Mercurial > repos > mheinzl > fsd_regions

comparison fsd_regions.xml @ 4:b202c97deabe draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/duplexanalysis_galaxy/tree/master/tools/fsd_regions commit dfaab79252a858e8df16bbea3607ebf1b6962e5a
author mheinzl
date Mon, 08 Oct 2018 05:53:50 -0400
parents 85d870b8ae92
children eabfdc012d7b
comparison
equal deleted inserted replaced
3:85d870b8ae92 4:b202c97deabe
1 <?xml version="1.0" encoding="UTF-8"?> 1 <?xml version="1.0" encoding="UTF-8"?>
2 <tool id="fsd_regions" name="Duplex Sequencing Analysis: fsd_regions" version="0.0.4"> 2 <tool id="fsd_regions" name="Duplex Sequencing Analysis: fsd_regions" version="1.0.0">
3 <description>Family size distribution (FSD) of user-specified regions in the reference genome</description>
3 <requirements> 4 <requirements>
4 <requirement type="package" version="2.7">python</requirement> 5 <requirement type="package" version="2.7">python</requirement>
5 <requirement type="package" version="1.4">matplotlib</requirement> 6 <requirement type="package" version="1.4.0">matplotlib</requirement>
6 </requirements> 7 </requirements>
7 <description>Family size distribution (FSD) of user-specified regions</description>
8 <command> 8 <command>
9 python2 $__tool_directory__/fsd_regions.py --inputFile "$file1" --inputName1 "$file1.name" --ref_genome "$file2" --sep $separator --output_pdf $output_pdf --output_csv $output_csv 9 python2 '$__tool_directory__/fsd_regions.py' --inputFile '$file1' --inputName1 '$file1.name' --ref_genome '$file2' --output_pdf $output_pdf --output_tabular $output_tabular
10 </command> 10 </command>
11 <inputs> 11 <inputs>
12 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/> 12 <param name="file1" type="data" format="tabular" label="Dataset 1: input tags of whole dataset" optional="false" help="Input in tabular format with the family size, tags and the direction of the strand ('ab' or 'ba') for each family."/>
13 <param name="file2" type="data" format="txt" label="Dataset 2: input tags aligned to the reference genome" help="Input in txt format with the regions and the tags, which were aligned to the reference genome."/> 13 <param name="file2" type="data" format="txt" label="Dataset 2: input tags aligned to the reference genome" help="Input in txt format with the regions in the reference genome and the tags, which were aligned to the reference genome."/>
14 <param name="separator" type="text" label="Separator of the CSV file." help="can be a single character" value=","/>
15 </inputs> 14 </inputs>
16 <outputs> 15 <outputs>
17 <data name="output_pdf" format="pdf" /> 16 <data name="output_pdf" format="pdf" />
18 <data name="output_csv" format="csv"/> 17 <data name="output_tabular" format="tabular"/>
19 </outputs> 18 </outputs>
19 <tests>
20 <test>
21 <param name="file1" value="Test_data.tabular"/>
22 <param name="file2" value="Test_data_regions.txt"/>
23 <output name="output_pdf" file="output_file.pdf" lines_diff="136"/>
24 <output name="output_tabular" file="output_file.tabular"/>
25 </test>
26 </tests>
20 <help> <![CDATA[ 27 <help> <![CDATA[
21 28
22 **What it does** 29 **What it does**
23 30
24 This tool will create a distribution of family sizes of all tags, which were aligned to the reference genome. The distribution is separated after the regions of the reference genome. 31 This tool will create a distribution of family sizes of all tags, which were aligned to the reference genome. The distribution is separated after the regions of the reference genome.
47 | 656_1143 | GGGGCAGCCATATTGGCAATTATCAT | 54 | 656_1143 | GGGGCAGCCATATTGGCAATTATCAT |
48 +-----------+------------------------------+ 55 +-----------+------------------------------+
49 56
50 **Output** 57 **Output**
51 58
52 The output is a PDF file with the plot and a CSV with the data of the plot. 59 The output is a PDF file with the plot and a tabular file with the data of the plot.
53 60
54 61
55 **About Author** 62 **About Author**
56 63
57 Author: Monika Heinzl 64 Author: Monika Heinzl