# HG changeset patch
# User jjohnson
# Date 1616764613 0
# Node ID 2cafa8420c046f99fb60cf9e723fc72e8637feaa
"planemo upload for repository https://github.com/jj-umn/galaxytools/tree/master/bamutil/ commit c1945909ca200610f128577b68a82d9228905f3d-dirty"
diff -r 000000000000 -r 2cafa8420c04 bamutil_diff.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamutil_diff.xml Fri Mar 26 13:16:53 2021 +0000
@@ -0,0 +1,265 @@
+
+ two coordinate sorted SAM/BAM files
+
+ macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ^([A-Za-z][A-Za-z0-9]:[AifZHB])(,[A-Za-z][A-Za-z0-9]:[AifZHB])*$
+
+
+
+
+
+
+
+
+
+
+
+
+
+ output_as == 'diff.bam'
+
+
+ output_as == 'diff.bam'
+
+
+ output_as == 'diff.bam'
+
+
+ output_as == 'diff.sam'
+
+
+ output_as == 'diff.sam'
+
+
+ output_as == 'diff.sam'
+
+
+ output_as == 'diff.txt'
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ '. If the record is from the first file (--in1), it begins with a '<'. If the record is from the 2nd file (--in2), it begins with a '>'.
+ The 2nd line is the flag followed by the diff'd fields from one of the records.
+ The 3rd line (if a matching record was found) is the flag followed by the diff'd fields from the matching record.
+ The diff'd record lines are tab separated, and are in the following order if --onlyDiffs is not specified::
+
+ - '<' or '>'
+ - flag
+ - chrom:pos (chromosome name ':' 1 based position) - if --noPos is not specified
+ - cigar - if --noCigar is not specified
+ - mapping quality - if --mapq or --all is specified
+ - mate chrom:pos (chromosome name ':' 1 based position) - if --mate or --all is specified
+ - insert size - if --isize or --all is specified
+ - sequence - if --seq or --all is specified
+ - base quality - if --baseQual or --all is specified
+ - tag:type:value - for each tag:type specified in --tags or for every tag if --all or --everyTag specified
+
+
+ **BAM Format**
+ In SAM/BAM format there will be 3 output files::
+
+ 1. the specified name with record diffs
+ 2. specified name with _only_.sam/bam with records only in the in1 file
+ 3. specified name with _only_.sam/bam with records only in the in2 file
+
+ Records that are identical in the two files are not written in any of these output files.
+ When a record is found in both input files, but a difference is found, the record from the first file is written with additional tags to indicate the values from the second file, using the following tags::
+
+ - ZF - Flag
+ - ZP - Chromosome:1-based Position
+ - ZC - Cigar
+ - ZM - Mapping Quality
+ - ZN - Chromosome:1-based Mate Position
+ - ZI - Insert Size
+ - ZS - Sequence
+ - ZQ - Base Quality
+ - ZT - Tags
+
+ If --onlyDiffs is not specified, all fields that were compared will be printed in the tags. If --onlyDiffs is specified, then only the differing compared fields will be printed in the tags.
+
+
+
+
+https://genome.sph.umich.edu/wiki/BamUtil:_diff
+
+ ]]>
+
+
diff -r 000000000000 -r 2cafa8420c04 macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Fri Mar 26 13:16:53 2021 +0000
@@ -0,0 +1,22 @@
+
+ 1.0.15
+ 0
+
+
+ bamutil
+
+
+
+
+
+ @online{bamUtil,
+ author = {iStatistical Genetics},
+ title = {bamUtil},
+ year = 2015,
+ url = {https://github.com/statgen/bamUtil},
+ urldate = {2021-03-01}
+ }
+
+
+
+
diff -r 000000000000 -r 2cafa8420c04 test-data/diff.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/diff.sam Fri Mar 26 13:16:53 2021 +0000
@@ -0,0 +1,59 @@
+@HD VN:1.0 SO:coordinate
+@SQ SN:1 LN:248956422
+@SQ SN:2 LN:242193529
+@SQ SN:3 LN:198295559
+@SQ SN:4 LN:190214555
+@SQ SN:5 LN:181538259
+@SQ SN:6 LN:170805979
+@SQ SN:7 LN:159345973
+@SQ SN:8 LN:145138636
+@SQ SN:9 LN:138394717
+@SQ SN:10 LN:133797422
+@SQ SN:11 LN:135086622
+@SQ SN:12 LN:133275309
+@SQ SN:13 LN:114364328
+@SQ SN:14 LN:107043718
+@SQ SN:15 LN:101991189
+@SQ SN:16 LN:90338345
+@SQ SN:17 LN:83257441
+@SQ SN:18 LN:80373285
+@SQ SN:19 LN:58617616
+@SQ SN:20 LN:64444167
+@SQ SN:21 LN:46709983
+@SQ SN:22 LN:50818468
+@SQ SN:X LN:156040895
+@SQ SN:Y LN:57227415
+@SQ SN:MT LN:16569
+@PG ID:hisat2 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:hisat2-55424A4 PN:hisat2 VN:2.1.0 CL:"/home/galaxy/galaxy/miniconda2/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/rissdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:hisat2-55424A4-3A2CCEF5 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools PN:samtools PP:hisat2-55424A4-3A2CCEF5 VN:1.11 CL:samtools sort -@ 1 -m 10240M -T sorttemp -O sam -o 0.sam /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075444.dat
+@PG ID:hisat2-3A2CCEF5 PN:hisat2 VN:2.1.0 CL:"/home/galaxy/galaxy/miniconda2/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/rissdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools-6ADB4A65 PN:samtools PP:hisat2-3A2CCEF5 VN:1.11 CL:samtools sort -@ 1 -m 10240M -T sorttemp -O sam -o 1.sam /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat
+@PG ID:samtools.1 PN:samtools PP:samtools VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075450.dat 0.sam 1.sam
+@PG ID:samtools.2 PN:samtools PP:samtools-6ADB4A65 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075450.dat 0.sam 1.sam
+@PG ID:hisat2-6ADB4A65 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools.3 PN:samtools PP:samtools.1 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075454.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075523.dat 0.sam 1.sam
+@PG ID:samtools.4 PN:samtools PP:samtools.2 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075454.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075523.dat 0.sam 1.sam
+NB500964:249:HHLFNBGX7:4:12608:21020:10228 419 6 52995635 1 75M = 52995715 155 CTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCC AAAAAEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEAEEEEAEEEE a3 74M66N1M
+NB500964:249:HHLFNBGX7:3:22501:2652:1890
+< 1a3 74M66N1M
+> a3 74M74N1M
+NB500964:249:HHLFNBGX7:3:22503:25677:1737
+< 1a3 74M74N1M
+> a3 74M66N1M
+NB500964:249:HHLFNBGX7:3:22611:13268:8039
+< 1a3 74M74N1M
+> a3 74M66N1M
+NB500964:249:HHLFNBGX7:4:13607:25752:7238
+< 1a3 74M66N1M
+> a3 74M74N1M
+NB500964:249:HHLFNBGX7:4:21503:16243:7076
+< 1a3 74M74N1M
+> a3 74M66N1M
+NB500964:249:HHLFNBGX7:3:13604:7137:3437
+< 153 68M66N2M5S
+> 53 68M74N2M5S
+NB500964:249:HHLFNBGX7:3:23501:15949:4416
+< 153 68M66N2M5S
+> 53 68M74N2M5S
+NB500964:249:HHLFNBGX7:4:12404:22663:7685
+< 153 68M66N1M6S
+> 53 68M74N1M6S
+NB500964:249:HHLFNBGX7:4:12608:21020:10228
+< 153 68M74N2M5S
+> 53 68M66N2M5S
+NB500964:249:HHLFNBGX7:4:23603:22568:16607
+< 153 68M66N2M5S
+> 53 68M74N2M5S
+NB500964:249:HHLFNBGX7:3:23508:17777:5737
+< 1a3 70M5S
+> a3 75M
+NB500964:249:HHLFNBGX7:3:23508:17777:5737
+< 153 75M
+> 53 70M5S
+NB500964:249:HHLFNBGX7:4:11510:10074:3541
+> a3 6:52995646 75M
+NB500964:249:HHLFNBGX7:2:13209:7691:13203
+> a3 6:52995675 75M
+NB500964:249:HHLFNBGX7:4:11510:10074:3541
+> 53 6:52995715 75M
+NB500964:249:HHLFNBGX7:3:21512:8039:1524
+> a3 6:52995730 75M
+NB500964:249:HHLFNBGX7:2:13209:7691:13203
+> 53 6:52995789 75M
+NB500964:249:HHLFNBGX7:4:21507:2226:9226
+> a3 6:52995797 75M
+NB500964:249:HHLFNBGX7:4:21602:10644:5676
+> a3 6:52995802 75M
+NB500964:249:HHLFNBGX7:4:21507:2226:9226
+> 53 6:52995834 75M
+NB500964:249:HHLFNBGX7:4:21602:10644:5676
+> 53 6:52995834 75M
+NB500964:249:HHLFNBGX7:3:21512:8039:1524
+> 53 6:52995836 75M
+NB500964:249:HHLFNBGX7:3:13604:19654:15542
+> 63 6:53004731 75M
+NB500964:249:HHLFNBGX7:3:13604:19654:15542
+> 93 6:53004936 75M
+NB500964:249:HHLFNBGX7:1:12312:5087:3846
+< a3 6:52995649 75M
+NB500964:249:HHLFNBGX7:2:23304:14989:7965
+< 81 6:52995665 75M
+NB500964:249:HHLFNBGX7:4:13611:22454:15447
+< 1a3 6:52995667 75M
+NB500964:249:HHLFNBGX7:3:12409:4568:1161
+< a3 6:52995706 75M
+NB500964:249:HHLFNBGX7:4:21406:23062:17974
+< a3 6:52995706 75M
+NB500964:249:HHLFNBGX7:4:13611:22454:15447
+< 153 6:52995712 75M
+NB500964:249:HHLFNBGX7:3:23507:21978:1662
+< a3 6:52995758 75M
+NB500964:249:HHLFNBGX7:2:11209:14749:12659
+< a3 6:52995766 75M
+NB500964:249:HHLFNBGX7:3:12409:4568:1161
+< 53 6:52995785 75M
+NB500964:249:HHLFNBGX7:4:21406:23062:17974
+< 53 6:52995825 75M
+NB500964:249:HHLFNBGX7:2:13103:3678:13730
+< 59 6:52995829 75M
+NB500964:249:HHLFNBGX7:2:11209:14749:12659
+< 53 6:52995834 75M
+NB500964:249:HHLFNBGX7:3:23507:21978:1662
+< 53 6:52995835 1S73M1S
+NB500964:249:HHLFNBGX7:4:12611:5420:13168
+< 51 6:52995838 74M1S
+NB500964:249:HHLFNBGX7:1:12312:5087:3846
+< 53 6:52995848 73M2S
+NB500964:249:HHLFNBGX7:3:12402:8344:2452
+> 63 6:73519463 54M366N21M
+NB500964:249:HHLFNBGX7:3:12402:8344:2452
+> 93 6:73519916 75M
+NB500964:249:HHLFNBGX7:3:21607:1536:15142
+< 63 6:73518202 63M89N12M
+NB500964:249:HHLFNBGX7:3:21607:1536:15142
+< 93 6:73518250 2S15M89N58M
+NB500964:249:HHLFNBGX7:2:21106:19199:5423
+< 63 6:73519036 75M
+NB500964:249:HHLFNBGX7:2:21106:19199:5423
+< 93 6:73519096 75M
+NB500964:249:HHLFNBGX7:1:23112:23126:11688
+< 163 6:73519370 75M
+NB500964:249:HHLFNBGX7:1:23112:23126:11688
+< 193 6:73519434 75M
diff -r 000000000000 -r 2cafa8420c04 test-data/diff_only1_in1.sam
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/diff_only1_in1.sam Fri Mar 26 13:16:53 2021 +0000
@@ -0,0 +1,58 @@
+@HD VN:1.0 SO:coordinate
+@SQ SN:1 LN:248956422
+@SQ SN:2 LN:242193529
+@SQ SN:3 LN:198295559
+@SQ SN:4 LN:190214555
+@SQ SN:5 LN:181538259
+@SQ SN:6 LN:170805979
+@SQ SN:7 LN:159345973
+@SQ SN:8 LN:145138636
+@SQ SN:9 LN:138394717
+@SQ SN:10 LN:133797422
+@SQ SN:11 LN:135086622
+@SQ SN:12 LN:133275309
+@SQ SN:13 LN:114364328
+@SQ SN:14 LN:107043718
+@SQ SN:15 LN:101991189
+@SQ SN:16 LN:90338345
+@SQ SN:17 LN:83257441
+@SQ SN:18 LN:80373285
+@SQ SN:19 LN:58617616
+@SQ SN:20 LN:64444167
+@SQ SN:21 LN:46709983
+@SQ SN:22 LN:50818468
+@SQ SN:X LN:156040895
+@SQ SN:Y LN:57227415
+@SQ SN:MT LN:16569
+@PG ID:hisat2 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:hisat2-55424A4 PN:hisat2 VN:2.1.0 CL:"/home/galaxy/galaxy/miniconda2/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/rissdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:hisat2-55424A4-3A2CCEF5 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools PN:samtools PP:hisat2-55424A4-3A2CCEF5 VN:1.11 CL:samtools sort -@ 1 -m 10240M -T sorttemp -O sam -o 0.sam /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075444.dat
+@PG ID:hisat2-3A2CCEF5 PN:hisat2 VN:2.1.0 CL:"/home/galaxy/galaxy/miniconda2/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/rissdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools-6ADB4A65 PN:samtools PP:hisat2-3A2CCEF5 VN:1.11 CL:samtools sort -@ 1 -m 10240M -T sorttemp -O sam -o 1.sam /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat
+@PG ID:samtools.1 PN:samtools PP:samtools VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075450.dat 0.sam 1.sam
+@PG ID:samtools.2 PN:samtools PP:samtools-6ADB4A65 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075446.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075450.dat 0.sam 1.sam
+@PG ID:hisat2-6ADB4A65 PN:hisat2 VN:2.1.0 CL:"/panfs/roc/galaxy/shared/miniconda3/envs/mulled-v1-e7321ba46fa5ea4c6b9a06b78e6cd5182b33c0a47c2c86b5d610e1361f8b1686/bin/hisat2-align-s --wrapper basic-0 -p 4 -x /panfs/roc/risdb/galaxy/genomes/GRCh38_canon/hisat2_index/GRCh38_canon/GRCh38_canon --pen-cansplice 0 --pen-noncansplice 12 --pen-canintronlen G,-8.0,1.0 --pen-noncanintronlen G,-8.0,1.0 --known-splicesite-infile splice_sites.txt --min-intronlen 20 --max-intronlen 500000 --dta -1 input_f.fastq -2 input_r.fastq"
+@PG ID:samtools.3 PN:samtools PP:samtools.1 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075454.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075523.dat 0.sam 1.sam
+@PG ID:samtools.4 PN:samtools PP:samtools.2 VN:1.11 CL:samtools merge -@ 1 -s 1 -f -h /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075454.dat /panfs/roc/galaxy/PRODUCTION/database/files/001/075/dataset_1075523.dat 0.sam 1.sam
+NB500964:249:HHLFNBGX7:1:12312:5087:3846 163 6 52995649 60 75M = 52995848 274 TGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCG AAAA/EEEE6EEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEE6EEEEEEEE/EEEEEEEEEEEEEEEEEE/EE/ AS:i:0 MD:Z:75 NM:i:0 NH:i:1 XN:i:0 XM:i:0 ZS:i:-1 XO:i:0 XG:i:0 YS:i:-2 YT:Z:CP
+NB500964:249:HHLFNBGX7:2:23304:14989:7965 129 6 52995665 1 75M 2 32916255 0 GCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCT AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEE