Mercurial > repos > jjohnson > bamutil_diff
diff bamutil_diff.xml @ 0:2cafa8420c04 draft default tip
"planemo upload for repository https://github.com/jj-umn/galaxytools/tree/master/bamutil/ commit c1945909ca200610f128577b68a82d9228905f3d-dirty"
author | jjohnson |
---|---|
date | Fri, 26 Mar 2021 13:16:53 +0000 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bamutil_diff.xml Fri Mar 26 13:16:53 2021 +0000 @@ -0,0 +1,265 @@ +<tool id="bamutil_diff" name="BamUtil diff" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" python_template_version="3.5"> + <description>two coordinate sorted SAM/BAM files</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="exit_code"><![CDATA[ + bam diff + --in1 '$in1' + --in2 '$in2' + #if $fields.choice == 'all': + --all + #elif $fields.choice == 'select': + $fields.flag + $fields.mapQual + $fields.mate + $fields.isize + $fields.seq + $fields.baseQual + $fields.noCigar + $fields.noPos + #if $fields.samtags.tagchoice == 'everyTag': + --everyTag + #elif $fields.samtags.tagchoice == 'specify': + --tags '$fields.samtags.tags' + #end if + #end if + --posDiff $posDiff + --recPoolSize -1 + $onlyDiffs + --params + --noPhoneHome + --out $output_as + ]]></command> + <inputs> + <param argument="--in1" type="data" format="sam,bam" label="Input BAM 1"/> + <param argument="--in2" type="data" format="sam,bam" label="Input BAM 2"/> + <param argument="--posDiff" type="integer" value="100000" min="0" label="max base pair difference between possibly matching records"/> + <param argument="--onlyDiffs" type="boolean" truevalue="--onlyDiffs" falsevalue="" checked="false" label="only print the fields that differ"/> + <conditional name="fields"> + <param name="choice" type="select" label="BAM fields to diff"> + <option value="default" selected="true">Read Name, Flag Fragment bit, Position, Cigar</option> + <option value="all">Diff all the SAM/BAM fields</option> + <option value="select">Select SAM/BAM fields to diff</option> + </param> + <when value="default"/> + <when value="all"/> + <when value="select"> + <param argument="--flag" type="boolean" truevalue="--flag" falsevalue="" checked="false" label="diff the flags."/> + <param argument="--mapQual" type="boolean" truevalue="--mapQual" falsevalue="" checked="false" label="diff the mapping qualities."/> + <param argument="--mate" type="boolean" truevalue="--mate" falsevalue="" checked="false" label="diff the mate chrom/pos."/> + <param argument="--isize" type="boolean" truevalue="--isize" falsevalue="" checked="false" label="diff the insert sizes."/> + <param argument="--seq" type="boolean" truevalue="--seq" falsevalue="" checked="false" label="diff the sequence bases."/> + <param argument="--baseQual" type="boolean" truevalue="--baseQual" falsevalue="" checked="false" label="diff the base qualities."/> + <param argument="--noCigar" type="boolean" truevalue="--noCigar" falsevalue="" checked="false" label="do not diff the the cigars."/> + <param argument="--noPos" type="boolean" truevalue="--noPos" falsevalue="" checked="false" label="do not diff the positions."/> + <conditional name="samtags"> + <param name="tagchoice" type="select" label="Tags to diff"> + <option value="none">Do not diff tags</option> + <option value="everyTag">Diff every tag</option> + <option value="specify">Specify tags to diff</option> + </param> + <when value="none"/> + <when value="everyTag"/> + <when value="specify"> + <param argument="--tags" type="text" label="diff the specified Tags formatted as Tag:Type,Tag:Type,Tag:Type..."> + <validator type="regex" message="SAM 2-char Tag:type">^([A-Za-z][A-Za-z0-9]:[AifZHB])(,[A-Za-z][A-Za-z0-9]:[AifZHB])*$</validator> + </param> + </when> + </conditional> + </when> + </conditional> + <param name="output_as" type="select" label="Output format"> + <option value="diff.txt">ASCII text diff file</option> + <option value="diff.bam">BAM files: diff, only_in_file1, only_in_file2</option> + <option value="diff.sam">SAM files: diff, only_in_file1, only_in_file2</option> + </param> + </inputs> + <outputs> + <data name="diff_bam" format="bam" from_work_dir="diff.bam" label="${tool.name} on ${on_string}: diff.bam"> + <filter>output_as == 'diff.bam'</filter> + </data> + <data name="diff_only1_bam" format="bam" from_work_dir="diff_only1_*.bam" label="${tool.name} on ${on_string} only in: ${in1.element_identifier}"> + <filter>output_as == 'diff.bam'</filter> + </data> + <data name="diff_only2_bam" format="bam" from_work_dir="diff_only2_*.bam" label="${tool.name} on ${on_string} only in: ${in2.element_identifier}"> + <filter>output_as == 'diff.bam'</filter> + </data> + <data name="diff_sam" format="sam" from_work_dir="diff.sam" label="${tool.name} on ${on_string}: diff.sam"> + <filter>output_as == 'diff.sam'</filter> + </data> + <data name="diff_only1_sam" format="sam" from_work_dir="diff_only1_*.sam" label="${tool.name} on ${on_string} only in: ${in1.element_identifier}"> + <filter>output_as == 'diff.sam'</filter> + </data> + <data name="diff_only2_sam" format="sam" from_work_dir="diff_only2_*.sam" label="${tool.name} on ${on_string} only in: ${in2.element_identifier}"> + <filter>output_as == 'diff.sam'</filter> + </data> + <data name="diff_txt" format="txt" from_work_dir="diff.txt" label="${tool.name} on ${on_string}: diff.txt"> + <filter>output_as == 'diff.txt'</filter> + </data> + </outputs> + <tests> + <!-- Test-1 --> + <test> + <param name="in1" ftype="sam" value="in1.sam"/> + <param name="in2" ftype="sam" value="in2.sam"/> + <param name="posDiff" value="100000"/> + <param name="onlyDiffs" value="true"/> + <conditional name="fields"> + <param name="choice" value="default"/> + </conditional> + <param name="output_as" value="diff.txt"/> + <output name="diff_txt" file="diff.txt"/> + <output name="diff_txt"> + <assert_contents> + <has_text text="NB500964:249:HHLFNBGX7:3:21407:1974:9687" /> + <has_text_matching expression="<\t1a3\t74M74N1M" /> + <has_text_matching expression=">\ta3\t74M66N1M" /> + </assert_contents> + </output> + </test> + + <!-- Test-2 --> + <test> + <param name="in1" ftype="sam" value="in1.sam"/> + <param name="in2" ftype="sam" value="in2.sam"/> + <param name="posDiff" value="100000"/> + <param name="onlyDiffs" value="true"/> + <conditional name="fields"> + <param name="choice" value="select"/> + <param name="flag" value="true"/> + <param name="seq" value="true"/> + <conditional name="samtags"> + <param name="tagchoice" value="specify"/> + <param name="tags" value="AS:i,MD:Z"/> + </conditional> + </conditional> + <param name="output_as" value="diff.sam"/> + <output name="diff_sam"> + <assert_contents> + <has_text text="NB500964:249:HHLFNBGX7:4:12608:21020:10228" /> + <not_has_text text="NB500964:249:HHLFNBGX7:4:11510:10074:3541" /> + <not_has_text text="NB500964:249:HHLFNBGX7:1:12312:5087:3846" /> + </assert_contents> + </output> + <output name="diff_only1_sam"> + <assert_contents> + <has_text text="NB500964:249:HHLFNBGX7:1:12312:5087:3846" /> + <not_has_text text="NB500964:249:HHLFNBGX7:4:11510:10074:3541" /> + <has_text text="TGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCG" /> + <has_text text="AS:i:0" /> + <has_text text="MD:Z:75" /> + </assert_contents> + </output> + <output name="diff_only2_sam"> + <assert_contents> + <has_text text="NB500964:249:HHLFNBGX7:4:11510:10074:3541" /> + <not_has_text text="NB500964:249:HHLFNBGX7:1:12312:5087:3846" /> + <has_text text="ATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCA" /> + <has_text text="AS:i:0" /> + <has_text text="MD:Z:75" /> + </assert_contents> + </output> + </test> + <!-- Test-3 --> + <test> + <param name="in1" ftype="sam" value="in1.sam"/> + <param name="in2" ftype="sam" value="in3.sam"/> + <param name="posDiff" value="100000"/> + <param name="onlyDiffs" value="true"/> + <conditional name="fields"> + <param name="choice" value="default"/> + </conditional> + <param name="output_as" value="diff.txt"/> + <output name="diff_txt"> + <assert_contents> + <not_has_text text="NB500964:249:HHLFNBGX7:3:21407:1974:9687" /> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ +**bamUtil diff** + +The diff option on the bamUtil executable prints the difference between two coordinate sorted SAM/BAM files. This can be used to compare the outputs of running a SAM/BAM through different tools/versions of tools. +The diff tool compares records that have the same Read Name and Fragment (from the flag). If a matching ReadName & Fragment is not found, the record is considered to be different. +diff assumes the files are coordinate sorted and uses this assumption for determining how long to store a record before determining that the other file does not contain a matching ReadName/Fragment. If the files are not coordinate sorted, this logic does not work. +By default, just the chromosome/position and cigar are compared for each record. +Note: The headers are not compared. + +Options are available to compare:: + + - all fields + - flags + - mapping quality + - mate chromosome/position + - insert size + - sequence + - base quality + - specified tags + - all tags + - turn off position comparison + - turn off cigar comparison + +**Inputs** + Two BAM or SAM alignment files + +**Outputs** + Choice of 2 Output Formats: + + :: + + **Diff Format** + There are 2 types of differences. + ReadName/Fragment combo is in one file, but not in the other file within the window set by recPoolSize & posDiff + ReadName/Fragment combo is in both files, but at least one of the specified fields to diff is different + Each difference output consists of 2 or 3 lines. If the record only appears in one of the files, the diff is 2 lines, if it appears in both files, the diff is 3 lines. + The first line of the difference output is just the read name. + The 2nd and 3rd line (if present) begin with either a '<' or a '>'. If the record is from the first file (--in1), it begins with a '<'. If the record is from the 2nd file (--in2), it begins with a '>'. + The 2nd line is the flag followed by the diff'd fields from one of the records. + The 3rd line (if a matching record was found) is the flag followed by the diff'd fields from the matching record. + The diff'd record lines are tab separated, and are in the following order if --onlyDiffs is not specified:: + + - '<' or '>' + - flag + - chrom:pos (chromosome name ':' 1 based position) - if --noPos is not specified + - cigar - if --noCigar is not specified + - mapping quality - if --mapq or --all is specified + - mate chrom:pos (chromosome name ':' 1 based position) - if --mate or --all is specified + - insert size - if --isize or --all is specified + - sequence - if --seq or --all is specified + - base quality - if --baseQual or --all is specified + - tag:type:value - for each tag:type specified in --tags or for every tag if --all or --everyTag specified + + + **BAM Format** + In SAM/BAM format there will be 3 output files:: + + 1. the specified name with record diffs + 2. specified name with _only_<in1>.sam/bam with records only in the in1 file + 3. specified name with _only_<in2>.sam/bam with records only in the in2 file + + Records that are identical in the two files are not written in any of these output files. + When a record is found in both input files, but a difference is found, the record from the first file is written with additional tags to indicate the values from the second file, using the following tags:: + + - ZF - Flag + - ZP - Chromosome:1-based Position + - ZC - Cigar + - ZM - Mapping Quality + - ZN - Chromosome:1-based Mate Position + - ZI - Insert Size + - ZS - Sequence + - ZQ - Base Quality + - ZT - Tags + + If --onlyDiffs is not specified, all fields that were compared will be printed in the tags. If --onlyDiffs is specified, then only the differing compared fields will be printed in the tags. + + + + +https://genome.sph.umich.edu/wiki/BamUtil:_diff + + ]]></help> + <expand macro="citations" /> +</tool>