <section class=match id=match47>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>47</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline47>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -2715,10 +2672,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -2742,7 +2699,7 @@
                   <td>100%</td>
                   <td>9.338e-08</td>
                   <td>92%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
                 </tr>
               </table>
 
@@ -2752,21 +2709,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit47-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description47-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
                     <span class=b>Length:</span> 4180
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -2776,8 +2732,6 @@
                 <div class=hotspot id=hotspot47-1-1>
                   <p class=range>
                     <span class=range>Range 1: 1541 to 1565</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign&amp;from=1541&amp;to=1565">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign&amp;from=1541&amp;to=1565">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -2785,10 +2739,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>23/25(92%)</td>
-                      <td>0/25(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>9.33825e-08</td>
+                      <td>23/25 (92%)</td>
+                      <td>0/25 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -2806,39 +2760,38 @@
       
       <section class=match id=match48>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>48</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline48>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -2899,10 +2852,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -2926,7 +2879,7 @@
                   <td>100%</td>
                   <td>9.338e-08</td>
                   <td>92%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
                 </tr>
               </table>
 
@@ -2936,21 +2889,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit48-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description48-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
                     <span class=b>Length:</span> 4983
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -2960,8 +2912,6 @@
                 <div class=hotspot id=hotspot48-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2344 to 2368</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign&amp;from=2344&amp;to=2368">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign&amp;from=2344&amp;to=2368">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -2969,10 +2919,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>37.4 bits(40)</td>
-                      <td>0.0</td>
-                      <td>23/25(92%)</td>
-                      <td>0/25(0%)</td>
+                      <td>37.3537 bits (40)</td>
+                      <td>9.33825e-08</td>
+                      <td>23/25 (92%)</td>
+                      <td>0/25 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -2990,22 +2940,21 @@
       
       <section class=match id=match49>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>49</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3016,22 +2965,21 @@
       
       <section class=match id=match50>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>50</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3042,22 +2990,21 @@
       
       <section class=match id=match51>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>51</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3068,22 +3015,21 @@
       
       <section class=match id=match52>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>52</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3094,22 +3040,21 @@
       
       <section class=match id=match53>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>53</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3120,22 +3065,21 @@
       
       <section class=match id=match54>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>54</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -3146,39 +3090,38 @@
       
       <section class=match id=match55>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>55</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline55>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -3243,10 +3186,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -3270,7 +3213,7 @@
                   <td>100%</td>
                   <td>6.629e-23</td>
                   <td>86%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a></td>
                 </tr>
               </table>
 
@@ -3280,21 +3223,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit55-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description55-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign">Subject_7</a>
                     <span class=b>Length:</span> 4180
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -3304,8 +3246,6 @@
                 <div class=hotspot id=hotspot55-1-1>
                   <p class=range>
                     <span class=range>Range 1: 1516 to 1589</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&amp;log$=nuclalign&amp;from=1516&amp;to=1589">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=graph&amp;log$=nuclalign&amp;from=1516&amp;to=1589">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -3313,10 +3253,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>89.7 bits(98)</td>
-                      <td>0.0</td>
-                      <td>64/74(86%)</td>
-                      <td>0/74(0%)</td>
+                      <td>89.6514 bits (98)</td>
+                      <td>6.62923e-23</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -3337,39 +3277,38 @@
       
       <section class=match id=match56>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td></td></tr>
+            <tr><td class=param>Query number:</td><td>56</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline56>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -3434,10 +3373,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -3461,7 +3400,7 @@
                   <td>100%</td>
                   <td>6.629e-23</td>
                   <td>86%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a></td>
                 </tr>
               </table>
 
@@ -3471,21 +3410,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit56-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description56-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign">Subject_8</a>
                     <span class=b>Length:</span> 4983
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -3495,8 +3433,6 @@
                 <div class=hotspot id=hotspot56-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2319 to 2392</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&amp;log$=nuclalign&amp;from=2319&amp;to=2392">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=graph&amp;log$=nuclalign&amp;from=2319&amp;to=2392">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -3504,10 +3440,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>89.7 bits(98)</td>
-                      <td>0.0</td>
-                      <td>64/74(86%)</td>
-                      <td>0/74(0%)</td>
+                      <td>89.6514 bits (98)</td>
+                      <td>6.62923e-23</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example3b.html	Tue Jul 07 09:28:08 2015 +0200
@@ -0,0 +1,3472 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      font-size: 200%;
+      }
+
+      h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
+      border-bottom: 1px solid #CCCCCC;
+      padding-bottom: 0.1em;
+      }
+
+      h3 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h5.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      font-size: 108%;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+          <tr><td class=param>Database:</td><td></td></tr>
+        </table>
+
+      </section>
+
+
+      <section class=index>
+        <h2>Queries</h2>
+
+        <div class=indexentry><a href="#match1">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match2">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match3">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match4">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match5">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match6">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match7">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match8">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match9">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match10">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match11">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match12">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match13">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match14">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match15">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match16">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match17">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match18">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match19">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match20">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match21">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match22">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match23">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match24">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match25">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match26">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match27">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match28">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match29">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match30">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match31">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match32">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match33">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match34">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match35">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match36">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match37">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match38">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match39">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match40">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match41">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match42">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match43">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match44">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match45">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match46">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match47">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match48">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match49">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match50">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match51">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match52">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match53">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match54">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match55">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 1 hits)
+        </a></div>
+        <div class=indexentry><a href="#match56">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 1 hits)
+        </a></div>
+
+      </section>
+
+      
+      <section class=match id=match1>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match2>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>2</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match3>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>3</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline3>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit3-1"
+                   onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3-1"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description3-1">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit3-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot3-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 200 to 219</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject    200  AGCGCGCAAACTAGGATAAA  219</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match4>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>4</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match5>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>5</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match6>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>6</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline6>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit6-1"
+                   onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit6-1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description6-1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit6-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description6-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot6-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2119 to 2138</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject   2119  AGCGCGCAAACTAGGATAAA  2138</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match7>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>7</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match8>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>8</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match9>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>9</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match10>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>10</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match11>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>11</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match12>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>12</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match13>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>13</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match14>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>14</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match15>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>15</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match16>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>16</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match17>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>17</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match18>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>18</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline18>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit18-1"
+                   onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 15%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 85%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit18-1"
+                              title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000"
+                              id="description18-1">
+                        AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000
+                  </a></div></td>
+                  <td>31.9</td>
+                  <td>31.9</td>
+                  <td>85%</td>
+                  <td>2.981e-06</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit18-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description18-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_2">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a>
+                    <span class=b>Length:</span> 1045
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot18-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2 to 18</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>31.9436 bits (34)</td>
+                      <td>2.98095e-06</td>
+                      <td>17/17 (100%)</td>
+                      <td>0/17 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  GCGCGGTGTCATCTATG  20
+                |||||||||||||||||
+Subject      2  GCGCGGTGTCATCTATG  18</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match19>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>19</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline19>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit19-1"
+                   onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit19-1"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description19-1">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit19-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description19-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot19-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 224 to 243</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject    224  CGCGCGCGGTGTCATCTATG  243</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match20>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>20</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match21>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>21</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match22>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>22</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline22>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit22-1"
+                   onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit22-1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description22-1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>7.011e-08</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit22-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description22-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot22-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2143 to 2162</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>7.01052e-08</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject   2143  CGCGCGCGGTGTCATCTATG  2162</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match23>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>23</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match24>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>24</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match25>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>25</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match26>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>26</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match27>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>27</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match28>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>28</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match29>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>29</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match30>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>30</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match31>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>31</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match32>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>32</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match33>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>33</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match34>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>34</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match35>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>35</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match36>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>36</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match37>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>37</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match38>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>38</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match39>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>39</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match40>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>40</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match41>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>41</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match42>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>42</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match43>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>43</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match44>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>44</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match45>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>45</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match46>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>46</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match47>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>47</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline47>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit47-1"
+                   onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit47-1"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description47-1">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>9.338e-08</td>
+                  <td>92%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit47-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description47-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot47-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 1541 to 1565</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>9.33825e-08</td>
+                      <td>23/25 (92%)</td>
+                      <td>0/25 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCACAGC  25
+                |||||||||||||| ||||||| ||
+Subject   1541  ACATGAACAGCGCCCTGACCACCGC  1565</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match48>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>48</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline48>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit48-1"
+                   onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit48-1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description48-1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>37.4</td>
+                  <td>37.4</td>
+                  <td>100%</td>
+                  <td>9.338e-08</td>
+                  <td>92%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit48-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description48-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot48-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2344 to 2368</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>37.3537 bits (40)</td>
+                      <td>9.33825e-08</td>
+                      <td>23/25 (92%)</td>
+                      <td>0/25 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCACAGC  25
+                |||||||||||||| ||||||| ||
+Subject   2344  ACATGAACAGCGCCCTGACCACCGC  2368</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match49>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>49</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match50>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>50</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match51>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>51</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match52>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>52</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match53>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>53</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match54>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>54</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match55>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>55</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline55>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit55-1"
+                   onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit55-1"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description55-1">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>89.7</td>
+                  <td>89.7</td>
+                  <td>100%</td>
+                  <td>6.629e-23</td>
+                  <td>86%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit55-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description55-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot55-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 1516 to 1589</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>89.6514 bits (98)</td>
+                      <td>6.62923e-23</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG  60
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | 
+Subject   1516  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  1575</pre>
+                  <pre class=alignmentgraphic>Query       61  TTCGCAGTCCAGAA  74
+                ||||| ||||||||
+Subject   1576  TTCGCCGTCCAGAA  1589</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match56>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>56</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline56>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit56-1"
+                   onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit56-1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description56-1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>89.7</td>
+                  <td>89.7</td>
+                  <td>100%</td>
+                  <td>6.629e-23</td>
+                  <td>86%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit56-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description56-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot56-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2319 to 2392</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>89.6514 bits (98)</td>
+                      <td>6.62923e-23</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG  60
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | 
+Subject   2319  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  2378</pre>
+                  <pre class=alignmentgraphic>Query       61  TTCGCAGTCCAGAA  74
+                ||||| ||||||||
+Subject   2379  TTCGCCGTCCAGAA  2392</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- a/test-data/blast xml example4.html	Thu Jul 31 16:49:27 2014 +0200
+++ b/test-data/blast xml example4.html	Tue Jul 07 09:28:08 2015 +0200
@@ -40,20 +40,28 @@
       }
 
       h1 {
+      font-size: 200%;
+      }
+
+      h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
       border-bottom: 1px solid #CCCCCC;
-      font-size: 150%;
       padding-bottom: 0.1em;
       }
 
-      h2 {
+      h3 {
       font-size: 120%;
       font-weight: bold;
       }
 
-      h4.darkHeader {
+      h5.darkHeader {
       color: #4D4D4D;
       letter-spacing: 0;
       font-weight: bold;
+      font-size: 108%;
       }
 
       #nodata {
@@ -385,9 +393,20 @@
     
     <div id=content>
 
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+          <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+        </table>
+
+      </section>
+
 
       <section class=index>
-        <h1>Queries</h1>
+        <h2>Queries</h2>
 
         <div class=indexentry><a href="#match1">
             Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
@@ -423,39 +442,38 @@
       
       <section class=match id=match1>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
             <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline1>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -530,10 +548,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -557,7 +575,7 @@
                   <td>100%</td>
                   <td>1.513e-07</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">5</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit1-2"
@@ -570,7 +588,7 @@
                   <td>100%</td>
                   <td>1.513e-07</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">2</a></td>
                 </tr>
               </table>
 
@@ -580,21 +598,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit1-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|5</a>
                     <span class=b>Length:</span> 2457
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -604,8 +621,6 @@
                 <div class=hotspot id=hotspot1-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2119 to 2138</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2119&amp;to=2138">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2119&amp;to=2138">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -613,10 +628,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>40.1 bits(20)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -632,14 +647,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description1-2">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|2</a>
                     <span class=b>Length:</span> 323
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -649,8 +663,6 @@
                 <div class=hotspot id=hotspot1-2-1>
                   <p class=range>
                     <span class=range>Range 1: 200 to 219</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=200&amp;to=219">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=200&amp;to=219">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -658,10 +670,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>40.1 bits(20)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -679,22 +691,21 @@
       
       <section class=match id=match2>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>2</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -705,39 +716,38 @@
       
       <section class=match id=match3>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>3</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline3>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -825,10 +835,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -852,7 +862,7 @@
                   <td>100%</td>
                   <td>1.513e-07</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">5</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit3-2"
@@ -865,7 +875,7 @@
                   <td>100%</td>
                   <td>1.513e-07</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">2</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit3-3"
@@ -878,7 +888,7 @@
                   <td>85%</td>
                   <td>9.334e-06</td>
                   <td>100%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">1</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&amp;log$=nuclalign">1</a></td>
                 </tr>
               </table>
 
@@ -888,21 +898,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit3-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description3-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">5</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|5</a>
                     <span class=b>Length:</span> 2457
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -912,8 +921,6 @@
                 <div class=hotspot id=hotspot3-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2143 to 2162</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2143&amp;to=2162">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2143&amp;to=2162">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -921,10 +928,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>40.1 bits(20)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -940,14 +947,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description3-2">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">2</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|2</a>
                     <span class=b>Length:</span> 323
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -957,8 +963,6 @@
                 <div class=hotspot id=hotspot3-2-1>
                   <p class=range>
                     <span class=range>Range 1: 224 to 243</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=224&amp;to=243">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=224&amp;to=243">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -966,10 +970,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>40.1 bits(20)</td>
-                      <td>0.0</td>
-                      <td>20/20(100%)</td>
-                      <td>0/20(0%)</td>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -985,14 +989,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description3-3">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">1</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|1</a>
                     <span class=b>Length:</span> 1045
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1002,8 +1005,6 @@
                 <div class=hotspot id=hotspot3-3-1>
                   <p class=range>
                     <span class=range>Range 1: 2 to 18</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2&amp;to=18">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2&amp;to=18">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1011,10 +1012,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>34.2 bits(17)</td>
-                      <td>0.0</td>
-                      <td>17/17(100%)</td>
-                      <td>0/17(0%)</td>
+                      <td>34.1929 bits (17)</td>
+                      <td>9.33411e-06</td>
+                      <td>17/17 (100%)</td>
+                      <td>0/17 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1032,22 +1033,21 @@
       
       <section class=match id=match4>
       
-        <h1>Nucleotide Sequence (24 letters)</h1>
+        <h2>Nucleotide Sequence (24 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>4</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1058,22 +1058,21 @@
       
       <section class=match id=match5>
       
-        <h1>Nucleotide Sequence (20 letters)</h1>
+        <h2>Nucleotide Sequence (20 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>5</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
           </table>
 
         </section>
 
         <section>
-          <h2>No Hits</h2>
+          <h3>No Hits</h3>
           <div class=grey>
             <table class=headerdata>
               <tr><td class=param>Message:</td><td>No hits found</td></tr>
@@ -1084,39 +1083,38 @@
       
       <section class=match id=match6>
       
-        <h1>Nucleotide Sequence (25 letters)</h1>
+        <h2>Nucleotide Sequence (25 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>6</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline6>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1192,10 +1190,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1219,7 +1217,7 @@
                   <td>88%</td>
                   <td>3.148e-06</td>
                   <td>95%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">7</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit6-2"
@@ -1232,7 +1230,7 @@
                   <td>88%</td>
                   <td>3.148e-06</td>
                   <td>95%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">6</a></td>
                 </tr>
               </table>
 
@@ -1242,21 +1240,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit6-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description6-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|7</a>
                     <span class=b>Length:</span> 4983
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1266,8 +1263,6 @@
                 <div class=hotspot id=hotspot6-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2344 to 2365</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2344&amp;to=2365">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2344&amp;to=2365">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1275,10 +1270,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>36.2 bits(18)</td>
-                      <td>0.0</td>
-                      <td>21/22(95%)</td>
-                      <td>0/22(0%)</td>
+                      <td>36.1753 bits (18)</td>
+                      <td>3.14801e-06</td>
+                      <td>21/22 (95%)</td>
+                      <td>0/22 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1294,14 +1289,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description6-2">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|6</a>
                     <span class=b>Length:</span> 4180
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1311,8 +1305,6 @@
                 <div class=hotspot id=hotspot6-2-1>
                   <p class=range>
                     <span class=range>Range 1: 1541 to 1562</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1541&amp;to=1562">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1541&amp;to=1562">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1320,10 +1312,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>36.2 bits(18)</td>
-                      <td>0.0</td>
-                      <td>21/22(95%)</td>
-                      <td>0/22(0%)</td>
+                      <td>36.1753 bits (18)</td>
+                      <td>3.14801e-06</td>
+                      <td>21/22 (95%)</td>
+                      <td>0/22 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1341,39 +1333,38 @@
       
       <section class=match id=match7>
       
-        <h1>Nucleotide Sequence (74 letters)</h1>
+        <h2>Nucleotide Sequence (74 letters)</h2>
 
         <section class=header>
 
           <table class=headerdata>
-            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
-            <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
-            <tr><td class=param>Query length:</td><td>20</td></tr>
-            <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
-            <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+            <tr><td class=param>Query number:</td><td>7</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
           </table>
 
         </section>
 
 
         <section class=graphics>
-          <h2>Graphic Summary</h2>
+          <h3>Graphic Summary</h3>
 
           <div class=grey>
-            <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
 
             <div class=defline id=defline7>
               Mouse-over to show defline and scores, click to show alignments
             </div>
 
             <div class=graphic>
-              <h4 class=darkHeader>Color key for alignment scores</h4>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
               <div class=legend><div class=graphicrow>
                   <div class=graphicitem style="background-color: black">&lt;40</div>
                   <div class=graphicitem style="background-color: blue">40–50</div>
                   <div class=graphicitem style="background-color: green">50–80</div>
                   <div class=graphicitem style="background-color: magenta">80–200</div>
-                  <div class=graphicitem style="background-color: red">200≤</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
               </div></div>
               <div style="clear: left"></div>
 
@@ -1449,10 +1440,10 @@
 
 
         <section class=descriptions>
-          <h2>Descriptions</h2>
+          <h3>Descriptions</h3>
 
           <div class=grey><div class=white>
-              <h4 class=darkHeader>Sequences producing significant alignments:</h4>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
 
               <table class=descriptiontable>
                 <col/><col/><col/><col/><col/><col/><col/>
@@ -1476,7 +1467,7 @@
                   <td>100%</td>
                   <td>3.564e-15</td>
                   <td>86%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">7</a></td>
                 </tr>
                 <tr>
                   <td><div><a href="#hit7-2"
@@ -1489,7 +1480,7 @@
                   <td>100%</td>
                   <td>3.564e-15</td>
                   <td>86%</td>
-                  <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a></td>
+                  <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">6</a></td>
                 </tr>
               </table>
 
@@ -1499,21 +1490,20 @@
 
 
         <section class=alignments>
-          <h2>Alignments</h2>
+          <h3>Alignments</h3>
 
           <div class=grey><div class=white>
               <div class=alignment id=hit7-1>
 
                 <div class=linkheader>
                   <div class=right><a href="#description7-1">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">7</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|7</a>
                     <span class=b>Length:</span> 4983
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1523,8 +1513,6 @@
                 <div class=hotspot id=hotspot7-1-1>
                   <p class=range>
                     <span class=range>Range 1: 2319 to 2392</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=2319&amp;to=2392">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=2319&amp;to=2392">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1532,10 +1520,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>67.9 bits(34)</td>
-                      <td>0.0</td>
-                      <td>64/74(86%)</td>
-                      <td>0/74(0%)</td>
+                      <td>67.8929 bits (34)</td>
+                      <td>3.56369e-15</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
                       <td>Plus/Plus</td>
                     </tr>
                   </table>
@@ -1554,14 +1542,13 @@
 
                 <div class=linkheader>
                   <div class=right><a href="#description7-2">Descriptions</a></div>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">GenBank</a>
-                  <a class=linkheader href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign">Graphics</a>
+                  <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">Gene Bank</a>
                 </div>
 
                 <div class=title>
                   <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
                   <p class=titleinfo>
-                    <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign">6</a>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&amp;log$=nuclalign">gnl|BL_ORD_ID|6</a>
                     <span class=b>Length:</span> 4180
                     <span class=b>Number of Matches:</span> 1
                   </p>
@@ -1571,8 +1558,6 @@
                 <div class=hotspot id=hotspot7-2-1>
                   <p class=range>
                     <span class=range>Range 1: 1589 to 1516</span>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=genbank&amp;log$=nuclalign&amp;from=1589&amp;to=1516">GenBank</a>
-                    <a class=range href="http://www.ncbi.nlm.nih.gov/nucleotide/BL_ORD_ID?report=graph&amp;log$=nuclalign&amp;from=1589&amp;to=1516">Graphics</a>
                   </p>
 
                   <table class=hotspotstable>
@@ -1580,10 +1565,10 @@
                       <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
                     </tr>
                     <tr>
-                      <td>67.9 bits(34)</td>
-                      <td>0.0</td>
-                      <td>64/74(86%)</td>
-                      <td>0/74(0%)</td>
+                      <td>67.8929 bits (34)</td>
+                      <td>3.56369e-15</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
                       <td>Plus/Minus</td>
                     </tr>
                   </table>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast xml example4b.html	Tue Jul 07 09:28:08 2015 +0200
@@ -0,0 +1,1597 @@
+<!DOCTYPE html>
+<html>
+  <head>
+    <meta charset="UTF-8">
+    <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/">
+    
+    <title>Blast output</title>
+    
+    <style>
+      body {
+      color: #333333;
+      font-family: Arial,Sans-Serif;
+      }
+
+      :link {
+      color: #336699;
+      }
+
+      .right {
+      float: right;
+      }
+
+      /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/
+      #strip_html_warning {
+      display: none;
+      }
+      
+      #content {
+      margin: 0 2em;
+      padding: 0.5em;
+      border: 1px solid #888888;
+      background-color: #d3dff5;
+      }
+
+      h1, h2, h3, h4, h5, h6 {
+      color: #2A6979;
+      font-family: arial,verdana,sans-serif;
+      letter-spacing: -1px;
+      margin: 1.2em 0 0.3em;
+      }
+
+      h1 {
+      font-size: 200%;
+      }
+
+      h2 {
+      font-size: 150%;
+      }
+      
+      h1, h2 {
+      border-bottom: 1px solid #CCCCCC;
+      padding-bottom: 0.1em;
+      }
+
+      h3 {
+      font-size: 120%;
+      font-weight: bold;
+      }
+
+      h5.darkHeader {
+      color: #4D4D4D;
+      letter-spacing: 0;
+      font-weight: bold;
+      font-size: 108%;
+      }
+
+      #nodata {
+      font-weight: bold;
+      }
+
+      .index {
+      margin-bottom: 3em;
+      }
+      .index div.indexentry {
+      margin: 1.2em 1.6em;
+      font-weight: bold;
+      font-size: 100%;
+      }
+      
+      .headerdata {
+      font-size: 90%;
+      }
+      .headerdata .param {
+      font-weight: bold;
+      text-align: right;
+      padding: 0 1em;
+      }
+
+      .grey {
+      background-color: #eeeeee;
+      border: 1px solid #cccccc;
+      padding: 1em;
+      }
+
+      .white {
+      background-color: white;
+      border: 1px solid #cccccc;
+      padding: 1.5em 2%;
+      }
+
+      .graphicrow {
+      clear: left;
+      width: 100%;
+      }
+
+      .graphicitem {
+      float: left;
+      }
+
+
+      
+      .graphics .grey {
+      text-align: center;
+      }
+
+      .graphic {
+      background-color: white;
+      border: 2px solid black;
+      padding: 1.5em;
+      margin: auto;
+      }
+
+      .centered, .defline, div.legend, div.tablewrapper {
+      margin-left: auto;
+      margin-right: auto;
+      }
+
+      .defline {
+      background-color: white;
+      border: 1px solid black;
+      margin: .5em auto;
+      padding-left: .2em;
+      padding-right: .2em;
+      max-width: 50em;
+      text-align: left;
+      height: 2.8em;
+      overflow: hidden;
+      }
+
+      div.legend {
+      max-width: 40em;
+      }
+      div.legend div {
+      width: 100%;
+      color: white;
+      font-weight: bold;
+      border-spacing: 0;
+      }
+      div.legend div .graphicitem {
+      width: 20%;
+      padding: 0;
+      margin: 0;
+      border: none;
+      }
+
+      div.tablewrapper {
+      width: 50%;
+      min-width: 60em;
+      }
+
+      /* For small widths we give the graphic 100% */
+      @media (max-width: 72.5em) {
+      div.tablewrapper {
+      width: 100%;
+      min-width: 0px;
+      }
+      }
+
+      .scale {
+      width: 100%;
+      margin: .5em 0;
+      font-weight: bold;
+      }
+      .scale div {
+      color: red;
+      text-align: left;
+      }
+      .scale .graphicrow {
+      margin: .5em 0 .5em 0;
+      color: white;
+      }
+      .scale .graphicitem {
+      position: relative;
+      }
+      .scale .graphicitem div {
+      margin: 0 1px;
+      padding: 0 2px;
+      text-align: right;
+      background-color: red;
+      color: white;
+      }
+      .scale .graphicitem:first-child div {
+      margin-left: 0px;
+      }
+      .scale .graphicitem:last-child div {
+      margin-right: 0px;
+      }
+      .scale .graphicitem .lastlabel {
+      position: absolute;
+      top: 0px;
+      left: 100%;
+      background-color: transparent;
+      color: red;
+      }
+
+      a.matchresult {
+      display: block;
+      margin: 0;
+      padding: 0;
+      }
+      div.matchrow {
+      margin-top: 4px;
+      }
+      div.matchrow, div.matchitem {
+      height: 4px;
+      }
+
+      
+      table.descriptiontable {
+      font-size: 85%;
+      border: 1px solid #97b0c8;
+      border-spacing: 0;
+      color: #222222;
+      line-height: 1.3em;
+      background-color: white;
+      }
+      table.descriptiontable col:first-child {
+      width: 100%;
+      }
+      table.descriptiontable tr:hover {
+      background-color: #D5DEE3;
+      }
+      table.descriptiontable th {
+      color: #14376C;
+      font-weight: normal;
+      background-color: #F0F0F0;
+      background: linear-gradient(#FFFFFF, #F0F0F0);
+      border-bottom: 1px solid #D4DFE9;
+      border-right: 1px solid #CFCFCF;
+      border-left: 0px solid black;
+      border-top: 0px solid black;
+      }
+      table.descriptiontable td {
+      overflow: hidden;
+      text-align: center;
+      padding: .4em .8em;
+      }
+      table.descriptiontable td div {
+      width: 1em;
+      overflow: visible;
+      white-space: nowrap;
+      text-align: left;
+      }
+
+
+      
+      .alignments .white {
+      padding: 1.5em 1em;
+      }
+      
+      .alignment {
+      border-top: 1px solid black;
+      padding-left: 1em;
+      padding-right: 1em;
+      }
+      
+      div.linkheader {
+      padding-top: .2em;
+      font-size: 85%;
+      color: #14376C;
+      }
+      div.linkheader a.linkheader {
+      margin-right: 1em;
+      }
+      div.linkheader .right a {
+      text-decoration: none;
+      }
+
+      .title .hittitle {
+      color: #222222;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo {
+      font-size: 80%;
+      margin-top: 0;
+      margin-bottom: .3em;
+      }
+      .title .titleinfo .b {
+      color: #606060;
+      font-weight: bold;
+      font-size: 90%;
+      }
+
+      .moretitles {
+      margin: 1.2em;
+      }
+      .moretitles .titleinfo {
+      margin: 0;
+      padding: 0;
+      }
+      .moretitles .hittitle {
+      margin: .4em 0 .2em 0;
+      padding: 0;
+      }
+      
+      a.showmoretitles {
+      font-size: 75%;
+      color: #336699;
+      font-weight: bold;
+      margin-top: 0;
+      }
+      a.showmoretitles:hover {
+      }
+
+      .hotspot {
+      color: #606060;
+      font-family: verdana, arial, sans-serif;
+      margin-bottom: 2.5em;
+      }
+
+      .hotspot p.range {
+      font-size: 70%;
+      margin-top: 0;
+      margin-top: 1em;
+      margin-bottom: .2em;
+      }
+      .hotspot p.range span.range {
+      font-weight: bold;
+      }
+      .hotspot p.range a.range {
+      margin-left: .5em;
+      }
+
+      table.hotspotstable {
+      border-top: 1px solid;
+      border-bottom: 1px solid;
+      text-align: left;
+      border-collapse: collapse;
+      }
+      table.hotspotstable th, table.hotspotstable td {
+      padding: .1em 1em;
+      }
+      table.hotspotstable th {
+      font-size: 70%;
+      }
+      table.hotspotstable td {
+      min-width: 7em;
+      color: #222222;
+      font-size: 80%;
+      }
+
+      pre.alignmentgraphic {
+      color: #222222;
+      }
+
+      footer {
+      text-align: center;
+      color: #cccccc;
+      font-size: 70%;
+      margin-top: 1em;
+      }
+      footer :link {
+      color: #5588cc;
+      }
+      
+    </style>
+
+    <script type="text/javascript">
+      function toggle_visibility(id) {
+          var e = document.getElementById(id);
+          if(e.style.display != 'block')
+              e.style.display = 'block';
+          else
+              e.style.display = 'none';
+      }
+    </script>
+
+  </head>
+
+  
+  <body>
+    
+    <div id="strip_html_warning">
+      <!-- This div should be hidden by the header css block. Galaxy
+      strips all css, breaking this page but making this warning
+      visible. This warning contains some ugly old skool tabular html
+      layout that is not stripped. -->
+      <table bgcolor="#FFE5C9"><tr><td><font color="red"><b>
+                <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font>
+                Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy.
+      </b></font></td></tr></table>
+    </div>
+    
+    <div id=content>
+
+      <section class=header>
+
+        <h1>Nucleotide Blast results</h1>
+
+        <table class=headerdata>
+          <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr>
+          <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr>
+        </table>
+
+      </section>
+
+
+      <section class=index>
+        <h2>Queries</h2>
+
+        <div class=indexentry><a href="#match1">
+            Query_1: Forward_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 2 hits)
+        </a></div>
+        <div class=indexentry><a href="#match2">
+            Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID)
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match3">
+            Query_3: Probe|NOST-Spec_(Genetic_ID)
+            (20 letters, 3 hits)
+        </a></div>
+        <div class=indexentry><a href="#match4">
+            Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (24 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match5">
+            Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R
+            (20 letters, 0 hits)
+        </a></div>
+        <div class=indexentry><a href="#match6">
+            Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R
+            (25 letters, 2 hits)
+        </a></div>
+        <div class=indexentry><a href="#match7">
+            Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R
+            (74 letters, 2 hits)
+        </a></div>
+
+      </section>
+
+      
+      <section class=match id=match1>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>1</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_1</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline1>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit1-1"
+                   onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit1-2"
+                   onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description1-1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit1-2"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description1-2">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit1-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot1-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2119 to 2138</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject   2119  AGCGCGCAAACTAGGATAAA  2138</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit1-2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description1-2">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot1-2-1>
+                  <p class=range>
+                    <span class=range>Range 1: 200 to 219</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  AGCGCGCAAACTAGGATAAA  20
+                ||||||||||||||||||||
+Subject    200  AGCGCGCAAACTAGGATAAA  219</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match2>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>2</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_2</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match3>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>3</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_3</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline3>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>2</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>4</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>10</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>14</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 10%">
+                        <div>20</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit3-1"
+                   onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit3-2"
+                   onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 100%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit3-3"
+                   onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"'
+                   onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 15%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 85%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3-1"
+                              title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"
+                              id="description3-1">
+                        AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3-2"
+                              title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"
+                              id="description3-2">
+                        DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
+                  </a></div></td>
+                  <td>40.1</td>
+                  <td>40.1</td>
+                  <td>100%</td>
+                  <td>1.513e-07</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit3-3"
+                              title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000"
+                              id="description3-3">
+                        AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000
+                  </a></div></td>
+                  <td>34.2</td>
+                  <td>34.2</td>
+                  <td>85%</td>
+                  <td>9.334e-06</td>
+                  <td>100%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/AJ308515.1/">1</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit3-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a>
+                    <span class=b>Length:</span> 2457
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot3-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2143 to 2162</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject   2143  CGCGCGCGGTGTCATCTATG  2162</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit3-2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3-2">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a>
+                    <span class=b>Length:</span> 323
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot3-2-1>
+                  <p class=range>
+                    <span class=range>Range 1: 224 to 243</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>40.14 bits (20)</td>
+                      <td>1.51296e-07</td>
+                      <td>20/20 (100%)</td>
+                      <td>0/20 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  CGCGCGCGGTGTCATCTATG  20
+                ||||||||||||||||||||
+Subject    224  CGCGCGCGGTGTCATCTATG  243</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit3-3>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description3-3">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/AJ308515.1/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3&#39;UTR/plant_junction_region.|-9105899556052450000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a>
+                    <span class=b>Length:</span> 1045
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot3-3-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2 to 18</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>34.1929 bits (17)</td>
+                      <td>9.33411e-06</td>
+                      <td>17/17 (100%)</td>
+                      <td>0/17 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        4  GCGCGGTGTCATCTATG  20
+                |||||||||||||||||
+Subject      2  GCGCGGTGTCATCTATG  18</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match4>
+      
+        <h2>Nucleotide Sequence (24 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>4</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_4</td></tr>
+            <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>24</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match5>
+      
+        <h2>Nucleotide Sequence (20 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>5</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_5</td></tr>
+            <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>20</td></tr>
+          </table>
+
+        </section>
+
+        <section>
+          <h3>No Hits</h3>
+          <div class=grey>
+            <table class=headerdata>
+              <tr><td class=param>Message:</td><td>No hits found</td></tr>
+            </table>
+          </div>
+        </section>
+      </section>
+      
+      <section class=match id=match6>
+      
+        <h2>Nucleotide Sequence (25 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>6</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_6</td></tr>
+            <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>25</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline6>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>3</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>6</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>9</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>12</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>15</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>18</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>21</div>
+                      </div>
+                      <div class=graphicitem style="width: 12%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 4%">
+                        <div>25</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit6-1"
+                   onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 88%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit6-2"
+                   onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: black; width: 88%"></div>
+                    <div class="matchitem graphicitem"
+                         style="background-color: transparent; width: 12%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit6-1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description6-1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>36.2</td>
+                  <td>36.2</td>
+                  <td>88%</td>
+                  <td>3.148e-06</td>
+                  <td>95%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit6-2"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description6-2">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>36.2</td>
+                  <td>36.2</td>
+                  <td>88%</td>
+                  <td>3.148e-06</td>
+                  <td>95%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit6-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description6-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot6-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2344 to 2365</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>36.1753 bits (18)</td>
+                      <td>3.14801e-06</td>
+                      <td>21/22 (95%)</td>
+                      <td>0/22 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCAC  22
+                |||||||||||||| |||||||
+Subject   2344  ACATGAACAGCGCCCTGACCAC  2365</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit6-2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description6-2">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot6-2-1>
+                  <p class=range>
+                    <span class=range>Range 1: 1541 to 1562</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>36.1753 bits (18)</td>
+                      <td>3.14801e-06</td>
+                      <td>21/22 (95%)</td>
+                      <td>0/22 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  ACATGAACAGCGCCTTGACCAC  22
+                |||||||||||||| |||||||
+Subject   1541  ACATGAACAGCGCCCTGACCAC  1562</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+      
+      <section class=match id=match7>
+      
+        <h2>Nucleotide Sequence (74 letters)</h2>
+
+        <section class=header>
+
+          <table class=headerdata>
+            <tr><td class=param>Query number:</td><td>7</td></tr>
+            <tr><td class=param>Query ID:</td><td>Query_7</td></tr>
+            <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr>
+            <tr><td class=param>Length:</td><td>74</td></tr>
+          </table>
+
+        </section>
+
+
+        <section class=graphics>
+          <h3>Graphic Summary</h3>
+
+          <div class=grey>
+            <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4>
+
+            <div class=defline id=defline7>
+              Mouse-over to show defline and scores, click to show alignments
+            </div>
+
+            <div class=graphic>
+              <h5 class=darkHeader>Color key for alignment scores</h5>
+              <div class=legend><div class=graphicrow>
+                  <div class=graphicitem style="background-color: black">&lt;40</div>
+                  <div class=graphicitem style="background-color: blue">40–50</div>
+                  <div class=graphicitem style="background-color: green">50–80</div>
+                  <div class=graphicitem style="background-color: magenta">80–200</div>
+                  <div class=graphicitem style="background-color: red">≥200</div>
+              </div></div>
+              <div style="clear: left"></div>
+
+              <div class=tablewrapper>
+
+                <div class=scale>
+                  <div>query:</div>
+                  <div class=graphicrow>
+                    <div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>8</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>16</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>24</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>32</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>40</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>48</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>56</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>64</div>
+                      </div>
+                      <div class=graphicitem style="width: 10.8108108108%">
+                        <div>72</div>
+                      </div>
+                      <div class=graphicitem style="width: 2.7027027027%">
+                        <div>&nbsp;</div>
+                        <div class=lastlabel>74</div>
+                      </div>
+                    </div>
+                  </div>
+                  <div style="clear: left"></div>
+                </div>
+
+                <a class=matchresult
+                   href="#hit7-1"
+                   onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100%"></div>
+                  </div>
+                </a>
+
+                <a class=matchresult
+                   href="#hit7-2"
+                   onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"'
+                   onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"'
+                   title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000">
+                  <div class="matchrow graphicrow">
+                    <div class="matchitem graphicitem"
+                         style="background-color: green; width: 100%"></div>
+                  </div>
+                </a>
+
+              </div>
+            </div>
+          </div>
+        </section>
+
+
+
+        <section class=descriptions>
+          <h3>Descriptions</h3>
+
+          <div class=grey><div class=white>
+              <h5 class=darkHeader>Sequences producing significant alignments:</h5>
+
+              <table class=descriptiontable>
+                <col/><col/><col/><col/><col/><col/><col/>
+                <tr>
+                  <th>Description</th>
+                  <th>Max score</th>
+                  <th>Total score</th>
+                  <th>Query cover</th>
+                  <th>E value</th>
+                  <th>Ident</th>
+                  <th>Accession</th>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit7-1"
+                              title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"
+                              id="description7-1">
+                        EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
+                  </a></div></td>
+                  <td>67.9</td>
+                  <td>67.9</td>
+                  <td>100%</td>
+                  <td>3.564e-15</td>
+                  <td>86%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td>
+                </tr>
+                <tr>
+                  <td><div><a href="#hit7-2"
+                              title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"
+                              id="description7-2">
+                        AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
+                  </a></div></td>
+                  <td>67.9</td>
+                  <td>67.9</td>
+                  <td>100%</td>
+                  <td>3.564e-15</td>
+                  <td>86%</td>
+                  <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td>
+                </tr>
+              </table>
+
+          </div></div>
+        </section>
+
+
+
+        <section class=alignments>
+          <h3>Alignments</h3>
+
+          <div class=grey><div class=white>
+              <div class=alignment id=hit7-1>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description7-1">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a>
+                    <span class=b>Length:</span> 4983
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot7-1-1>
+                  <p class=range>
+                    <span class=range>Range 1: 2319 to 2392</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>67.8929 bits (34)</td>
+                      <td>3.56369e-15</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
+                      <td>Plus/Plus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG  60
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | 
+Subject   2319  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  2378</pre>
+                  <pre class=alignmentgraphic>Query       61  TTCGCAGTCCAGAA  74
+                ||||| ||||||||
+Subject   2379  TTCGCCGTCCAGAA  2392</pre>
+                </div>
+
+              </div>
+
+              <div class=alignment id=hit7-2>
+
+                <div class=linkheader>
+                  <div class=right><a href="#description7-2">Descriptions</a></div>
+                  <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a>
+                </div>
+
+                <div class=title>
+                  <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>
+                  <p class=titleinfo>
+                    <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a>
+                    <span class=b>Length:</span> 4180
+                    <span class=b>Number of Matches:</span> 1
+                  </p>
+                </div>
+
+
+                <div class=hotspot id=hotspot7-2-1>
+                  <p class=range>
+                    <span class=range>Range 1: 1589 to 1516</span>
+                  </p>
+
+                  <table class=hotspotstable>
+                    <tr>
+                      <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>
+                    </tr>
+                    <tr>
+                      <td>67.8929 bits (34)</td>
+                      <td>3.56369e-15</td>
+                      <td>64/74 (86%)</td>
+                      <td>0/74 (0%)</td>
+                      <td>Plus/Minus</td>
+                    </tr>
+                  </table>
+
+                  <pre class=alignmentgraphic>Query        1  GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG  60
+                ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | 
+Subject   1589  GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC  1530</pre>
+                  <pre class=alignmentgraphic>Query       61  TTCGCAGTCCAGAA  74
+                ||||| ||||||||
+Subject   1529  TTCGCCGTCCAGAA  1516</pre>
+                </div>
+
+              </div>
+
+          </div></div>
+        </section>
+      </section>
+
+    </div>
+
+    <footer>
+      This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>.
+    </footer>
+  </body>
+</html>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blastdb.loc	Tue Jul 07 09:28:08 2015 +0200
@@ -0,0 +1,39 @@
+#This is a sample file distributed with Galaxy that is used to define a
+#list of nucleotide BLAST databases, using three columns tab separated
+#(longer whitespace are TAB characters):
+#
+#<unique_id>	<database_caption>	<base_name_path>
+#
+#The captions typically contain spaces and might end with the build date.
+#It is important that the actual database name does not have a space in
+#it, and that there are only two tabs on each line.
+#
+#So, for example, if your database is nt and the path to your base name 
+#is /depot/data2/galaxy/blastdb/nt/nt.chunk, then the blastdb.loc entry 
+#would look like this:
+#
+#nt_02_Dec_2009      nt 02 Dec 2009      /depot/data2/galaxy/blastdb/nt/nt.chunk
+#
+#and your /depot/data2/galaxy/blastdb/nt directory would contain all of 
+#your "base names" (e.g.):
+#
+#-rw-r--r--  1 wychung galaxy  23437408 2008-04-09 11:26 nt.chunk.00.nhr
+#-rw-r--r--  1 wychung galaxy   3689920 2008-04-09 11:26 nt.chunk.00.nin
+#-rw-r--r--  1 wychung galaxy 251215198 2008-04-09 11:26 nt.chunk.00.nsq
+#...etc...
+#
+#Your blastdb.loc file should include an entry per line for each "base name" 
+#you have stored.  For example:
+#
+#nt_02_Dec_2009		nt 02 Dec 2009		/depot/data2/galaxy/blastdb/nt/nt.chunk
+#wgs_30_Nov_2009	wgs 30 Nov 2009	/depot/data2/galaxy/blastdb/wgs/wgs.chunk
+#test_20_Sep_2008	test 20 Sep 2008	/depot/data2/galaxy/blastdb/test/test
+#...etc...
+#
+#You can download the NCBI provided protein databases like NT from here:
+#ftp://ftp.ncbi.nlm.nih.gov/blast/db/
+#
+#See also blastdb_p.loc which is for any protein BLAST database, and
+#blastdb_d.loc which is for any protein domains databases (like CDD).
+
+EUginius_plasmid	Euginius plasmid insert	/opt/galaxy/blastdbs/EUginius_plasmid_insert	Example Gene Bank	http://example.com/example-genebank/{defline[0]}/
--- a/test-data/refresh_test_results.sh	Thu Jul 31 16:49:27 2014 +0200
+++ b/test-data/refresh_test_results.sh	Tue Jul 07 09:28:08 2015 +0200
@@ -6,5 +6,9 @@
 
 for i in 1 2 3 4
 do
-	"$@" ../blast2html.py -i "blast xml example$i.xml" -o "blast xml example$i.html"
+    "$@" ../blast2html.py -i "blast xml example$i.xml" -o "blast xml example$i.html"
 done
+
+"$@" ../blast2html.py -i "blast xml example3.xml" -o "blast xml example3b.html" --genelink-template 'http://example.com/example-genebank?id={fullid}'
+"$@" ../blast2html.py -i "blast xml example4.xml" -o "blast xml example4b.html" --db-config-dir .
+
--- a/tool_dependencies.xml	Thu Jul 31 16:49:27 2014 +0200
+++ b/tool_dependencies.xml	Tue Jul 07 09:28:08 2015 +0200
@@ -10,6 +10,11 @@
                 toolshed="http://toolshed.g2.bx.psu.edu" changeset_revision="039b04adcfee" />
   </package>
 
+  <package name="zlib" version="1.2.8">
+    <repository name="package_zlib_1_2_8" owner="iuc" prior_installation_required="True"
+                toolshed="http://toolshed.g2.bx.psu.edu" changeset_revision="63a4a902cda2" />
+  </package>
+
   <package name="blast2html_venv" version="0.2">
     <install version="1.0">
       <actions>
@@ -22,6 +27,10 @@
                       toolshed="http://toolshed.g2.bx.psu.edu" changeset_revision="039b04adcfee">
             <package name="libxslt" version="1.1.28" />
           </repository>
+          <repository name="package_zlib_1_2_8" owner="iuc"
+                      toolshed="http://toolshed.g2.bx.psu.edu" changeset_revision="63a4a902cda2">
+            <package name="zlib" version="1.2.8" />
+          </repository>
         </action>
 
 	<action type="setup_virtualenv">
@@ -37,8 +46,8 @@
 	</action>
 	
         <action type="set_environment">
-          <!-- add libxml2 library path so the runtime can find the shared library -->
-          <environment_variable name="LD_LIBRARY_PATH" action="prepend_to">$ENV[LIBXML_ROOT_PATH]/lib</environment_variable>
+          <!-- add libxml2/zlib library paths so the runtime can find the shared libraries -->
+          <environment_variable name="LD_LIBRARY_PATH" action="prepend_to">$ENV[LD_LIBRARY_PATH]</environment_variable>
         </action>
       </actions>
     </install>