Mercurial > repos > mheinzl > fsd_regions

diff fsd_regions.xml @ 2:2631864873d7 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/monikaheinzl/galaxyProject/tree/master/tools/fsd_regions commit 29bc65d5627553741c83ce1f298223e2b266f7c8
author mheinzl
date Tue, 15 May 2018 14:21:41 -0400
parents 9ce2b4089c1b
children 85d870b8ae92
line wrap: on
line diff
--- a/fsd_regions.xml	Tue May 15 13:50:29 2018 -0400
+++ b/fsd_regions.xml	Tue May 15 14:21:41 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version="1.0" encoding="UTF-8"?>
-<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.2">
+<tool id="fsd_regions" name="Duplex Sequencing Analysis:" version="0.0.3">
     <requirements>
         <requirement type="package" version="2.7">python</requirement>
         <requirement type="package" version="1.4">matplotlib</requirement>
@@ -37,7 +37,7 @@
     +-----+----------------------------+----+
     
     
-	In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required. 	This file can obtained from a different tool.
+    In addition, a TXT file with the regions and all tags that were aligned to the reference genome is required.      This file can obtained from a different tool.
     
     +-----------+------------------------------+
     | 87_636    | AAATCAAAGTATGAATGAAGTTGCCT   |