|
0
|
1 use DBI;
|
|
|
2
|
|
|
3 #####
|
|
|
4 # Database configuration
|
|
|
5 #####
|
|
|
6 #
|
|
|
7 # Specify the username to connect to the database as
|
|
|
8 #$db_username="MY_DB_USERNAME";
|
|
|
9 #
|
|
|
10 # Specify the password for the DB user
|
|
|
11 #$db_password="MY_DB_PASSWORD";
|
|
|
12 #
|
|
|
13 # The software running the application
|
|
|
14 # Currently supported:
|
|
|
15 # * MySQL (Several database operations use MySQL specific SQL)
|
|
|
16 #$db_type='mysql';
|
|
|
17 #
|
|
|
18 # The machine name or IP address to connect to the database on
|
|
|
19 #$db_host="127.0.0.1";
|
|
|
20 #
|
|
|
21 # The port that the database is listening to on the host
|
|
|
22 #$db_port='3306';
|
|
|
23 #
|
|
|
24 # The database to use for TAPDANCE
|
|
|
25 #$db_name="MY_TAPDANCE_DB";
|
|
|
26 #$db_name="MY_DB";
|
|
|
27 #
|
|
|
28 # Collapse db config to a single connection string
|
|
|
29 #$data_source = "dbi:$db_type:dbname=$db_name:$db_host;mysql_local_infile=1:$db_port";
|
|
|
30 #
|
|
|
31 # Connect to the daatbase, running 'perl ./tabdance_base_config.pl
|
|
|
32 # can be used to verfiy the database configuration
|
|
|
33 #$dbh = DBI->connect($data_source, $db_username, $db_password, { RaiseError => 1, AutoCommit => 0 });
|
|
|
34 #
|
|
|
35 # The name of the table to collect top level project information
|
|
|
36 $project_table_name = "TAPDANCE_project_master";
|
|
|
37
|
|
|
38 #####
|
|
|
39 # Required project dependant config variables
|
|
|
40 #####
|
|
|
41 # Project Name
|
|
|
42 #$proj = 'ProjName';
|
|
|
43
|
|
|
44 # Environment Directory or the top level directory for the project
|
|
|
45 # Contents will be as follows
|
|
|
46 # * CIS (directory containing intermediary files generated during CIS calculation)
|
|
|
47 # * config.pl (this file)
|
|
|
48 # * data (data inputs)
|
|
|
49 # * barcode2lib.txt (barcode to library name mapping, phase 1)
|
|
|
50 # * seq.tab (tabular sequence data, phase 1)
|
|
|
51 # * FISH (directory containing intermediary files generated during Fisher exact tests)
|
|
|
52 # * lib (executable code and some resources used by code)
|
|
|
53 # * mapping (directory containing intermediary files generated during mapping to the reference genome)
|
|
|
54 # * results (directory containing final outputs)
|
|
|
55 #$envDir = 'DirectoryName';
|
|
|
56
|
|
|
57 #####
|
|
|
58 # Config variables for insertion analysis
|
|
|
59 #####
|
|
|
60 # Specify the alignment
|
|
|
61
|
|
|
62 # Specify the bowtie command to use, useful if you want to use a specific bowtie version not on the path
|
|
|
63 # or would like special options. For example, to quiet bowtie output. Defaults to 'bowtie' on user $PATH
|
|
|
64 $bowtie_exe='bowtie --quiet';
|
|
|
65
|
|
|
66 # Specify the genome idnex to use, should be a full path excluding the file extension or just the name of
|
|
|
67 # the genome index if the index is in the indexes folder of the bowtie installation. Defaults to 'mm9'
|
|
|
68 #$bowtie_idx = '/project/ccbioinf/Software/bowtie_indexes/mus_musculus_ncbi37';
|
|
|
69 $bowtie_idx='mm9';
|
|
|
70
|
|
|
71 # Specify the IRDR string to use, see common options below, defaults to a Sleeping Beauty mutagen
|
|
|
72 # '__GTATGTAAACTTCCGACTTCAACTG'
|
|
|
73 $mutagens="__GTATGTAAACTTCCGACTTCAACTG";
|
|
|
74
|
|
|
75 #####
|
|
|
76 # Config variables for CIS calling
|
|
|
77 #####
|
|
|
78 # The interval file of features to annotate CIS calls with
|
|
|
79 $annotation_file="lib/mm9.bed";
|
|
|
80 #
|
|
|
81 $library_percent ='0.0001';
|
|
|
82 #
|
|
|
83 $CIS_total_pvalue = '0.05';
|
|
|
84 $CIS_library_pvalue = '0.05';
|
|
|
85 $CIS_region_pvalue = '0.05';
|
|
|
86 #
|
|
|
87 $cocis_threshold ='0.001';
|
|
|
88
|
