--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lib/config.pl	Fri Dec 09 11:56:56 2011 -0500
@@ -0,0 +1,70 @@
+use DBI;
+
+#
+# Database stuff
+#
+
+ $dbh;       # database handler
+ $db_name     = 'largaespada_NGS_insertion_test';
+#my $db_username = 'insertion_larga';
+#my $db_password = 'uwtc.Pzc92';
+ $db_username = 'sarvera';
+ $db_password = 'fn101bcc';
+
+ $db_host     = '127.0.0.1;mysql_local_infile=1';
+ $db_type     = 'mysql';
+ $data_source = "DBI:$db_type:database=$db_name;host=$db_host";
+
+#
+# global values
+#
+# allows multiple active instances to be running in the db...
+$proj = 'merge_science';
+$library_percent ='0.0001';
+
+$CIS_total_pvalue = '0.05';
+$CIS_library_pvalue = '0.05';
+$CIS_region_pvalue = '0.05';
+
+$cocis_threshold ='0.001';
+
+$dbh = DBI->connect($data_source, $db_username, $db_password,
+{ RaiseError => 1, AutoCommit => 0 });
+
+sub resolve_barcodes {
+#2.1 map the barcodes to the sequences..must change (sequence, #) to length of barcode +1 based on barcode sequence length!.
+#Currently set up for 6,10,12 base barcodes.
+####for 6mer barcodes...
+#$sth = $dbh->prepare("create table illumina_decoded_$proj select library, id, substring(sequence,7) as decoded_sequence from barcode_$proj,illumina_raw_$proj where sequence like concat(seq,'%')");
+####for 10mer barcodes...
+$sth = $dbh->prepare("create table illumina_decoded_$proj select library, id, substring(sequence,11) as decoded_sequence from barcode_$proj,illumina_raw_$proj where sequence like concat(seq,'%')");
+#for 12mer barcodes...
+#$sth = $dbh->prepare("create table illumina_decoded_$proj select library, id, substring(sequence,13) as decoded_sequence from barcode_$proj,illumina_raw_$proj where sequence like concat(seq,'%')");
+
+$sth->execute;
+
+  }
+
+sub resolve_IRDR {
+#2.3 
+#different options available this section needs to be optomized for each dataset
+#for lung 454 data
+$sth = $dbh->prepare("create table illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,32) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like '_____TGTATGTAAACTTCCGACTTCAACTG%'");
+
+$sth->execute;
+$sth = $dbh->prepare("insert into illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,31) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like '_____TGTATGTAACTTCCGACTTCAACTG%'");
+
+
+
+#$sth = $dbh->prepare("create table illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,31) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like 'TTAAGTGTATGTAACTTCCGACTTCAACTG%'");
+
+#for illumina data
+#$sth = $dbh->prepare("create table illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,27) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like 'TGTATGTAAACTTCCGACTTCAACTG%'");
+
+#for illumina_2 data
+#$sth = $dbh->prepare("create table illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,30) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like '___TGTATGTAAACTTCCGACTTCAACTG%'");
+
+#for MULV virus
+#$sth = $dbh->prepare("create table illumina_without_IRDR_$proj select library,id,substring(decoded_sequence,26) as insertion_sequence, 'good' as type from illumina_decoded_$proj where decoded_sequence like 'CCAAACCTACAGGTGGGGTCTTTCA%'");
+$sth->execute;
+}