Mercurial > repos > mheinzl > variant_analyzer2
annotate read2mut.py @ 34:d5e725905448 draft
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
| author | mheinzl |
|---|---|
| date | Wed, 24 Feb 2021 11:05:26 +0000 |
| parents | deae1eb387e1 |
| children | 3a915683e6a0 |
| rev | line source |
|---|---|
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
1 #!/usr/bin/env python |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
2 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
3 """read2mut.py |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
4 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
5 Author -- Gundula Povysil |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
6 Contact -- povysil@bioinf.jku.at |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
7 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
8 Looks for reads with mutation at known |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
9 positions and calculates frequencies and stats. |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
10 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
11 ======= ========== ================= ================================ |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
12 Version Date Author Description |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
13 2.0.0 2020-10-30 Gundula Povysil - |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
14 ======= ========== ================= ================================ |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
15 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
16 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim5 10 --trim3 10 --chimera_correction |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
20 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
21 """ |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
22 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
23 from __future__ import division |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
24 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
25 import argparse |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
26 import csv |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
27 import json |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
28 import operator |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
29 import os |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
30 import re |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
31 import sys |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
32 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
33 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
34 import numpy as np |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
35 import pysam |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
36 import xlsxwriter |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
37 from cyvcf2 import VCF |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
38 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
39 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
40 def make_argparser(): |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
41 parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
42 parser.add_argument('--mutFile', |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
43 help='VCF file with DCS mutations.') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
44 parser.add_argument('--bamFile', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
45 help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).') |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
46 parser.add_argument('--inputJson', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
47 help='JSON file with data collected by mut2read.py.') |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
48 parser.add_argument('--sscsJson', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
49 help='JSON file with SSCS counts collected by mut2sscs.py.') |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
50 parser.add_argument('--outputFile', |
|
12
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
51 help='Output xlsx file with summary of mutations.') |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
52 parser.add_argument('--outputFile_csv', |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
53 help='Output csv file with summary of mutations.') |
|
12
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
54 parser.add_argument('--outputFile2', |
|
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
55 help='Output xlsx file with allele frequencies of mutations.') |
|
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
56 parser.add_argument('--outputFile3', |
|
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
57 help='Output xlsx file with examples of the tier classification.') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
58 parser.add_argument('--thresh', type=int, default=0, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
59 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.') |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
60 parser.add_argument('--phred', type=int, default=20, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
61 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.') |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
62 parser.add_argument('--trim5', type=int, default=10, |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
63 help='Integer threshold for assigning mutations at start of reads to lower tier. Default 10.') |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
64 parser.add_argument('--trim3', type=int, default=10, |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
65 help='Integer threshold for assigning mutations at end of reads to lower tier. Default 10.') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
66 parser.add_argument('--chimera_correction', action="store_true", |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
67 help='Count chimeric variants and correct the variant frequencies') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
68 return parser |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
69 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
70 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
71 def safe_div(x, y): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
72 if y == 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
73 return None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
74 return x / y |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
75 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
76 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
77 def read2mut(argv): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
78 parser = make_argparser() |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
79 args = parser.parse_args(argv[1:]) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
80 file1 = args.mutFile |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
81 file2 = args.bamFile |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
82 json_file = args.inputJson |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
83 sscs_json = args.sscsJson |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
84 outfile = args.outputFile |
|
12
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
85 outfile2 = args.outputFile2 |
|
7a418148319d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
11
diff
changeset
|
86 outfile3 = args.outputFile3 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
87 outputFile_csv = args.outputFile_csv |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
88 thresh = args.thresh |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
89 phred_score = args.phred |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
90 trim5 = args.trim5 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
91 trim3 = args.trim3 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
92 chimera_correction = args.chimera_correction |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
93 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
94 if os.path.isfile(file1) is False: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
95 sys.exit("Error: Could not find '{}'".format(file1)) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
96 if os.path.isfile(file2) is False: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
97 sys.exit("Error: Could not find '{}'".format(file2)) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
98 if os.path.isfile(json_file) is False: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
99 sys.exit("Error: Could not find '{}'".format(json_file)) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
100 if thresh < 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
101 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh)) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
102 if phred_score < 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
103 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score)) |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
104 if trim5 < 0: |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
105 sys.exit("Error: trim5 is '{}', but only non-negative integers allowed".format(trim5)) |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
106 if trim3 < 0: |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
107 sys.exit("Error: trim3 is '{}', but only non-negative integers allowed".format(trim3)) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
108 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
109 # load dicts |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
110 with open(json_file, "r") as f: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
111 (tag_dict, cvrg_dict) = json.load(f) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
112 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
113 with open(sscs_json, "r") as f: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
114 (mut_pos_dict, ref_pos_dict) = json.load(f) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
115 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
116 # read bam file |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
117 bam = pysam.AlignmentFile(file2, "rb") |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
118 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
119 # create mut_dict |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
120 mut_dict = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
121 mut_read_pos_dict = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
122 mut_read_dict = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
123 reads_dict = {} |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
124 i = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
125 mut_array = [] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
126 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
127 for variant in VCF(file1): |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
128 chrom = variant.CHROM |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
129 stop_pos = variant.start |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
130 #chrom_stop_pos = str(chrom) + "#" + str(stop_pos) |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
131 ref = variant.REF |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
132 alt = variant.ALT[0] |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
133 chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt |
|
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
134 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
135 if len(ref) == len(alt): |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
136 mut_array.append([chrom, stop_pos, ref, alt]) |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
137 i += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
138 mut_dict[chrom_stop_pos] = {} |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
139 mut_read_pos_dict[chrom_stop_pos] = {} |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
140 reads_dict[chrom_stop_pos] = {} |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
141 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
142 for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000): |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
143 if pileupcolumn.reference_pos == stop_pos: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
144 count_alt = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
145 count_ref = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
146 count_indel = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
147 count_n = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
148 count_other = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
149 count_lowq = 0 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
150 n = 0 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
151 print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups), |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
152 "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n) |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
153 for pileupread in pileupcolumn.pileups: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
154 n += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
155 if not pileupread.is_del and not pileupread.is_refskip: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
156 tag = pileupread.alignment.query_name |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
157 nuc = pileupread.alignment.query_sequence[pileupread.query_position] |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
158 phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
159 if phred < phred_score: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
160 nuc = "lowQ" |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
161 if tag not in mut_dict[chrom_stop_pos]: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
162 mut_dict[chrom_stop_pos][tag] = {} |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
163 if nuc in mut_dict[chrom_stop_pos][tag]: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
164 mut_dict[chrom_stop_pos][tag][nuc] += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
165 else: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
166 mut_dict[chrom_stop_pos][tag][nuc] = 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
167 if tag not in mut_read_pos_dict[chrom_stop_pos]: |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
168 mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1 |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
169 reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence) |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
170 else: |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
171 mut_read_pos_dict[chrom_stop_pos][tag] = np.append( |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
172 mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
173 reads_dict[chrom_stop_pos][tag] = np.append( |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
174 reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence)) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
175 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
176 if nuc == alt: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
177 count_alt += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
178 if tag not in mut_read_dict: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
179 mut_read_dict[tag] = {} |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
180 mut_read_dict[tag][chrom_stop_pos] = (alt, ref) |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
181 else: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
182 mut_read_dict[tag][chrom_stop_pos] = (alt, ref) |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
183 elif nuc == ref: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
184 count_ref += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
185 elif nuc == "N": |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
186 count_n += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
187 elif nuc == "lowQ": |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
188 count_lowq += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
189 else: |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
190 count_other += 1 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
191 else: |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
192 count_indel += 1 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
193 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
194 print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq)) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
195 else: |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
196 print("indels are currently not evaluated") |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
197 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
198 mut_array = np.array(mut_array) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
199 for read in bam.fetch(until_eof=True): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
200 if read.is_unmapped: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
201 pure_tag = read.query_name[:-5] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
202 nuc = "na" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
203 for key in tag_dict[pure_tag].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
204 if key not in mut_dict: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
205 mut_dict[key] = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
206 if read.query_name not in mut_dict[key]: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
207 mut_dict[key][read.query_name] = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
208 if nuc in mut_dict[key][read.query_name]: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
209 mut_dict[key][read.query_name][nuc] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
210 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
211 mut_dict[key][read.query_name][nuc] = 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
212 bam.close() |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
213 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
214 # create pure_tags_dict |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
215 pure_tags_dict = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
216 for key1, value1 in sorted(mut_dict.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
217 i = np.where(np.array(['#'.join(str(i) for i in z) |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
218 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0] |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
219 ref = mut_array[i, 2] |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
220 alt = mut_array[i, 3] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
221 pure_tags_dict[key1] = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
222 for key2, value2 in sorted(value1.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
223 for key3, value3 in value2.items(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
224 pure_tag = key2[:-5] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
225 if key3 == alt: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
226 if pure_tag in pure_tags_dict[key1]: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
227 pure_tags_dict[key1][pure_tag] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
228 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
229 pure_tags_dict[key1][pure_tag] = 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
230 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
231 # create pure_tags_dict_short with thresh |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
232 if thresh > 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
233 pure_tags_dict_short = {} |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
234 for key, value in sorted(pure_tags_dict.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
235 if len(value) < thresh: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
236 pure_tags_dict_short[key] = value |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
237 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
238 pure_tags_dict_short = pure_tags_dict |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
239 |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
240 csv_data = open(outputFile_csv, "wb") |
|
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
241 csv_writer = csv.writer(csv_data, delimiter=",") |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
242 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
243 # output summary with threshold |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
244 workbook = xlsxwriter.Workbook(outfile) |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
245 workbook2 = xlsxwriter.Workbook(outfile2) |
|
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
246 workbook3 = xlsxwriter.Workbook(outfile3) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
247 ws1 = workbook.add_worksheet("Results") |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
248 ws2 = workbook2.add_worksheet("Allele frequencies") |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
249 ws3 = workbook3.add_worksheet("Tiers") |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
250 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
251 format1 = workbook.add_format({'bg_color': '#BCF5A9'}) # green |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
252 format2 = workbook.add_format({'bg_color': '#FFC7CE'}) # red |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
253 format3 = workbook.add_format({'bg_color': '#FACC2E'}) # yellow |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
254 |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
255 format12 = workbook2.add_format({'bg_color': '#BCF5A9'}) # green |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
256 format22 = workbook2.add_format({'bg_color': '#FFC7CE'}) # red |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
257 format32 = workbook2.add_format({'bg_color': '#FACC2E'}) # yellow |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
258 |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
259 format13 = workbook3.add_format({'bg_color': '#BCF5A9'}) # green |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
260 format23 = workbook3.add_format({'bg_color': '#FFC7CE'}) # red |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
261 format33 = workbook3.add_format({'bg_color': '#FACC2E'}) # yellow |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
262 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
263 header_line = ('variant ID', 'tier', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
264 'read median length.ba', 'DCS median length', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
265 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
266 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
267 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
268 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
269 'in phase', 'chimeric tag') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
270 ws1.write_row(0, 0, header_line) |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
271 csv_writer.writerow(header_line) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
272 counter_tier11 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
273 counter_tier12 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
274 counter_tier21 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
275 counter_tier22 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
276 counter_tier23 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
277 counter_tier24 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
278 counter_tier31 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
279 counter_tier32 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
280 counter_tier41 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
281 counter_tier42 = 0 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
282 counter_tier5 = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
283 counter_tier6 = 0 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
284 row = 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
285 tier_dict = {} |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
286 chimera_dict = {} |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
287 for key1, value1 in sorted(mut_dict.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
288 counts_mut = 0 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
289 chimeric_tag = {} |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
290 if key1 in pure_tags_dict_short.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
291 i = np.where(np.array(['#'.join(str(i) for i in z) |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
292 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0] |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
293 ref = mut_array[i, 2] |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
294 alt = mut_array[i, 3] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
295 dcs_median = cvrg_dict[key1][2] |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
296 whole_array = list(pure_tags_dict_short[key1].keys()) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
297 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
298 tier_dict[key1] = {} |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
299 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
300 ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0), ("tier 6", 0)] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
301 for k, v in values_tier_dict: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
302 tier_dict[key1][k] = v |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
303 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
304 used_keys = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
305 if 'ab' in mut_pos_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
306 sscs_mut_ab = mut_pos_dict[key1]['ab'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
307 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
308 sscs_mut_ab = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
309 if 'ba' in mut_pos_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
310 sscs_mut_ba = mut_pos_dict[key1]['ba'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
311 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
312 sscs_mut_ba = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
313 if 'ab' in ref_pos_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
314 sscs_ref_ab = ref_pos_dict[key1]['ab'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
315 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
316 sscs_ref_ab = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
317 if 'ba' in ref_pos_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
318 sscs_ref_ba = ref_pos_dict[key1]['ba'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
319 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
320 sscs_ref_ba = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
321 for key2, value2 in sorted(value1.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
322 add_mut14 = "" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
323 add_mut23 = "" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
324 if (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key2[:-5] not in used_keys) and (key1 in tag_dict[key2[:-5]].keys()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
325 if key2[:-5] + '.ab.1' in mut_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
326 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
327 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
328 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
329 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
330 na1 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
331 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
332 lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
333 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
334 lowq1 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
335 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
336 ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
337 ref1f = ref1 / (total1 - na1 - lowq1) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
338 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
339 ref1 = ref1f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
340 if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
341 alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
342 alt1f = alt1 / (total1 - na1 - lowq1) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
343 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
344 alt1 = alt1f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
345 total1new = total1 - na1 - lowq1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
346 if (key2[:-5] + '.ab.1') in mut_read_dict.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
347 k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys() |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
348 add_mut1 = len(k1) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
349 if add_mut1 > 1: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
350 for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
351 if k != key1: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
352 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
353 if len(add_mut14) == 0: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
354 add_mut14 = new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
355 else: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
356 add_mut14 = add_mut14 + ", " + new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
357 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
358 k1 = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
359 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
360 total1 = total1new = na1 = lowq1 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
361 ref1 = alt1 = ref1f = alt1f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
362 k1 = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
363 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
364 if key2[:-5] + '.ab.2' in mut_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
365 total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
366 if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
367 na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
368 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
369 na2 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
370 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
371 lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
372 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
373 lowq2 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
374 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
375 ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
376 ref2f = ref2 / (total2 - na2 - lowq2) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
377 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
378 ref2 = ref2f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
379 if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
380 alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
381 alt2f = alt2 / (total2 - na2 - lowq2) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
382 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
383 alt2 = alt2f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
384 total2new = total2 - na2 - lowq2 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
385 if (key2[:-5] + '.ab.2') in mut_read_dict.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
386 k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys() |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
387 add_mut2 = len(k2) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
388 if add_mut2 > 1: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
389 for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
390 if k != key1: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
391 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
392 if len(add_mut23) == 0: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
393 add_mut23 = new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
394 else: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
395 add_mut23 = add_mut23 + ", " + new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
396 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
397 k2 = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
398 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
399 total2 = total2new = na2 = lowq2 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
400 ref2 = alt2 = ref2f = alt2f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
401 k2 = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
402 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
403 if key2[:-5] + '.ba.1' in mut_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
404 total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
405 if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
406 na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
407 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
408 na3 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
409 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
410 lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
411 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
412 lowq3 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
413 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
414 ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
415 ref3f = ref3 / (total3 - na3 - lowq3) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
416 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
417 ref3 = ref3f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
418 if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
419 alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
420 alt3f = alt3 / (total3 - na3 - lowq3) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
421 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
422 alt3 = alt3f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
423 total3new = total3 - na3 - lowq3 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
424 if (key2[:-5] + '.ba.1') in mut_read_dict.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
425 add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
426 if add_mut3 > 1: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
427 for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
428 if k != key1 and k not in k2: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
429 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
430 if len(add_mut23) == 0: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
431 add_mut23 = new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
432 else: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
433 add_mut23 = add_mut23 + ", " + new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
434 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
435 total3 = total3new = na3 = lowq3 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
436 ref3 = alt3 = ref3f = alt3f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
437 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
438 if key2[:-5] + '.ba.2' in mut_dict[key1].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
439 total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
440 if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
441 na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
442 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
443 na4 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
444 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
445 lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ'] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
446 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
447 lowq4 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
448 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
449 ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
450 ref4f = ref4 / (total4 - na4 - lowq4) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
451 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
452 ref4 = ref4f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
453 if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
454 alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
455 alt4f = alt4 / (total4 - na4 - lowq4) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
456 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
457 alt4 = alt4f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
458 total4new = total4 - na4 - lowq4 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
459 if (key2[:-5] + '.ba.2') in mut_read_dict.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
460 add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys()) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
461 if add_mut4 > 1: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
462 for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
463 if k != key1 and k not in k1: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
464 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
465 if len(add_mut14) == 0: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
466 add_mut14 = new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
467 else: |
|
4
386438cd4c3b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
3
diff
changeset
|
468 add_mut14 = add_mut14 + ", " + new_mut |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
469 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
470 total4 = total4new = na4 = lowq4 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
471 ref4 = alt4 = ref4f = alt4f = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
472 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
473 read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
474 read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
475 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
476 if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys(): |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
477 read_pos1 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
478 read_len_median1 = np.median(reads_dict[key1][key2[:-5] + '.ab.1']) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
479 if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys(): |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
480 read_pos2 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
481 read_len_median2 = np.median(reads_dict[key1][key2[:-5] + '.ab.2']) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
482 if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys(): |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
483 read_pos3 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
484 read_len_median3 = np.median(reads_dict[key1][key2[:-5] + '.ba.1']) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
485 if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys(): |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
486 read_pos4 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
487 read_len_median4 = np.median(reads_dict[key1][key2[:-5] + '.ba.2']) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
488 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
489 used_keys.append(key2[:-5]) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
490 counts_mut += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
491 if (alt1f + alt2f + alt3f + alt4f) > 0.5: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
492 if total1new == 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
493 ref1f = alt1f = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
494 alt1ff = -1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
495 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
496 alt1ff = alt1f |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
497 if total2new == 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
498 ref2f = alt2f = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
499 alt2ff = -1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
500 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
501 alt2ff = alt2f |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
502 if total3new == 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
503 ref3f = alt3f = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
504 alt3ff = -1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
505 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
506 alt3ff = alt3f |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
507 if total4new == 0: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
508 ref4f = alt4f = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
509 alt4ff = -1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
510 else: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
511 alt4ff = alt4f |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
512 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
513 beg1 = beg4 = beg2 = beg3 = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
514 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
515 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
516 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
517 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
518 trimmed_five = False |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
519 trimmed_three = False |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
520 contradictory = False |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
521 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
522 if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
523 alt1ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
524 alt4ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
525 alt2ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
526 alt3ff = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
527 trimmed_five = False |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
528 trimmed_three = False |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
529 contradictory = True |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
530 else: |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
531 if ((read_pos1 >= 0) and (read_pos1 <= trim5)): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
532 beg1 = total1new |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
533 total1new = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
534 alt1ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
535 alt1f = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
536 trimmed_five = True |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
537 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
538 if ((read_pos1 >= 0) and (abs(read_len_median1 - read_pos1) <= trim3)): |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
539 beg1 = total1new |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
540 total1new = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
541 alt1ff = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
542 alt1f = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
543 trimmed_three = True |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
544 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
545 if ((read_pos4 >= 0) and (read_pos4 <= trim5)): |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
546 beg4 = total4new |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
547 total4new = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
548 alt4ff = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
549 alt4f = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
550 trimmed_five = True |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
551 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
552 if ((read_pos4 >= 0) and (abs(read_len_median4 - read_pos4) <= trim3)): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
553 beg4 = total4new |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
554 total4new = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
555 alt4ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
556 alt4f = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
557 trimmed_three = True |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
558 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
559 if ((read_pos2 >= 0) and (read_pos2 <= trim5)): |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
560 beg2 = total2new |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
561 total2new = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
562 alt2ff = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
563 alt2f = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
564 trimmed_five = True |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
565 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
566 if ((read_pos2 >= 0) and (abs(read_len_median2 - read_pos2) <= trim3)): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
567 beg2 = total2new |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
568 total2new = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
569 alt2ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
570 alt2f = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
571 trimmed_three = True |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
572 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
573 if ((read_pos3 >= 0) and (read_pos3 <= trim5)): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
574 beg3 = total3new |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
575 total3new = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
576 alt3ff = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
577 alt3f = 0 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
578 trimmed_five = True |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
579 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
580 if ((read_pos3 >= 0) and (abs(read_len_median3 - read_pos3) <= trim3)): |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
581 beg3 = total3new |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
582 total3new = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
583 alt3ff = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
584 alt3f = 0 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
585 trimmed_three = True |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
586 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
587 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
588 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
589 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
590 # assign tiers |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
591 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
592 tier = "1.1" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
593 counter_tier11 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
594 tier_dict[key1]["tier 1.1"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
595 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
596 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
597 & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
598 tier = "1.2" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
599 counter_tier12 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
600 tier_dict[key1]["tier 1.2"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
601 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
602 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
603 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
604 tier = "2.1" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
605 counter_tier21 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
606 tier_dict[key1]["tier 2.1"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
607 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
608 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
609 tier = "2.2" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
610 counter_tier22 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
611 tier_dict[key1]["tier 2.2"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
612 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
613 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
614 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
615 tier = "2.3" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
616 counter_tier23 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
617 tier_dict[key1]["tier 2.3"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
618 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
619 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
620 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
621 tier = "2.4" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
622 counter_tier24 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
623 tier_dict[key1]["tier 2.4"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
624 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
625 elif ((len(pure_tags_dict_short[key1]) > 1) & (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
626 tier = "3.1" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
627 counter_tier31 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
628 tier_dict[key1]["tier 3.1"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
629 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
630 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
631 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
632 tier = "3.2" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
633 counter_tier32 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
634 tier_dict[key1]["tier 3.2"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
635 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
636 elif trimmed_five: |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
637 tier = "4.1" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
638 counter_tier41 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
639 tier_dict[key1]["tier 4.1"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
640 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
641 elif trimmed_three: |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
642 tier = "4.2" |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
643 counter_tier42 += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
644 tier_dict[key1]["tier 4.2"] += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
645 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
646 elif contradictory: |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
647 tier = "5" |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
648 counter_tier5 += 1 |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
649 tier_dict[key1]["tier 5"] += 1 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
650 else: |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
651 tier = "6" |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
652 counter_tier6 += 1 |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
653 tier_dict[key1]["tier 6"] += 1 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
654 |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
655 chrom, pos, ref_a, alt_a = re.split(r'\#', key1) |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
656 var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
657 sample_tag = key2[:-5] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
658 array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
659 # exclude identical tag from array2, to prevent comparison to itself |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
660 same_tag = np.where(array2 == sample_tag) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
661 index_array2 = np.arange(0, len(array2), 1) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
662 index_withoutSame = np.delete(index_array2, same_tag) # delete identical tag from the data |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
663 array2 = array2[index_withoutSame] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
664 if len(array2) != 0: # only perform chimera analysis if there is more than 1 variant |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
665 array1_half = sample_tag[0:int(len(sample_tag) / 2)] # mate1 part1 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
666 array1_half2 = sample_tag[int(len(sample_tag) / 2):int(len(sample_tag))] # mate1 part 2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
667 array2_half = np.array([ii[0:int(len(ii) / 2)] for ii in array2]) # mate2 part1 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
668 array2_half2 = np.array([ii[int(len(ii) / 2):int(len(ii))] for ii in array2]) # mate2 part2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
669 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
670 min_tags_list_zeros = [] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
671 chimera_tags = [] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
672 for mate_b in [False, True]: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
673 i = 0 # counter, only used to see how many HDs of tags were already calculated |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
674 if mate_b is False: # HD calculation for all a's |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
675 half1_mate1 = array1_half |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
676 half2_mate1 = array1_half2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
677 half1_mate2 = array2_half |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
678 half2_mate2 = array2_half2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
679 elif mate_b is True: # HD calculation for all b's |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
680 half1_mate1 = array1_half2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
681 half2_mate1 = array1_half |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
682 half1_mate2 = array2_half2 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
683 half2_mate2 = array2_half |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
684 # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's" |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
685 dist = np.array([sum(map(operator.ne, half1_mate1, c)) for c in half1_mate2]) |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
686 min_index = np.where(dist == dist.min()) # get index of min HD |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
687 # get all "b's" of the tag or all "a's" of the tag with minimum HD |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
688 min_tag_half2 = half2_mate2[min_index] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
689 min_tag_array2 = array2[min_index] # get whole tag with min HD |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
690 min_value = dist.min() |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
691 # calculate HD of "b" to all "b's" or "a" to all "a's" |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
692 dist_second_half = np.array([sum(map(operator.ne, half2_mate1, e)) |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
693 for e in min_tag_half2]) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
694 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
695 dist2 = dist_second_half.max() |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
696 max_index = np.where(dist_second_half == dist_second_half.max())[0] # get index of max HD |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
697 max_tag = min_tag_array2[max_index] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
698 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
699 # tags which have identical parts: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
700 if min_value == 0 or dist2 == 0: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
701 min_tags_list_zeros.append(tag) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
702 chimera_tags.append(max_tag) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
703 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
704 i += 1 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
705 chimera_tags = [x for x in chimera_tags if x != []] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
706 chimera_tags_new = [] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
707 for i in chimera_tags: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
708 if len(i) > 1: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
709 for t in i: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
710 chimera_tags_new.append(t) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
711 else: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
712 chimera_tags_new.extend(i) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
713 chimera = ", ".join(chimera_tags_new) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
714 else: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
715 chimera_tags_new = [] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
716 chimera = "" |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
717 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
718 if len(chimera_tags_new) > 0: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
719 chimera_tags_new.append(sample_tag) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
720 key_chimera = ",".join(sorted(chimera_tags_new)) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
721 if key_chimera in chimeric_tag.keys(): |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
722 chimeric_tag[key_chimera].append(float(tier)) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
723 else: |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
724 chimeric_tag[key_chimera] = [float(tier)] |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
725 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
726 if (read_pos1 == -1): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
727 read_pos1 = read_len_median1 = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
728 if (read_pos4 == -1): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
729 read_pos4 = read_len_median4 = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
730 if (read_pos2 == -1): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
731 read_pos2 = read_len_median2 = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
732 if (read_pos3 == -1): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
733 read_pos3 = read_len_median3 = None |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
734 line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
735 ws1.write_row(row, 0, line) |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
736 csv_writer.writerow(line) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
737 line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
738 ws1.write_row(row + 1, 0, line) |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
739 csv_writer.writerow(line) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
740 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
741 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
742 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
743 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
744 'format': format1, |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
745 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
746 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
747 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
748 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
749 'format': format3, |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
750 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
751 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
752 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
753 'criteria': '=$B${}>="3"'.format(row + 1), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
754 'format': format2, |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
755 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)}) |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
756 row += 3 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
757 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
758 if chimera_correction: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
759 chimeric_dcs_high_tiers = 0 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
760 chimeric_dcs = 0 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
761 for keys_chimera in chimeric_tag.keys(): |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
762 tiers = chimeric_tag[keys_chimera] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
763 chimeric_dcs += len(tiers) - 1 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
764 high_tiers = sum(1 for t in tiers if t < 3.) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
765 if high_tiers == len(tiers): |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
766 chimeric_dcs_high_tiers += high_tiers - 1 |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
767 else: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
768 chimeric_dcs_high_tiers += high_tiers |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
769 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers) |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
770 #csv_data.close() |
|
26
5cb0bdd578cf
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
25
diff
changeset
|
771 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
772 # sheet 2 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
773 if chimera_correction: |
|
3
4fc62ab6e9e8
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
2
diff
changeset
|
774 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
775 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
776 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
777 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
778 else: |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
779 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
780 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
781 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
782 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6') |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
783 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
784 ws2.write_row(0, 0, header_line2) |
|
34
d5e725905448
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
33
diff
changeset
|
785 ws2.conditional_format('J1:K1', {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1}) |
|
d5e725905448
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
33
diff
changeset
|
786 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
787 row = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
788 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
789 for key1, value1 in sorted(tier_dict.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
790 if key1 in pure_tags_dict_short.keys(): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
791 i = np.where(np.array(['#'.join(str(i) for i in z) |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
792 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0] |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
793 ref = mut_array[i, 2] |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
794 alt = mut_array[i, 3] |
|
7
ded0dc6a20d3
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
6
diff
changeset
|
795 chrom, pos, ref_a, alt_a = re.split(r'\#', key1) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
796 ref_count = cvrg_dict[key1][0] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
797 alt_count = cvrg_dict[key1][1] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
798 cvrg = ref_count + alt_count |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
799 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
800 var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
801 lst = [var_id, cvrg] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
802 used_tiers = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
803 cum_af = [] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
804 for key2, value2 in sorted(value1.items()): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
805 # calculate cummulative AF |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
806 used_tiers.append(value2) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
807 if len(used_tiers) > 1: |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
808 cum = safe_div(sum(used_tiers), cvrg) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
809 cum_af.append(cum) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
810 lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)]) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
811 if chimera_correction: |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
812 chimeras_all = chimera_dict[key1][0] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
813 new_alt = sum(used_tiers) - chimeras_all |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
814 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers))) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
815 if fraction_chimeras is None: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
816 fraction_chimeras = 0. |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
817 new_cvrg = cvrg * (1. - fraction_chimeras) |
|
3
4fc62ab6e9e8
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
2
diff
changeset
|
818 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
819 lst.extend([(cvrg - sum(used_tiers[-6:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-6:])))]) |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
820 if chimera_correction: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
821 chimeras_all = chimera_dict[key1][1] |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
822 new_alt = sum(used_tiers[0:6]) - chimeras_all |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
823 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6]))) |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
824 if fraction_chimeras is None: |
|
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
825 fraction_chimeras = 0. |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
826 new_cvrg = (cvrg - sum(used_tiers[-6:])) * (1. - fraction_chimeras) |
|
3
4fc62ab6e9e8
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
2
diff
changeset
|
827 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
828 lst.extend([alt_count, safe_div(alt_count, cvrg)]) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
829 lst.extend(used_tiers) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
830 lst.extend(cum_af) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
831 lst = tuple(lst) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
832 ws2.write_row(row + 1, 0, lst) |
|
30
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
833 #if chimera_correction: |
|
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
834 # ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) |
|
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
835 # ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) |
|
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
836 # ws2.conditional_format('V{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:AA{} V1:AA1'.format(row + 2, row + 2)}) |
|
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
837 #else: |
|
34
d5e725905448
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
33
diff
changeset
|
838 #ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) |
|
33
deae1eb387e1
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
32
diff
changeset
|
839 #ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) |
|
32
80cbf0bd6e9c
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
31
diff
changeset
|
840 #ws2.conditional_format('P{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:U{} P1:U1'.format(row + 2, row + 2)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
841 row += 1 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
842 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
843 # sheet 3 |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
844 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
845 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
846 ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
847 ("tier 4.2", counter_tier42), ("tier 5", counter_tier5), ("tier 6", counter_tier6)] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
848 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
849 header = ("tier", "count") |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
850 ws3.write_row(0, 0, header) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
851 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
852 for i in range(len(sheet3)): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
853 ws3.write_row(i + 1, 0, sheet3[i]) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
854 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
855 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
856 'criteria': '=OR($A${}="tier 1.1", $A${}="tier 1.2")'.format(i + 2, i + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
857 'format': format1}) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
858 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
859 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
860 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
861 'format': format3}) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
862 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
863 {'type': 'formula', |
|
30
e7da54e10e2d
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
29
diff
changeset
|
864 'criteria': '=$A${}>="3"'.format(i + 2), |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
865 'format': format2}) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
866 |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
867 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
868 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
869 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
870 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
871 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
872 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
873 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
874 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
875 ("Tier 4.1", "variants at the beginning of the reads"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
876 ("Tier 4.2", "variants at the end of the reads"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
877 ("Tier 5", "mates with contradictory information"), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
878 ("Tier 6", "remaining variants")] |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
879 examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
880 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
881 "4081", "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
882 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
883 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
884 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
885 [("chr5-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
886 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
887 "0", "4081", "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
888 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
889 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
890 "7", "0", "0", "4081", "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
891 [("chr5-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
892 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
893 "0", "0", "1", "6", "47170", "41149", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
894 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
895 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
896 "0", "0", "1", "6", "47170", "41149", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
897 [("chr5-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
898 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
899 "4081", "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
900 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
901 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
902 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
903 [("chr5-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
904 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
905 "4081", "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
906 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
907 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
908 "4081", "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
909 [("chr5-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
910 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
911 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
912 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
913 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
914 "0", "0", "4081", "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
915 [("chr5-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
916 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
917 "4098", "5", "10", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
918 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
919 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
920 "4098", "5", "10", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
921 [("chr5-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
922 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
923 "0", "0", "3", "3", "47170", "41149", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
924 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
925 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
926 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
927 [("chr5-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
928 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
929 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
930 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
931 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
932 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
933 [("chr5-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "100", "255", "276", "269", |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
934 "5", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
935 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
936 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
937 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
938 [("chr5-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "20", "270", "255", "276", "269", |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
939 "5", "6", "5", "0", "0", "0", "5", "0", "0", "0", "1", "0", "0", "0", "0", "0", "0", "6", "1", "1", "5348", "5350", "", ""), |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
940 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
941 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
942 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], |
|
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
943 [("chr5-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
944 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
945 "0", "0", "0", "1", "1", "5348", "5350", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
946 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
947 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
948 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
949 [("chr5-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
950 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
951 "0", "1", "1", "5348", "5350", "", ""), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
952 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
953 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", |
|
2
9d74f30275c6
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
0
diff
changeset
|
954 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
955 |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
956 start_row = 15 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
957 ws3.write(start_row, 0, "Description of tiers with examples") |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
958 ws3.write_row(start_row + 1, 0, header_line) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
959 row = 0 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
960 for i in range(len(description_tiers)): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
961 ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i]) |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
962 ex = examples_tiers[i] |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
963 for k in range(len(ex)): |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
964 ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k]) |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
965 ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
966 ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
967 {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
968 'format': format3, |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
969 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
970 ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
971 {'type': 'formula', |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
972 'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2), |
|
11
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
973 'format': format2, |
|
84a1a3f70407
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
10
diff
changeset
|
974 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
975 row += 3 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
976 workbook.close() |
|
6
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
977 workbook2.close() |
|
11a2a34f8a2b
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
5
diff
changeset
|
978 workbook3.close() |
|
29
b14b69697cf6
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
28
diff
changeset
|
979 csv_data.close() |
|
28
afda74e874ac
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
27
diff
changeset
|
980 |
|
0
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
981 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
982 |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
983 if __name__ == '__main__': |
|
e5953c54cfb5
planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff
changeset
|
984 sys.exit(read2mut(sys.argv)) |
