<?xml version="1.0" encoding="UTF-8"?>
<tool id="fsd_beforevsafter" name="FSD Before/After" version="1.0.1">
    <description>: Family Size Distribution of duplex sequecning tags during DuNovo analysis</description>
    <requirements>
		<!-- galaxy version 16.04 -->
        <requirement type="package" version="2.7">python</requirement>
        <requirement type="package" version="1.4">matplotlib</requirement>
        <requirement type="package" version="1.71">biopython</requirement>
    </requirements>
    <command>
        python2 '$__tool_directory__/fsd_beforevsafter.py' --inputFile_SSCS '$file1' --inputName1 '$file1.name' --makeDCS '$makeDCS' --afterTrimming '$afterTrimming' --bamFile '$bamFile' --output_pdf $output_pdf --output_tabular $output_tabular
    </command>
    <inputs>
        <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/>
        <param name="makeDCS" type="data" format="fasta" label="Dataset 2: tags after making DCSs" help="Input in fasta format with the tags of the reads, which were aligned to DCSs, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next line."/>
        <param name="afterTrimming" type="data" format="fasta" optional="true" label="Dataset 3: tags after trimming" help="Input in fasta format with the tags of the reads, which were not filtered out after trimming, and their family sizes of both strands (reverse and forward) in the header, as well as the read itself in the next following line."/>
        <param name="bamFile" type="data" format="bam" optional="true" label="Dataset 4: input tags aligned to the reference genome" help="Input in BAM format with the reads that were aligned to the reference genome."/>
    </inputs>
    <outputs>
        <data name="output_pdf" format="pdf" />
        <data name="output_tabular" format="tabular"/>
    </outputs>
    <tests>
        <test>
            <param name="file1" value="fsd_ba_data.tab"/>
            <param name="makeDCS" value="fsd_ba_DCS.fna"/>
            <param name="afterTrimming" value="fsd_ba_trimmed.fna"/>
            <param name="bamFile" value="fsd_ba.bam"/>
            <output name="output_pdf" file="fsd_ba_output.pdf" lines_diff="183"/>
            <output name="output_tabular" file="fsd_ba_output.tab"/>
        </test>
    </tests>
    <help><![CDATA[

**What it does**
        
This tool will create a distribution of family sizes of various datasets obtained from different steps of the Du Novo pipeline. 

-----
               
**Input**
        
**Dataset 1:** This tools expects a tabular file with the tags of all families, their sizes and information about forward (ab) and reverse (ba) strands.:: 

      1  AAAAAAAAAAAATGTTGGAATCTT ba
     10  AAAAAAAAAAAGGCGGTCCACCCC ab
     28  AAAAAAAAAAATGGTATGGACCGA ab
          
**Dataset 2:** A fasta file with all tags and their family sizes of both strands (forward and reverse) in the header and the read itself in the next line is required. This input file can be obtained by the tool "Du Novo: make consensus reads". 
    
**Dataset 3 (optional):** In addition, the fasta file with all tags, which were not filtered out after trimming, can be given. This file can be obtained by the tool "Sequence Content Trimmer".
For both input files, only one file from both tools are necessary (these tools give for both forward and reverse strands an output file), since both files have the same tags and family sizes, but different reads, which are not required in this tool::
 
  >AAAAAAAAATAGATCATAGACTCT 7-10
  CTAGACTCACTGGCGTTACTGACTGCGAGACCCTCCACGTG
  >AAAAAAAAGGCAGAAGATATACGC 11-3
  CNCNGGCCCCCCGCTCCGTGCACAGACGNNGCNACTGACAA
	
**Dataset 4 (optional):** BAM file of the aligned reads. This file can be obtained by the tool "Map with BWA-MEM".	

**Output**
        
The output is a PDF file with the plot and a tabular file with the data of the plot.
         
**About Author**
        
Author: Monika Heinzl
    
Department: Institute of Bioinformatics, Johannes Kepler University Linz, Austria
    
Contact: monika.heinzl@edumail.at
        
        ]]> 

    </help>
    <citations>
        <citation type="bibtex">
            @misc{duplex,
            author = {Heinzl, Monika},
            year = {2018},
            title = {Development of algorithms for the analysis of duplex sequencing data}
         }
        </citation>
    </citations>
</tool>