Mercurial > repos > jjohnson > gmap
comparison gsnap.xml @ 7:561503a442f0
refactor
author | Jim Johnson <jj@umn.edu> |
---|---|
date | Tue, 08 Nov 2011 13:26:41 -0600 |
parents | |
children | a89fec682254 |
comparison
equal
deleted
inserted
replaced
6:3be0e0a858fe | 7:561503a442f0 |
---|---|
1 <tool id="gsnap" name="GSNAP" version="2.0.0"> | |
2 <description>Genomic Short-read Nucleotide Alignment Program</description> | |
3 <requirements> | |
4 <requirement type="binary">gsnap</requirement> | |
5 <!-- proposed tag for added datatype dependencies --> | |
6 <requirement type="datatype">gmapdb</requirement> | |
7 <requirement type="datatype">gmapsnpindex</requirement> | |
8 <requirement type="datatype">splicesites.iit</requirement> | |
9 <requirement type="datatype">introns.iit</requirement> | |
10 </requirements> | |
11 <version_string>gsnap --version</version_string> | |
12 <command> | |
13 #import os.path, re | |
14 gsnap | |
15 --nthreads="4" --ordered | |
16 #if $refGenomeSource.genomeSource == "gmapdb": | |
17 #set $gmapdb = $os.listdir($refGenomeSource.gmapdb.extra_files_path)[0] | |
18 --dir=$refGenomeSource.gmapdb.extra_files_path --db=$refGenomeSource.gmapdb.metadata.db_name | |
19 #else: | |
20 --dir=$os.path.dirname($refGenomeSource.gmapindex.value) --db=$os.path.basename($refGenomeSource.gmapindex.value) | |
21 #end if | |
22 #if $refGenomeSource.kmer != None and len($refGenomeSource.kmer.__str__) == 2: | |
23 --kmer=$refGenomeSource.kmer | |
24 #end if | |
25 #if $refGenomeSource.use_splicing.src == 'gmapdb': | |
26 #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: | |
27 -s $refGenomeSource.use_splicing.splicemap.value | |
28 #end if | |
29 #elif $refGenomeSource.use_splicing.src == 'history': | |
30 #if $refGenomeSource.use_splicing.splicemap != None and len($refGenomeSource.use_splicing.splicemap.__str__) > 0: | |
31 -S $os.path.dirname($refGenomeSource.use_splicing.splicemap) -s $os.path.basename($refGenomeSource.use_splicing.splicemap) | |
32 #end if | |
33 #end if | |
34 #if $refGenomeSource.use_snps.src == 'gmapdb': | |
35 #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: | |
36 -v $refGenomeSource.use_snps.snpindex.value | |
37 #end if | |
38 #elif $refGenomeSource.use_snps.src == 'history': | |
39 #if $refGenomeSource.use_snps.snpindex != None and len($refGenomeSource.use_snps.snpindex.__str__) > 0: | |
40 -V $refGenomeSource.use_snps.snpindex.extra_files_path -v $refGenomeSource.use_snps.snpindex.metadata.snps_name | |
41 #end if | |
42 #end if | |
43 #if $refGenomeSource.mode.__str__ != '': | |
44 --mode=$refGenomeSource.mode | |
45 #end if | |
46 #if $mapq_unique_score.__str__ != '': | |
47 --mapq-unique-score=$mapq_unique_score | |
48 #end if | |
49 #if $computation.options == "advanced": | |
50 #if $computation.max_mismatches.__str__ != '': | |
51 --max-mismatches=$computation.max_mismatches | |
52 #end if | |
53 $computation.query_unk_mismatch | |
54 $computation.genome_unk_mismatch | |
55 #if $computation.terminal_threshold.__str__ != '': | |
56 --terminal-threshold=$computation.terminal_threshold | |
57 #end if | |
58 #if $computation.indel_penalty.__str__ != '': | |
59 --indel-penalty=$computation.indel_penalty | |
60 #end if | |
61 #if $computation.indel_endlength.__str__ != '': | |
62 --indel-endlength=$computation.indel_endlength | |
63 #end if | |
64 #if $computation.max_middle_insertions.__str__ != '': | |
65 --max-middle-insertions=$computation.max_middle_insertions | |
66 #end if | |
67 #if $computation.max_middle_deletions.__str__ != '': | |
68 --max-middle-deletions=$computation.max_middle_deletions | |
69 #end if | |
70 #if $computation.max_end_insertions.__str__ != '': | |
71 --max-end-insertions=$computation.max_end_insertions | |
72 #end if | |
73 #if $computation.max_end_deletions.__str__ != '': | |
74 --max-end-deletions=$computation.max_end_deletions | |
75 #end if | |
76 #if $computation.suboptimal_levels.__str__ != '': | |
77 --suboptimal-levels=$computation.suboptimal_levels | |
78 #end if | |
79 #if $computation.adapter_strip.__str__ != '': | |
80 --adapter-strip=$computation.adapter_strip | |
81 #end if | |
82 #if $computation.trim_mismatch_score.__str__ != '': | |
83 --trim-mismatch-score=$computation.trim_mismatch_score | |
84 #end if | |
85 ## TODO - do we need these options (Is it tally XOR runlength?): | |
86 ## --tallydir= --use-tally=tally | |
87 ## --runlengthdir --use-runlength=runlength | |
88 #if $computation.use_tally != None and len($computation.use_tally.__str__) > 0: | |
89 ##--tallydir $os.path.dirname($computation.use_tally) --use-tally $os.path.basename($computation.use_tally) | |
90 --use-tally=$computation.use_tally | |
91 #end if | |
92 ## gmap options | |
93 #if $computation.gmap_mode.__str__ != '' and $computation.gmap_mode.__str__ != 'None': | |
94 --gmap-mode='$computation.gmap_mode' | |
95 #end if | |
96 #if $computation.trigger_score_for_gmap.__str__ != '': | |
97 --trigger-score-for-gmap=$computation.trigger_score_for_gmap | |
98 #end if | |
99 #if $computation.max_gmap_pairsearch.__str__ != '' and $re.search("pairsearch",$computation.gmap_mode): | |
100 --max-gmap-pairsearch=$computation.max_gmap_pairsearch | |
101 #end if | |
102 #if $computation.max_gmap_terminal.__str__ != '' and $re.search("terminal",$computation.gmap_mode): | |
103 --max-gmap-terminal=$computation.max_gmap_terminal | |
104 #end if | |
105 #if $computation.max_gmap_improvement.__str__ != '' and $re.search("improv",$computation.gmap_mode): | |
106 --max-gmap-improvement=$computation.max_gmap_improvement | |
107 #end if | |
108 #if $computation.microexon_spliceprob.__str__ != '': | |
109 --microexon-spliceprob=$computation.microexon_spliceprob | |
110 #end if | |
111 #end if | |
112 #if $splicing.options == "advanced": | |
113 $splicing.novelsplicing | |
114 #if $splicing.localsplicedist.__str__ != '': | |
115 --localsplicedist=$splicing.localsplicedist | |
116 #end if | |
117 #if $splicing.local_splice_penalty.__str__ != '': | |
118 --local-splice-penalty=$splicing.local_splice_penalty | |
119 #end if | |
120 #if $splicing.distant_splice_penalty.__str__ != '': | |
121 --distant-splice-penalty=$splicing.distant_splice_penalty | |
122 #end if | |
123 #if $splicing.local_splice_endlength.__str__ != '': | |
124 --local-splice-endlength=$splicing.local_splice_endlength | |
125 #end if | |
126 #if $splicing.distant_splice_endlength.__str__ != '': | |
127 --distant-splice-endlength=$splicing.distant_splice_endlength | |
128 #end if | |
129 #if $splicing.distant_splice_identity.__str__ != '': | |
130 --distant-splice-identity=$splicing.distant_splice_identity | |
131 #end if | |
132 #end if | |
133 #if $output.options == "advanced": | |
134 #if $output.npath.__str__ != '': | |
135 --npath=$output.npath | |
136 #end if | |
137 $output.quiet_if_excessive | |
138 $output.show_refdiff | |
139 $output.clip_overlap | |
140 #end if | |
141 #if $result.format == "sam": | |
142 --format=sam | |
143 $result.no_sam_headers | |
144 #if $result.read_group_id.__str__.strip != '': | |
145 --read-group-id='$result.read_group_id' | |
146 #end if | |
147 #if $result.read_group_name.__str__ != '': | |
148 --read-group-name='$result.read_group_name' | |
149 #end if | |
150 #if $result.read_group_library.__str__ != '': | |
151 --read-group-library='$result.read_group_library' | |
152 #end if | |
153 #if $result.read_group_platform.__str__ != '': | |
154 --read-group-platform='$result.read_group_platform' | |
155 #end if | |
156 #if $result.quality_shift.__str__ != '': | |
157 --quality-shift=$result.quality_shift | |
158 #end if | |
159 #elif $result.format == "goby": | |
160 #if $result.goby_output.__str__ != '': | |
161 --goby-output='$result.goby_output' | |
162 #end if | |
163 #if $result.creads_window_start.__str__ != '': | |
164 --creads-window-start=$result.creads_window_start | |
165 #end if | |
166 #if $result.creads_window_end.__str__ != '': | |
167 --creads-window-end=$result.creads_window_end | |
168 #end if | |
169 $result.creads_complement | |
170 #end if | |
171 #if $results.split_output == 'yes': | |
172 --split-output=gsnap_out | |
173 #if $results.fails.choice == 'nofails': | |
174 --nofails | |
175 #elif $results.fails.choice == 'failsonly': | |
176 --failsonly | |
177 #end if | |
178 $results.fails_as_input | |
179 #else | |
180 #if $results.fails.choice == 'nofails': | |
181 --nofails | |
182 #elif $results.fails.choice == 'failsonly': | |
183 --failsonly | |
184 $results.fails.fails_as_input | |
185 #end if | |
186 #end if | |
187 #if $seq.format == "gsnap_fasta": | |
188 $seq.circularinput $seq.gsnap | |
189 #else if $seq.format == "fastq": | |
190 #if $seq.barcode_length.__str__ != '': | |
191 --barcode-length=$seq.barcode_length | |
192 #end if | |
193 #if $seq.fastq_id_start.__str__ != '': | |
194 --fastq-id-start=$seq.fastq_id_start | |
195 #end if | |
196 #if $seq.fastq_id_end.__str__ != '': | |
197 --fastq-id-end=$seq.fastq_id_end | |
198 #end if | |
199 #if $seq.filter_chastity.__str__ != 'off': | |
200 --filter-chastity=$seq.filter_chastity | |
201 #end if | |
202 #if $seq.paired.ispaired.__str__ == 'yes': | |
203 #if $seq.paired.pairmax_dna.__str__ != '': | |
204 --pairmax-dna=$seq.paired.pairmax_dna | |
205 #end if | |
206 #if $seq.paired.pairmax_rna.__str__ != '': | |
207 --pairmax-rna=$seq.paired.pairmax_rna | |
208 #end if | |
209 $seq.fastq $seq.paired.fastq | |
210 #else | |
211 $seq.fastq | |
212 #end if | |
213 #end if | |
214 #if $results.split_output == 'yes': | |
215 2> $gsnap_stderr | |
216 #else: | |
217 #if $results.fails.choice.__str__ == 'failsonly' and $results.fails.fails_as_input.__str__ != '': | |
218 2> $gsnap_stderr > $gsnap_fq | |
219 #else | |
220 2> $gsnap_stderr > $gsnap_out | |
221 #end if | |
222 #end if | |
223 | |
224 </command> | |
225 <inputs> | |
226 <!-- Input data --> | |
227 <conditional name="seq"> | |
228 <param name="format" type="select" label="<H2>Input Sequences</H2>Select the input format" help=""> | |
229 <option value="fastq">Fastq</option> | |
230 <!-- | |
231 <option value="goby">Goby compact-reads</option> | |
232 --> | |
233 <option value="gsnap_fasta">GNSAP fasta</option> | |
234 </param> | |
235 <when value="fastq"> | |
236 <param name="fastq" type="data" format="fastq" label="Select a fastq dataset" /> | |
237 <conditional name="paired"> | |
238 <param name="ispaired" type="boolean" truevalue="yes" falsevalue="no" checked="false" label="Use Paired Reads?"/> | |
239 <when value="no"/> | |
240 <when value="yes"> | |
241 <param name="fastq" type="data" format="fastq" label="Select the paired reads reverse dataset" /> | |
242 <param name="orientation" type="select" label="Orientation of paired-end reads" help=""> | |
243 <option value="FR">fwd-rev, typical Illumina default</option> | |
244 <option value="RF">rev-fwd, for circularized inserts</option> | |
245 <option value="FF">fwd-fwd, same strand</option> | |
246 </param> | |
247 <param name="pairmax_dna" type="integer" value="" optional="true" label="Max total genomic length for DNA-Seq paired reads, or other reads without splicing (default 1000)." help="Used if no splice file is provided and novelsplicing is off."/> | |
248 <param name="pairmax_rna" type="integer" value="" optional="true" label="Max total genomic length for RNA-Seq paired reads, or other reads that could have a splice (default 200000)." help="Used novelspliceing is specified or a splice file is provided. Should probably match the value for localsplicedist."/> | |
249 </when> | |
250 </conditional> | |
251 <param name="barcode_length" type="integer" value="" optional="true" label="Amount of barcode to remove from start of read (default 0)" /> | |
252 <param name="fastq_id_start" type="integer" value="" optional="true" label="Starting field of identifier in FASTQ header, whitespace-delimited, starting from 1" /> | |
253 <param name="fastq_id_end" type="integer" value="" optional="true" label="Ending field of identifier in FASTQ header, whitespace-delimited, starting from 1" | |
254 help="Examples: | |
255 <br>@HWUSI-EAS100R:6:73:941:1973#0/1 | |
256 <br> . start=1, end=1 (default) => identifier is HWUSI-EAS100R:6:73:941:1973#0/1 | |
257 <br>@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36 | |
258 <br> . start=1, end=1 => identifier is SRR001666.1 | |
259 <br> . start=2, end=2 => identifier is 071112_SLXA-EAS1_s_7:5:1:817:345 | |
260 <br> . start=1, end=2 => identifier is SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345" | |
261 /> | |
262 <param name="filter_chastity" type="select" label="Skip reads marked by the Illumina chastity program" | |
263 help="String after the accession having a 'Y' after the first colon, like this: | |
264 <br>@accession 1:Y:0:CTTGTA | |
265 <br>where the 'Y' signifies filtering by chastity. | |
266 <br> For 'either', a 'Y' on either end of a paired-end read will be filtered. | |
267 <br> For 'both', a 'Y' is required on both ends of a paired-end read (or on the only end of a single-end read)" | |
268 > | |
269 <option value="off">off - no filtering</option> | |
270 <option value="either">either - a 'Y' on either end of a paired-end read</option> | |
271 <option value="both">both - a 'Y' is required on both ends of a paired-end read or the only end of a single-end read</option> | |
272 </param> | |
273 </when> | |
274 <!-- | |
275 <when value="goby"> | |
276 </when> | |
277 --> | |
278 <when value="gsnap_fasta"> | |
279 <param name="gsnap" type="data" format="fasta" label="Select a single-end dataset" help="GSNAP fasta must have the sequence entirely on one line, a second line is interpreted as the paired-end sequence"/> | |
280 <param name="circularinput" type="boolean" checked="false" truevalue="--circular-input=true" falsevalue="" label="Circular-end data (paired reads are on same strand)"/> | |
281 </when> | |
282 | |
283 </conditional> | |
284 <param name="mapq_unique_score" type="integer" value="" optional="true" label="MAPQ score threshold" | |
285 help="For multiple results, consider as a unique result if only one of the results has a MAPQ score equal or greater than this | |
286 (if not selected, then reports all multiple results, up to npaths)" /> | |
287 | |
288 <!-- GMAPDB for alignment --> | |
289 <conditional name="refGenomeSource"> | |
290 <param name="genomeSource" type="select" label="<HR><H2>Align To</H2>Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options"> | |
291 <option value="indexed">Use a built-in index</option> | |
292 <option value="gmapdb">Use a gmapdb from your history</option> | |
293 </param> | |
294 <when value="indexed"> | |
295 <param name="gmapindex" type="select" label="Select a reference genome" help="if your genome of interest is not listed - contact Galaxy team"> | |
296 <options from_file="gmap_indices.loc"> | |
297 <column name="uid" index="0" /> | |
298 <column name="dbkey" index="1" /> | |
299 <column name="name" index="2" /> | |
300 <column name="kmers" index="3" /> | |
301 <column name="maps" index="4" /> | |
302 <column name="snps" index="5" /> | |
303 <column name="value" index="6" /> | |
304 </options> | |
305 </param> | |
306 | |
307 <param name="kmer" type="select" data_ref="gmapindex" label="kmer size" help="Defaults to highest available kmer size"> | |
308 <options from_file="gmap_indices.loc"> | |
309 <column name="name" index="3"/> | |
310 <column name="value" index="3"/> | |
311 <filter type="param_value" ref="gmapindex" column="6"/> | |
312 <filter type="multiple_splitter" column="3" separator=","/> | |
313 <filter type="add_value" name="" value=""/> | |
314 <filter type="sort_by" column="3"/> | |
315 </options> | |
316 </param> | |
317 | |
318 <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase."> | |
319 <option value="">standard</option> | |
320 <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> | |
321 <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> | |
322 <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option> | |
323 <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option> | |
324 </param> | |
325 | |
326 <conditional name="use_splicing"> | |
327 <param name="src" type="select" label="<HR>Known Splicesite and Introns" | |
328 help="Look for splicing involving known sites or known introns at short or long distances | |
329 See README instructions for the distinction between known sites and known introns"> | |
330 <option value="none" selected="true">None</option> | |
331 <option value="gmapdb">From the GMAP Database</option> | |
332 <option value="history">A Map in your history</option> | |
333 </param> | |
334 <when value="none"/> | |
335 <when value="history"> | |
336 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" | |
337 help="built with GMAP IIT"/> | |
338 </when> | |
339 <when value="gmapdb"> | |
340 <param name="splicemap" type="select" data_ref="gmapindex" label="Use map for splicing involving known sites or known introns" help=""> | |
341 <options from_file="gmap_indices.loc"> | |
342 <column name="name" index="4"/> | |
343 <column name="value" index="4"/> | |
344 <filter type="param_value" ref="gmapindex" column="6"/> | |
345 <filter type="multiple_splitter" column="4" separator=","/> | |
346 <filter type="add_value" name="" value=""/> | |
347 <filter type="sort_by" column="4"/> | |
348 </options> | |
349 </param> | |
350 </when> | |
351 </conditional> | |
352 | |
353 <conditional name="use_snps"> | |
354 <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments"> | |
355 <option value="none" selected="true">None</option> | |
356 <option value="gmapdb">From the GMAP Database</option> | |
357 <option value="history">A SNP Index in your history</option> | |
358 </param> | |
359 <when value="none"/> | |
360 <when value="history"> | |
361 <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" | |
362 help="built with GMAP SNP Index"/> | |
363 </when> | |
364 <when value="gmapdb"> | |
365 <param name="snpindex" type="select" data_ref="gmapindex" label="Use database containing known SNPs" help=""> | |
366 <options from_file="gmap_indices.loc"> | |
367 <column name="name" index="5"/> | |
368 <column name="value" index="5"/> | |
369 <filter type="param_value" ref="gmapindex" column="6"/> | |
370 <filter type="multiple_splitter" column="5" separator=","/> | |
371 <filter type="add_value" name="" value=""/> | |
372 <filter type="sort_by" column="5"/> | |
373 </options> | |
374 </param> | |
375 </when> | |
376 </conditional> | |
377 | |
378 </when> | |
379 <when value="gmapdb"> | |
380 <param name="gmapdb" type="data" format="gmapdb" metadata_name="dbkey" label="Select a gmapdb" | |
381 help="A GMAP database built with GMAP Build"/> | |
382 <param name="kmer" type="select" data_ref="gmapdb" label="kmer size" help="Defaults to highest available kmer size"> | |
383 <options> | |
384 <filter type="data_meta" ref="gmapdb" key="kmers" multiple="True" separator=","/> | |
385 </options> | |
386 </param> | |
387 | |
388 <param name="mode" type="select" label="Alignment mode" help="Assumes cmetindex and atoiindex were run on the gmap datatbase."> | |
389 <option value="">standard</option> | |
390 <option value="cmet-stranded">cmet-stranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> | |
391 <option value="cmet-nonstranded">cmet-nonstranded for bisulfite-treated DNA reads (tolerance to C-to-T changes)</option> | |
392 <option value="atoi-stranded">atoi-stranded for RNA-editing tolerance (A-to-G changes)</option> | |
393 <option value="atoi-nonstranded">atoi-nonstranded for RNA-editing tolerance (A-to-G changes)</option> | |
394 </param> | |
395 | |
396 <conditional name="use_splicing"> | |
397 <param name="src" type="select" label="<HR>Known Splicesite and Introns" | |
398 help="Look for splicing involving known sites or known introns at short or long distances | |
399 See README instructions for the distinction between known sites and known introns"> | |
400 <option value="none" selected="true">None</option> | |
401 <option value="gmapdb">From the GMAP Database</option> | |
402 <option value="history">A Map in your history</option> | |
403 </param> | |
404 <when value="none"/> | |
405 <when value="history"> | |
406 <param name="splicemap" type="data" format="splicesites.iit,introns.iit" metadata_name="dbkey" label="Select a splicesite map" | |
407 help="built with GMAP IIT"/> | |
408 </when> | |
409 <when value="gmapdb"> | |
410 <param name="splicemap" type="select" data_ref="gmapdb" label="Use map for splicing involving known sites or known introns" help=""> | |
411 <options> | |
412 <filter type="data_meta" ref="gmapdb" key="maps" multiple="True"/> | |
413 </options> | |
414 </param> | |
415 </when> | |
416 </conditional> | |
417 | |
418 <conditional name="use_snps"> | |
419 <param name="src" type="select" label="<HR>Known SNPs" help="for SNP tolerant alignments"> | |
420 <option value="none" selected="true">None</option> | |
421 <option value="gmapdb">From the GMAP Database</option> | |
422 <option value="history">A SNP Index in your history</option> | |
423 </param> | |
424 <when value="none"/> | |
425 <when value="history"> | |
426 <param name="snpindex" type="data" format="gmapsnpindex" metadata_name="dbkey" label="Select a snpindex" | |
427 help="built with GMAP SNP Index"/> | |
428 </when> | |
429 <when value="gmapdb"> | |
430 <param name="snpindex" type="select" data_ref="gmapdb" label="Use database containing known SNPs" help=""> | |
431 <options> | |
432 <filter type="data_meta" ref="gmapdb" key="snps" multiple="True" separator=","/> | |
433 </options> | |
434 </param> | |
435 </when> | |
436 </conditional> | |
437 | |
438 </when> | |
439 </conditional> | |
440 | |
441 <!-- Computation options --> | |
442 <conditional name="computation"> | |
443 <param name="options" type="select" label="<HR>Computational Settings" help=""> | |
444 <option value="default">Use default settings</option> | |
445 <option value="advanced">Set Computation Options</option> | |
446 </param> | |
447 <when value="default"/> | |
448 <when value="advanced"> | |
449 <param name="max_mismatches" type="float" value="" optional="true" label="Maximum number of mismatches allowed (uses default when negative)" | |
450 help="Defaults to the ultrafast level of ((readlength+2)/12 - 2)). | |
451 If specified between 0.0 and 1.0, then treated as a fraction | |
452 of each read length. Otherwise, treated as an integral number | |
453 of mismatches (including indel and splicing penalties) | |
454 For RNA-Seq, you may need to increase this value slightly | |
455 to align reads extending past the ends of an exon."> | |
456 <validator type="in_range" message="The mismatches must >= 0." min="0."/> | |
457 </param> | |
458 <param name="query_unk_mismatch" type="boolean" checked="false" truevalue="--query-unk-mismatch=1" falsevalue="" label="Count unknown (N) characters in the query as a mismatch"/> | |
459 <param name="genome_unk_mismatch" type="boolean" checked="true" truevalue="" falsevalue="--genome-unk-mismatch=0" label="Count unknown (N) characters in the genome as a mismatch"/> | |
460 <param name="terminal_threshold" type="integer" value="" optional="true" label="Threshold for searching for a terminal alignment (default 3)" | |
461 help="(from one end of the read to the best possible position at the other end). To turn off terminal alignments, set this to a high value." /> | |
462 <param name="indel_penalty" type="integer" value="" optional="true" label="Penalty for an indel (default 2)" | |
463 help="Counts against mismatches allowed. To find indels, make indel-penalty less than or equal to max-mismatches. A value < 2 can lead to false positives at read ends" /> | |
464 <param name="indel_endlength" type="integer" value="" optional="true" label="Minimum length at end required for indel alignments (default 4)" /> | |
465 <param name="max_middle_insertions" type="integer" value="" optional="true" label="Maximum number of middle insertions allowed (default 9)" /> | |
466 <param name="max_middle_deletions" type="integer" value="" optional="true" label="Maximum number of middle deletions allowed (default 30)" /> | |
467 <param name="max_end_insertions" type="integer" value="" optional="true" label="Maximum number of end insertions allowed (default 3)" /> | |
468 <param name="max_end_deletions" type="integer" value="" optional="true" label="Maximum number of end deletions allowed (default 6)" /> | |
469 <param name="suboptimal_levels" type="integer" value="" optional="true" label="Report suboptimal hits beyond best hit (default 0)" | |
470 help="All hits with best score plus suboptimal-levels are reported" /> | |
471 <param name="adapter_strip" type="select" label="Method for removing adapters from reads" | |
472 help="paired removes adapters from paired-end reads if a concordant or paired alignment cannot be found from the original read"> | |
473 <option value="paired" selected="true">paired</option> | |
474 <option value="off">off</option> | |
475 </param> | |
476 <param name="trim_mismatch_score" type="integer" value="" optional="true" label="Score to use for mismatches when trimming at ends (default is -3)" | |
477 help="to turn off trimming, specify 0"/> | |
478 <param name="use_tally" type="data" format="tally.iit" optional="true" metadata_name="dbkey" label="Select a tally IIT file to resolve concordant multiple results" | |
479 help="generated by gsnap_tally and iit_store"/> | |
480 | |
481 <!-- | |
482 tallydir=STRING Directory for tally IIT file to resolve concordant multiple results (default is | |
483 location of genome index files specified using -D and -d). Note: can | |
484 just give full path name to use-tally instead. | |
485 use-tally=STRING Use this tally IIT file to resolve concordant multiple results | |
486 runlengthdir=STRING Directory for runlength IIT file to resolve concordant multiple results (default is | |
487 location of genome index files specified using -D and -d). Note: can | |
488 just give full path name to use-runlength instead. | |
489 use-runlength=STRING Use this runlength IIT file to resolve concordant multiple results | |
490 --> | |
491 | |
492 <!-- Options for GMAP alignment within GSNAP --> | |
493 <param name="gmap_mode" type="select" multiple="true" optional="true" display="checkboxes" label="Cases to use GMAP for complex alignments containing multiple splices or indels" | |
494 help="Default: pairsearch,terminal,improve"> | |
495 <option value="pairsearch" selected="true">pairsearch</option> | |
496 <option value="terminal" selected="true">terminal</option> | |
497 <option value="improve" selected="true">improve</option> | |
498 </param> | |
499 <param name="trigger_score_for_gmap" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 5)" | |
500 help="Try GMAP pairsearch on nearby genomic regions if best score (the total of both ends if paired-end) exceeds this value (default 5)" /> | |
501 <param name="max_gmap_pairsearch" type="integer" value="" optional="true" label="GMAP pairsearch threshold (default 3)" | |
502 help="Perform GMAP pairsearch on nearby genomic regions up to this many candidate ends (default 3)." /> | |
503 <param name="max_gmap_terminal" type="integer" value="" optional="true" label="GMAP terminal threshold (default 3)" | |
504 help="Perform GMAP terminal on nearby genomic regions up to this many candidate ends (default 3)." /> | |
505 <param name="max_gmap_improvement" type="integer" value="" optional="true" label="GMAP improvement threshold (default 3)" | |
506 help="Perform GMAP improvement on nearby genomic regions up to this many candidate ends (default 3)." /> | |
507 <param name="microexon_spliceprob" type="float" value="" optional="true" label="GMAP microexons threshold (default .90)" | |
508 help="Allow microexons only if one of the splice site probabilities is greater than this value." > | |
509 <validator type="in_range" message="The microexons probability must be between 0. and 1." min="0." max="1."/> | |
510 </param> | |
511 </when> | |
512 </conditional> | |
513 | |
514 <conditional name="splicing"> | |
515 <param name="options" type="select" label="<HR>Splicing options for RNA-Seq" help=""> | |
516 <option value="default">Use default settings</option> | |
517 <option value="advanced">Set Splicing Options</option> | |
518 </param> | |
519 <when value="default"/> | |
520 <when value="advanced"> | |
521 <!-- Splicing options for RNA-Seq --> | |
522 <!-- use-splicing This should be either a select list from the gmapdb maps or a data type using splicesdir and use-splicing --> | |
523 <!-- Neither novel splicing (-N) nor known splicing (-s) turned on => assume reads are DNA-Seq (genomic) --> | |
524 <param name="novelsplicing" type="boolean" checked="false" truevalue="--novelsplicing=1" falsevalue="" label="Look for novel splicing "/> | |
525 <param name="localsplicedist" type="integer" value="" optional="true" label="Definition of local novel splicing event (default 200000)"/> | |
526 <param name="local_splice_penalty" type="integer" value="" optional="true" label="Penalty for a local splice (default 0). Counts against mismatches allowed"/> | |
527 <param name="distant_splice_penalty" type="integer" value="" optional="true" label="Penalty for a distant splice (default 3). Counts against mismatches allowed" | |
528 help="A distant splice is one where the intron length exceeds the value of localsplicedist or is an | |
529 inversion, scramble, or translocation between two different chromosomes. Counts against mismatches allowed"/> | |
530 <param name="distant_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for distant spliced alignments" | |
531 help="(default 16, min is the kmer length)"/> | |
532 <param name="shortend_splice_endlength" type="integer" value="" optional="true" label="Minimum length at end required for short-end spliced alignments" | |
533 help="(default 2, but unless known splice sites are provided, GSNAP may still need the end length to be the value of kmer size to find a given splice"/> | |
534 <param name="distant_splice_identity" type="float" value="" optional="true" label="Minimum identity at end required for distant spliced alignments (default 0.95)"/> | |
535 <param name="antistranded_penalty" type="integer" value="" optional="true" label="Penalty for antistranded splicing when using stranded RNA-Seq protocols" | |
536 help="A positive value, such as 1, expects antisense on the first read and sense on the second read. | |
537 Default is 0, which treats sense and antisense equally well"/> | |
538 </when> | |
539 </conditional> | |
540 | |
541 <!-- Output data --> | |
542 <conditional name="output"> | |
543 <param name="options" type="select" label="<HR><H2>Output</H2>Output options for RNA-Seq" help=""> | |
544 <option value="default">Use default settings</option> | |
545 <option value="advanced">Set Output Options</option> | |
546 </param> | |
547 <when value="default"/> | |
548 <when value="advanced"> | |
549 <param name="npath" type="integer" value="" optional="true" label="Maximum number of paths to print (default 100)"/> | |
550 <param name="quiet_if_excessive" type="boolean" checked="false" truevalue="--quiet-if-excessive" falsevalue="" label="Quiet if Excessive" | |
551 help="If more than maximum number of paths are found, then nothing is printed."/> | |
552 <param name="show_refdiff" type="boolean" checked="false" truevalue="--show-refdiff" falsevalue="" label="Show SNP-tolerant alignment" | |
553 help="For GSNAP output in SNP-tolerant alignment, shows all differences relative to the reference genome as lower case (otherwise, it shows all differences relative to both the reference and alternate genome)"/> | |
554 <param name="clip_overlap" type="boolean" checked="false" truevalue="--clip-overlap" falsevalue="" label="Clip Overlap" | |
555 help="For paired-end reads whose alignments overlap, clip the overlapping region."/> | |
556 </when> | |
557 </conditional> | |
558 <conditional name="result"> | |
559 <param name="format" type="select" label="Select the output format" help=""> | |
560 <option value="sam">SAM</option> | |
561 <!-- goby should only be an option if the input is in goby format | |
562 <option value="goby">Goby</option> | |
563 --> | |
564 <option value="gsnap">GSNAP default output</option> | |
565 </param> | |
566 <when value="gsnap"> | |
567 </when> | |
568 <when value="sam"> | |
569 <param name="no_sam_headers" type="boolean" truevalue="--no-sam-headers" falsevalue="" checked="false" label="Do not print headers beginning with '@'"/> | |
570 <param name="read_group_id" type="text" value="" optional="true" label="Value to put into read-group id (RG-ID) field"/> | |
571 <param name="read_group_name" type="text" value="" optional="true" label="Value to put into read-group name (RG-SM) field"/> | |
572 <param name="read_group_library" type="text" value="" optional="true" label="Value to put into read-group library (RG-LB) field"/> | |
573 <param name="read_group_platform" type="text" value="" optional="true" label="Value to put into read-group library platform (RG-PL) field"/> | |
574 <param name="quality_shift" type="integer" value="" optional="true" label="Shift FASTQ quality scores by this amount in SAM output (default -31)"/> | |
575 </when> | |
576 <!-- | |
577 <when value="goby"> | |
578 <param name="goby_output" type="text" value="" label="Basename for Goby output files"/> | |
579 <param name="creads_window_start" type="integer" value="" optional="true" label="Compact reads window start (default: 0=start of file)"/> | |
580 <param name="creads_window_end" type="integer" value="" optional="true" label="Compact reads window end (default: 0=end of file)"/> | |
581 <param name="creads_complement" type="boolean" truevalue="-\-creads-complement" falsevalue="" checked="false" label="Complement read sequences (without reversing)"/> | |
582 </when> | |
583 --> | |
584 </conditional> | |
585 <!-- TODO combine fails and split_output --> | |
586 | |
587 <conditional name="results"> | |
588 <param name="split_output" type="select" label="<HR>Split outputs" | |
589 help="Separate outputs for: nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, and concordant_mult results"> | |
590 <option value="no">no</option> | |
591 <option value="yes">yes</option> | |
592 </param> | |
593 <when value="no"> | |
594 <conditional name="fails"> | |
595 <param name="choice" type="select" label="How to deal with fails" help=""> | |
596 <option value="default">default - include them in results</option> | |
597 <option value="nofails">nofails - exclude fails from results</option> | |
598 <option value="failsonly">failsonly - only output failing results</option> | |
599 </param> | |
600 <when value="default"/> | |
601 <when value="nofails"/> | |
602 <when value="failsonly"> | |
603 <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format" | |
604 help=""/> | |
605 </when> | |
606 </conditional> | |
607 </when> | |
608 <when value="yes"> | |
609 <conditional name="fails"> | |
610 <param name="choice" type="select" label="How to deal with fails" help=""> | |
611 <option value="default">default - include them in results</option> | |
612 <option value="nofails">nofails - exclude fails from results</option> | |
613 <option value="failsonly">failsonly - only output failing results</option> | |
614 </param> | |
615 <when value="default"/> | |
616 <when value="nofails"/> | |
617 <when value="failsonly"/> | |
618 </conditional> | |
619 <param name="fails_as_input" type="boolean" truevalue="--fails-as-input" falsevalue="" checked="false" label="Print completely failed alignments as input FASTA or FASTQ format" | |
620 help=""/> | |
621 </when> | |
622 </conditional> | |
623 | |
624 </inputs> | |
625 <outputs> | |
626 <data format="txt" name="gsnap_stderr" label="${tool.name} on ${on_string}: gsnap.log"/> | |
627 | |
628 <data format="txt" name="gsnap_out" label="${tool.name} on ${on_string} ${result.format}" > | |
629 <filter>(results['split_output'] == 'no' and (results['fails']['choice'] != 'failsonly' or results['fails']['fails_as_input'] == False))</filter> | |
630 <change_format> | |
631 <when input="result['format']" value="sam" format="sam"/> | |
632 <when input="result['format']" value="gsnap" format="gsnap"/> | |
633 </change_format> | |
634 </data> | |
635 | |
636 <data format="fastq" name="gsnap_fq" label="${tool.name} on ${on_string} fails.fq" > | |
637 <filter>(results['split_output'] == 'no' and results['fails']['choice'] == 'failsonly' and results['fails']['fails_as_input'] == True)</filter> | |
638 </data> | |
639 | |
640 <!-- nomapping, halfmapping_uniq, halfmapping_mult, unpaired_uniq, unpaired_mult, paired_uniq, paired_mult, concordant_uniq, concordant_mult --> | |
641 | |
642 <data format="txt" name="unpaired_mult" label="${tool.name} on ${on_string} unpaired_mult.${result.format}" from_work_dir="gsnap_out.unpaired_mult"> | |
643 <filter>(results['split_output'] == 'yes')</filter> | |
644 <change_format> | |
645 <when input="result['format']" value="sam" format="sam"/> | |
646 <when input="result['format']" value="gsnap" format="gsnap"/> | |
647 </change_format> | |
648 </data> | |
649 <data format="txt" name="unpaired_uniq" label="${tool.name} on ${on_string} unpaired_uniq.${result.format}" from_work_dir="gsnap_out.unpaired_uniq"> | |
650 <filter>(results['split_output'] == 'yes')</filter> | |
651 <change_format> | |
652 <when input="result['format']" value="sam" format="sam"/> | |
653 <when input="result['format']" value="gsnap" format="gsnap"/> | |
654 </change_format> | |
655 </data> | |
656 <data format="txt" name="unpaired_transloc" label="${tool.name} on ${on_string} unpaired_transloc.${result.format}" from_work_dir="gsnap_out.unpaired_transloc"> | |
657 <filter>(results['split_output'] == 'yes')</filter> | |
658 <change_format> | |
659 <when input="result['format']" value="sam" format="sam"/> | |
660 <when input="result['format']" value="gsnap" format="gsnap"/> | |
661 </change_format> | |
662 </data> | |
663 <data format="txt" name="halfmapping_mult" label="${tool.name} on ${on_string} halfmapping_mult.${result.format}" from_work_dir="gsnap_out.halfmapping_mult"> | |
664 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
665 <change_format> | |
666 <when input="result['format']" value="sam" format="sam"/> | |
667 <when input="result['format']" value="gsnap" format="gsnap"/> | |
668 </change_format> | |
669 </data> | |
670 <data format="txt" name="halfmapping_uniq" label="${tool.name} on ${on_string} halfmapping_uniq.${result.format}" from_work_dir="gsnap_out.halfmapping_uniq"> | |
671 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
672 <change_format> | |
673 <when input="result['format']" value="sam" format="sam"/> | |
674 <when input="result['format']" value="gsnap" format="gsnap"/> | |
675 </change_format> | |
676 </data> | |
677 <data format="txt" name="halfmapping_transloc" label="${tool.name} on ${on_string} halfmapping_transloc.${result.format}" from_work_dir="gsnap_out.halfmapping_transloc"> | |
678 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
679 <change_format> | |
680 <when input="result['format']" value="sam" format="sam"/> | |
681 <when input="result['format']" value="gsnap" format="gsnap"/> | |
682 </change_format> | |
683 </data> | |
684 <data format="txt" name="paired_mult" label="${tool.name} on ${on_string} paired_mult.${result.format}" from_work_dir="gsnap_out.paired_mult"> | |
685 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
686 <change_format> | |
687 <when input="result['format']" value="sam" format="sam"/> | |
688 <when input="result['format']" value="gsnap" format="gsnap"/> | |
689 </change_format> | |
690 </data> | |
691 <data format="txt" name="paired_uniq" label="${tool.name} on ${on_string} paired_uniq.${result.format}" from_work_dir="gsnap_out.paired_uniq"> | |
692 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
693 <change_format> | |
694 <when input="result['format']" value="sam" format="sam"/> | |
695 <when input="result['format']" value="gsnap" format="gsnap"/> | |
696 </change_format> | |
697 </data> | |
698 <data format="txt" name="paired_transloc" label="${tool.name} on ${on_string} paired_transloc.${result.format}" from_work_dir="gsnap_out.paired_transloc"> | |
699 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
700 <change_format> | |
701 <when input="result['format']" value="sam" format="sam"/> | |
702 <when input="result['format']" value="gsnap" format="gsnap"/> | |
703 </change_format> | |
704 </data> | |
705 | |
706 <data format="txt" name="concordant_mult" label="${tool.name} on ${on_string} concordant_mult.${result.format}" from_work_dir="gsnap_out.concordant_mult"> | |
707 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
708 <change_format> | |
709 <when input="result['format']" value="sam" format="sam"/> | |
710 <when input="result['format']" value="gsnap" format="gsnap"/> | |
711 </change_format> | |
712 </data> | |
713 <data format="txt" name="concordant_uniq" label="${tool.name} on ${on_string} concordant_uniq.${result.format}" from_work_dir="gsnap_out.concordant_uniq"> | |
714 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
715 <change_format> | |
716 <when input="result['format']" value="sam" format="sam"/> | |
717 <when input="result['format']" value="gsnap" format="gsnap"/> | |
718 </change_format> | |
719 </data> | |
720 <data format="txt" name="concordant_transloc" label="${tool.name} on ${on_string} concordant_transloc.${result.format}" from_work_dir="gsnap_out.concordant_transloc"> | |
721 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
722 <change_format> | |
723 <when input="result['format']" value="sam" format="sam"/> | |
724 <when input="result['format']" value="gsnap" format="gsnap"/> | |
725 </change_format> | |
726 </data> | |
727 | |
728 <data format="txt" name="nomapping" label="${tool.name} on ${on_string} nomapping.${result.format}" from_work_dir="gsnap_out.nomapping"> | |
729 <filter>(results['split_output'] == 'yes' and results['fails_as_input'] == False)</filter> | |
730 <change_format> | |
731 <when input="result['format']" value="sam" format="sam"/> | |
732 <when input="result['format']" value="gsnap" format="gsnap"/> | |
733 </change_format> | |
734 </data> | |
735 | |
736 <data format="fastq" name="nomapping_fq" label="${tool.name} on ${on_string} nomapping.fq" from_work_dir="gsnap_out.nomapping.fq"> | |
737 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == False)</filter> | |
738 </data> | |
739 | |
740 <data format="fastq" name="nomapping_1_fq" label="${tool.name} on ${on_string} nomapping.1.fq" from_work_dir="gsnap_out.nomapping.1.fq"> | |
741 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
742 </data> | |
743 | |
744 <data format="fastq" name="nomapping_2_fq" label="${tool.name} on ${on_string} nomapping.2.fq" from_work_dir="gsnap_out.nomapping.2.fq"> | |
745 <filter>(results['split_output'] == 'yes' and seq['format'] == 'fastq' and seq['paired']['ispaired'] == True)</filter> | |
746 </data> | |
747 | |
748 <!-- Will problay need wrapper code to generate composite datatype for goby alignment | |
749 <data format="gobyalignment" name="goby_alignment" label="${tool.name} on ${on_string} uniq.${result.format}" from_work_dir="gsnap_out.nomapping"> | |
750 <filter>result['format'] == 'goby'</filter> | |
751 </data> | |
752 --> | |
753 | |
754 </outputs> | |
755 <tests> | |
756 </tests> | |
757 | |
758 <help> | |
759 | |
760 **What it does** | |
761 | |
762 GSNAP_ (Genomic Short-read Nucleotide Alignment Program) is a short read aligner which can align both single- and paired-end reads as short as 14nt and of arbitrarily long length. It can detect short- and long-distance splicing, including interchromosomal splicing, in individual reads, using probabilistic models or a database of known splice sites. Our program also permits SNP-tolerant alignment to a reference space of all possible combinations of major and minor alleles, and can align reads from bisulfite-treated DNA for the study of methylation state. It is developed by Thomas D. Wu of Genentech, Inc. | |
763 Publication_ citation: Thomas D. Wu, Serban Nacu "Fast and SNP-tolerant detection of complex variants and splicing in short reads. Bioinformatics. 2010 Apr 1;26(7):873-81. Epub 2010 Feb 10. | |
764 | |
765 .. _GSNAP: http://research-pub.gene.com/gmap/ | |
766 .. _Publication: http://bioinformatics.oupjournals.org/cgi/content/full/26/7/873 | |
767 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2844994/?tool=pubmed | |
768 | |
769 ------ | |
770 | |
771 **Know what you are doing** | |
772 | |
773 .. class:: warningmark | |
774 | |
775 You will want to read the README_ | |
776 | |
777 .. _README: http://research-pub.gene.com/gmap/src/README | |
778 | |
779 ------ | |
780 | |
781 **Input formats** | |
782 | |
783 Input to GSNAP should be either in FASTQ or FASTA format. | |
784 | |
785 The FASTQ input may include quality scores, which will then be included in SAM | |
786 output, if that output format is selected. | |
787 | |
788 For FASTA format, you should include one line per read (or end of a | |
789 paired-end read). The same FASTA file can have a mixture of | |
790 single-end and paired-end reads of varying lengths, if desired. | |
791 | |
792 Single-end reads: | |
793 | |
794 Each FASTA entry should contain one short read per line, like this | |
795 | |
796 >Header information | |
797 AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA | |
798 | |
799 Each short read can have a different length. However, the entire read | |
800 needs to be on a single line, and may not wrap around multiple lines. | |
801 If it extends to a second line, GSNAP will think that the read is | |
802 paired-end. | |
803 | |
804 | |
805 Paired-end reads: | |
806 | |
807 Each FASTA entry should contain two short reads, one per line, like | |
808 this | |
809 | |
810 >Header information | |
811 AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA | |
812 GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG | |
813 | |
814 By default, the program assumes that the second end is in the reverse | |
815 complement direction compared with the first end. If they are in the | |
816 same direction, you may need to use the --circular-input (or -c) flag. | |
817 | |
818 ( The Galaxy tool: "FASTA Width formatter" can be used to reformat fasta files to have single line sequences. ) | |
819 | |
820 ------ | |
821 | |
822 **Output formats in GSNAP** | |
823 | |
824 SAM output format | |
825 | |
826 Default GSNAP format | |
827 See the README_ | |
828 | |
829 | |
830 | |
831 | |
832 </help> | |
833 </tool> | |
834 |