Mercurial > repos > mheinzl > fsd_bvsa

comparison fsd_beforevsafter.xml @ 2:e8115b71edbd draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_beforevsafter commit b9403b3ce2b7a41fa8ee1aa47909152de78cf641
author mheinzl
date Tue, 15 May 2018 13:50:02 -0400
parents 6ed6dca9488f
children 327c40a821ed
comparison
equal deleted inserted replaced
1:6ed6dca9488f 2:e8115b71edbd
1 <?xml version="1.0" encoding="UTF-8"?> 1 <?xml version="1.0" encoding="UTF-8"?>
2 <tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis:" version="0.0.2"> 2 <tool id="fsd_beforevsafter" name="Duplex Sequencing Analysis:" version="0.0.3">
3 <requirements> 3 <requirements>
4 <!-- galaxy version 16.04 --> 4 <!-- galaxy version 16.04 -->
5 <requirement type="package" version="2.7">python</requirement> 5 <requirement type="package" version="2.7">python</requirement>
6 <requirement type="package" version="1.4">matplotlib</requirement> 6 <requirement type="package" version="1.4">matplotlib</requirement>
7 <requirement type="package" version="1.7">biopython</requirement> 7 <requirement type="package" version="1.7">biopython</requirement>
8 8
9 </requirements> 9 </requirements>
10 <description>Family size distribution (FSD) of tags from various steps of the Du Novo pipeline</description> 10 <description>Family size distribution (FSD) of tags from various steps of the Du Novo pipeline</description>
11 <command> 11 <command>
12 python2 $__tool_directory__/fsd_beforevsafter.py --inputFile_SSCS "$file1" --makeDCS "$makeDCS" --afterTrimming "$afterTrimming" --alignedTags "$alignedTags" --sep $separator --output_csv $output_csv --output_pdf $output_pdf 12 python2 $__tool_directory__/fsd_beforevsafter.py --inputFile_SSCS "$file1" --inputName1 "$file1.name" --makeDCS "$makeDCS" --afterTrimming "$afterTrimming" --alignedTags "$alignedTags" --sep $separator --output_pdf $output_pdf --output_csv $output_csv
13 </command> 13 </command>
14 <inputs> 14 <inputs>
15 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> 15 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/>
16 <param name="makeDCS" type="data" format="fasta" label="Dataset 2: tags after making DCSs" help="Input in fasta format with the tags of the reads, which were aligned to DCSs, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next line."/> 16 <param name="makeDCS" type="data" format="fasta" label="Dataset 2: tags after making DCSs" help="Input in fasta format with the tags of the reads, which were aligned to DCSs, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next line."/>
17 <param name="afterTrimming" type="data" format="fasta" optional="true" label="Dataset 3: tags after trimming" help="Input in fasta format with the tags of the reads, which were not filtered out after trimming, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next following line."/> 17 <param name="afterTrimming" type="data" format="fasta" optional="true" label="Dataset 3: tags after trimming" help="Input in fasta format with the tags of the reads, which were not filtered out after trimming, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next following line."/>
56 | CNCNGGCCCCCCGCTCCGTGCACAGACGNNGCNACTGACAA | 56 | CNCNGGCCCCCCGCTCCGTGCACAGACGNNGCNACTGACAA |
57 +-------------------------------------------+ 57 +-------------------------------------------+
58 58
59 59
60 60
61
61 **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from a different tool. 62 **Dataset 4 (optional):** Finally, a TXT file with the regions and all tags that were aligned to the reference genome can be given as input. This file can obtained from a different tool.
62 63
63 +-----------+------------------------------+ 64 +-----------+------------------------------+
64 | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT | 65 | 87_636 | AAATCAAAGTATGAATGAAGTTGCCT |
65 +-----------+------------------------------+ 66 +-----------+------------------------------+