Mercurial > repos > mheinzl > variant_analyzer2
comparison read2mut.py @ 27:5992e30ae50e draft
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
| author | mheinzl | 
|---|---|
| date | Mon, 22 Feb 2021 16:56:05 +0000 | 
| parents | 5cb0bdd578cf | 
| children | afda74e874ac | 
   comparison
  equal
  deleted
  inserted
  replaced
| 26:5cb0bdd578cf | 27:5992e30ae50e | 
|---|---|
| 14 ======= ========== ================= ================================ | 14 ======= ========== ================= ================================ | 
| 15 | 15 | 
| 16 | 16 | 
| 17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam | 17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam | 
| 18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json | 18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json | 
| 19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim5 10 --trim3 10 --chimera_correction | 19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction | 
| 20 | 20 | 
| 21 """ | 21 """ | 
| 22 | 22 | 
| 23 from __future__ import division | 23 from __future__ import division | 
| 24 | 24 | 
| 25 import argparse | 25 import argparse | 
| 26 import csv | |
| 27 import json | 26 import json | 
| 28 import operator | 27 import operator | 
| 29 import os | 28 import os | 
| 30 import re | 29 import re | 
| 31 import sys | 30 import sys | 
| 32 | |
| 33 | 31 | 
| 34 import numpy as np | 32 import numpy as np | 
| 35 import pysam | 33 import pysam | 
| 36 import xlsxwriter | 34 import xlsxwriter | 
| 37 from cyvcf2 import VCF | 35 from cyvcf2 import VCF | 
| 47 help='JSON file with data collected by mut2read.py.') | 45 help='JSON file with data collected by mut2read.py.') | 
| 48 parser.add_argument('--sscsJson', | 46 parser.add_argument('--sscsJson', | 
| 49 help='JSON file with SSCS counts collected by mut2sscs.py.') | 47 help='JSON file with SSCS counts collected by mut2sscs.py.') | 
| 50 parser.add_argument('--outputFile', | 48 parser.add_argument('--outputFile', | 
| 51 help='Output xlsx file with summary of mutations.') | 49 help='Output xlsx file with summary of mutations.') | 
| 52 parser.add_argument('--outputFile_csv', | |
| 53 help='Output csv file with summary of mutations.') | |
| 54 parser.add_argument('--outputFile2', | 50 parser.add_argument('--outputFile2', | 
| 55 help='Output xlsx file with allele frequencies of mutations.') | 51 help='Output xlsx file with allele frequencies of mutations.') | 
| 56 parser.add_argument('--outputFile3', | 52 parser.add_argument('--outputFile3', | 
| 57 help='Output xlsx file with examples of the tier classification.') | 53 help='Output xlsx file with examples of the tier classification.') | 
| 58 parser.add_argument('--thresh', type=int, default=0, | 54 parser.add_argument('--thresh', type=int, default=0, | 
| 59 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.') | 55 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.') | 
| 60 parser.add_argument('--phred', type=int, default=20, | 56 parser.add_argument('--phred', type=int, default=20, | 
| 61 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.') | 57 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.') | 
| 62 parser.add_argument('--trim5', type=int, default=10, | 58 parser.add_argument('--trim', type=int, default=10, | 
| 63 help='Integer threshold for assigning mutations at start of reads to lower tier. Default 10.') | 59 help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.') | 
| 64 parser.add_argument('--trim3', type=int, default=10, | |
| 65 help='Integer threshold for assigning mutations at end of reads to lower tier. Default 10.') | |
| 66 parser.add_argument('--chimera_correction', action="store_true", | 60 parser.add_argument('--chimera_correction', action="store_true", | 
| 67 help='Count chimeric variants and correct the variant frequencies') | 61 help='Count chimeric variants and correct the variant frequencies') | 
| 68 return parser | 62 return parser | 
| 69 | 63 | 
| 70 | 64 | 
| 82 json_file = args.inputJson | 76 json_file = args.inputJson | 
| 83 sscs_json = args.sscsJson | 77 sscs_json = args.sscsJson | 
| 84 outfile = args.outputFile | 78 outfile = args.outputFile | 
| 85 outfile2 = args.outputFile2 | 79 outfile2 = args.outputFile2 | 
| 86 outfile3 = args.outputFile3 | 80 outfile3 = args.outputFile3 | 
| 87 outputFile_csv = args.outputFile_csv | |
| 88 thresh = args.thresh | 81 thresh = args.thresh | 
| 89 phred_score = args.phred | 82 phred_score = args.phred | 
| 90 trim5 = args.trim5 | 83 trim = args.trim | 
| 91 trim3 = args.trim3 | |
| 92 chimera_correction = args.chimera_correction | 84 chimera_correction = args.chimera_correction | 
| 93 | 85 | 
| 94 if os.path.isfile(file1) is False: | 86 if os.path.isfile(file1) is False: | 
| 95 sys.exit("Error: Could not find '{}'".format(file1)) | 87 sys.exit("Error: Could not find '{}'".format(file1)) | 
| 96 if os.path.isfile(file2) is False: | 88 if os.path.isfile(file2) is False: | 
| 99 sys.exit("Error: Could not find '{}'".format(json_file)) | 91 sys.exit("Error: Could not find '{}'".format(json_file)) | 
| 100 if thresh < 0: | 92 if thresh < 0: | 
| 101 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh)) | 93 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh)) | 
| 102 if phred_score < 0: | 94 if phred_score < 0: | 
| 103 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score)) | 95 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score)) | 
| 104 if trim5 < 0: | 96 if trim < 0: | 
| 105 sys.exit("Error: trim5 is '{}', but only non-negative integers allowed".format(trim5)) | 97 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh)) | 
| 106 if trim3 < 0: | |
| 107 sys.exit("Error: trim3 is '{}', but only non-negative integers allowed".format(trim3)) | |
| 108 | 98 | 
| 109 # load dicts | 99 # load dicts | 
| 110 with open(json_file, "r") as f: | 100 with open(json_file, "r") as f: | 
| 111 (tag_dict, cvrg_dict) = json.load(f) | 101 (tag_dict, cvrg_dict) = json.load(f) | 
| 112 | 102 | 
| 235 if len(value) < thresh: | 225 if len(value) < thresh: | 
| 236 pure_tags_dict_short[key] = value | 226 pure_tags_dict_short[key] = value | 
| 237 else: | 227 else: | 
| 238 pure_tags_dict_short = pure_tags_dict | 228 pure_tags_dict_short = pure_tags_dict | 
| 239 | 229 | 
| 240 #csv_data = open(outputFile_csv, "w") | |
| 241 #csv_writer = csv.writer(csv_data, delimiter=",") | |
| 242 | |
| 243 # output summary with threshold | 230 # output summary with threshold | 
| 244 workbook = xlsxwriter.Workbook(outfile) | 231 workbook = xlsxwriter.Workbook(outfile) | 
| 245 workbook2 = xlsxwriter.Workbook(outfile2) | 232 workbook2 = xlsxwriter.Workbook(outfile2) | 
| 246 workbook3 = xlsxwriter.Workbook(outfile3) | 233 workbook3 = xlsxwriter.Workbook(outfile3) | 
| 247 ws1 = workbook.add_worksheet("Results") | 234 ws1 = workbook.add_worksheet("Results") | 
| 266 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba', | 253 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba', | 
| 267 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba', | 254 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba', | 
| 268 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', | 255 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba', | 
| 269 'in phase', 'chimeric tag') | 256 'in phase', 'chimeric tag') | 
| 270 ws1.write_row(0, 0, header_line) | 257 ws1.write_row(0, 0, header_line) | 
| 271 #csv_writer.writerow(header_line) | |
| 272 counter_tier11 = 0 | 258 counter_tier11 = 0 | 
| 273 counter_tier12 = 0 | 259 counter_tier12 = 0 | 
| 274 counter_tier21 = 0 | 260 counter_tier21 = 0 | 
| 275 counter_tier22 = 0 | 261 counter_tier22 = 0 | 
| 276 counter_tier23 = 0 | 262 counter_tier23 = 0 | 
| 278 counter_tier31 = 0 | 264 counter_tier31 = 0 | 
| 279 counter_tier32 = 0 | 265 counter_tier32 = 0 | 
| 280 counter_tier41 = 0 | 266 counter_tier41 = 0 | 
| 281 counter_tier42 = 0 | 267 counter_tier42 = 0 | 
| 282 counter_tier5 = 0 | 268 counter_tier5 = 0 | 
| 283 counter_tier6 = 0 | |
| 284 row = 1 | 269 row = 1 | 
| 285 tier_dict = {} | 270 tier_dict = {} | 
| 286 chimera_dict = {} | 271 chimera_dict = {} | 
| 287 for key1, value1 in sorted(mut_dict.items()): | 272 for key1, value1 in sorted(mut_dict.items()): | 
| 288 counts_mut = 0 | 273 counts_mut = 0 | 
| 294 alt = mut_array[i, 3] | 279 alt = mut_array[i, 3] | 
| 295 dcs_median = cvrg_dict[key1][2] | 280 dcs_median = cvrg_dict[key1][2] | 
| 296 whole_array = list(pure_tags_dict_short[key1].keys()) | 281 whole_array = list(pure_tags_dict_short[key1].keys()) | 
| 297 | 282 | 
| 298 tier_dict[key1] = {} | 283 tier_dict[key1] = {} | 
| 299 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), | 284 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0)] | 
| 300 ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0), ("tier 6", 0)] | |
| 301 for k, v in values_tier_dict: | 285 for k, v in values_tier_dict: | 
| 302 tier_dict[key1][k] = v | 286 tier_dict[key1][k] = v | 
| 303 | 287 | 
| 304 used_keys = [] | 288 used_keys = [] | 
| 305 if 'ab' in mut_pos_dict[key1].keys(): | 289 if 'ab' in mut_pos_dict[key1].keys(): | 
| 513 beg1 = beg4 = beg2 = beg3 = 0 | 497 beg1 = beg4 = beg2 = beg3 = 0 | 
| 514 | 498 | 
| 515 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) | 499 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) | 
| 516 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) | 500 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) | 
| 517 | 501 | 
| 518 trimmed_five = False | 502 trimmed = False | 
| 519 trimmed_three = False | |
| 520 contradictory = False | 503 contradictory = False | 
| 521 | 504 | 
| 522 if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): | 505 if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))): | 
| 523 alt1ff = 0 | 506 alt1ff = 0 | 
| 524 alt4ff = 0 | 507 alt4ff = 0 | 
| 525 alt2ff = 0 | 508 alt2ff = 0 | 
| 526 alt3ff = 0 | 509 alt3ff = 0 | 
| 527 trimmed_five = False | 510 trimmed = False | 
| 528 trimmed_three = False | |
| 529 contradictory = True | 511 contradictory = True | 
| 530 else: | 512 else: | 
| 531 if ((read_pos1 >= 0) and (read_pos1 <= trim5)): | 513 if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))): | 
| 532 beg1 = total1new | 514 beg1 = total1new | 
| 533 total1new = 0 | 515 total1new = 0 | 
| 534 alt1ff = 0 | 516 alt1ff = 0 | 
| 535 alt1f = 0 | 517 alt1f = 0 | 
| 536 trimmed_five = True | 518 trimmed = True | 
| 537 | 519 | 
| 538 if ((read_pos1 >= 0) and (abs(read_len_median1 - read_pos1) <= trim3)): | 520 if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))): | 
| 539 beg1 = total1new | |
| 540 total1new = 0 | |
| 541 alt1ff = 0 | |
| 542 alt1f = 0 | |
| 543 trimmed_three = True | |
| 544 | |
| 545 if ((read_pos4 >= 0) and (read_pos4 <= trim5)): | |
| 546 beg4 = total4new | 521 beg4 = total4new | 
| 547 total4new = 0 | 522 total4new = 0 | 
| 548 alt4ff = 0 | 523 alt4ff = 0 | 
| 549 alt4f = 0 | 524 alt4f = 0 | 
| 550 trimmed_five = True | 525 trimmed = True | 
| 551 | 526 | 
| 552 if ((read_pos4 >= 0) and (abs(read_len_median4 - read_pos4) <= trim3)): | 527 if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))): | 
| 553 beg4 = total4new | |
| 554 total4new = 0 | |
| 555 alt4ff = 0 | |
| 556 alt4f = 0 | |
| 557 trimmed_three = True | |
| 558 | |
| 559 if ((read_pos2 >= 0) and (read_pos2 <= trim5)): | |
| 560 beg2 = total2new | 528 beg2 = total2new | 
| 561 total2new = 0 | 529 total2new = 0 | 
| 562 alt2ff = 0 | 530 alt2ff = 0 | 
| 563 alt2f = 0 | 531 alt2f = 0 | 
| 564 trimmed_five = True | 532 trimmed = True | 
| 565 | 533 | 
| 566 if ((read_pos2 >= 0) and (abs(read_len_median2 - read_pos2) <= trim3)): | 534 if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))): | 
| 567 beg2 = total2new | |
| 568 total2new = 0 | |
| 569 alt2ff = 0 | |
| 570 alt2f = 0 | |
| 571 trimmed_three = True | |
| 572 | |
| 573 if ((read_pos3 >= 0) and (read_pos3 <= trim5)): | |
| 574 beg3 = total3new | 535 beg3 = total3new | 
| 575 total3new = 0 | 536 total3new = 0 | 
| 576 alt3ff = 0 | 537 alt3ff = 0 | 
| 577 alt3f = 0 | 538 alt3f = 0 | 
| 578 trimmed_five = True | 539 trimmed = True | 
| 579 | |
| 580 if ((read_pos3 >= 0) and (abs(read_len_median3 - read_pos3) <= trim3)): | |
| 581 beg3 = total3new | |
| 582 total3new = 0 | |
| 583 alt3ff = 0 | |
| 584 alt3f = 0 | |
| 585 trimmed_three = True | |
| 586 | |
| 587 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) | 540 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4) | 
| 588 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) | 541 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3) | 
| 589 | 542 | 
| 590 # assign tiers | 543 # assign tiers | 
| 591 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): | 544 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))): | 
| 631 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): | 584 | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))): | 
| 632 tier = "3.2" | 585 tier = "3.2" | 
| 633 counter_tier32 += 1 | 586 counter_tier32 += 1 | 
| 634 tier_dict[key1]["tier 3.2"] += 1 | 587 tier_dict[key1]["tier 3.2"] += 1 | 
| 635 | 588 | 
| 636 elif trimmed_five: | 589 elif (trimmed): | 
| 637 tier = "4.1" | 590 tier = "4.1" | 
| 638 counter_tier41 += 1 | 591 counter_tier41 += 1 | 
| 639 tier_dict[key1]["tier 4.1"] += 1 | 592 tier_dict[key1]["tier 4.1"] += 1 | 
| 640 | 593 | 
| 641 elif trimmed_three: | 594 elif (contradictory): | 
| 642 tier = "4.2" | 595 tier = "4.2" | 
| 643 counter_tier42 += 1 | 596 counter_tier42 += 1 | 
| 644 tier_dict[key1]["tier 4.2"] += 1 | 597 tier_dict[key1]["tier 4.2"] += 1 | 
| 645 | 598 | 
| 646 elif contradictory: | 599 else: | 
| 647 tier = "5" | 600 tier = "5" | 
| 648 counter_tier5 += 1 | 601 counter_tier5 += 1 | 
| 649 tier_dict[key1]["tier 5"] += 1 | 602 tier_dict[key1]["tier 5"] += 1 | 
| 650 else: | |
| 651 tier = "6" | |
| 652 counter_tier6 += 1 | |
| 653 tier_dict[key1]["tier 6"] += 1 | |
| 654 | 603 | 
| 655 chrom, pos, ref_a, alt_a = re.split(r'\#', key1) | 604 chrom, pos, ref_a, alt_a = re.split(r'\#', key1) | 
| 656 var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) | 605 var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt]) | 
| 657 sample_tag = key2[:-5] | 606 sample_tag = key2[:-5] | 
| 658 array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time | 607 array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time | 
| 731 read_pos2 = read_len_median2 = None | 680 read_pos2 = read_len_median2 = None | 
| 732 if (read_pos3 == -1): | 681 if (read_pos3 == -1): | 
| 733 read_pos3 = read_len_median3 = None | 682 read_pos3 = read_len_median3 = None | 
| 734 line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera) | 683 line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera) | 
| 735 ws1.write_row(row, 0, line) | 684 ws1.write_row(row, 0, line) | 
| 736 #csv_writer.writerow(line) | |
| 737 line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera) | 685 line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera) | 
| 738 ws1.write_row(row + 1, 0, line) | 686 ws1.write_row(row + 1, 0, line) | 
| 739 #csv_writer.writerow(line) | |
| 740 | 687 | 
| 741 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), | 688 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2), | 
| 742 {'type': 'formula', | 689 {'type': 'formula', | 
| 743 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), | 690 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), | 
| 744 'format': format1, | 691 'format': format1, | 
| 765 if high_tiers == len(tiers): | 712 if high_tiers == len(tiers): | 
| 766 chimeric_dcs_high_tiers += high_tiers - 1 | 713 chimeric_dcs_high_tiers += high_tiers - 1 | 
| 767 else: | 714 else: | 
| 768 chimeric_dcs_high_tiers += high_tiers | 715 chimeric_dcs_high_tiers += high_tiers | 
| 769 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers) | 716 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers) | 
| 770 #csv_data.close() | |
| 771 | 717 | 
| 772 # sheet 2 | 718 # sheet 2 | 
| 773 if chimera_correction: | 719 if chimera_correction: | 
| 774 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', | 720 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', | 
| 775 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', | 721 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', | 
| 776 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', | 722 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', | 
| 777 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6') | 723 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') | 
| 778 else: | 724 else: | 
| 779 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', | 725 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)', | 
| 780 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', | 726 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', | 
| 781 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', | 727 'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2', | 
| 782 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6') | 728 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5') | 
| 783 | 729 | 
| 784 ws2.write_row(0, 0, header_line2) | 730 ws2.write_row(0, 0, header_line2) | 
| 785 row = 0 | 731 row = 0 | 
| 786 | 732 | 
| 787 for key1, value1 in sorted(tier_dict.items()): | 733 for key1, value1 in sorted(tier_dict.items()): | 
| 812 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers))) | 758 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers))) | 
| 813 if fraction_chimeras is None: | 759 if fraction_chimeras is None: | 
| 814 fraction_chimeras = 0. | 760 fraction_chimeras = 0. | 
| 815 new_cvrg = cvrg * (1. - fraction_chimeras) | 761 new_cvrg = cvrg * (1. - fraction_chimeras) | 
| 816 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) | 762 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) | 
| 817 lst.extend([(cvrg - sum(used_tiers[-6:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-6:])))]) | 763 lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:])))]) | 
| 818 if chimera_correction: | 764 if chimera_correction: | 
| 819 chimeras_all = chimera_dict[key1][1] | 765 chimeras_all = chimera_dict[key1][1] | 
| 820 new_alt = sum(used_tiers[0:6]) - chimeras_all | 766 new_alt = sum(used_tiers[0:6]) - chimeras_all | 
| 821 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6]))) | 767 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6]))) | 
| 822 if fraction_chimeras is None: | 768 if fraction_chimeras is None: | 
| 823 fraction_chimeras = 0. | 769 fraction_chimeras = 0. | 
| 824 new_cvrg = (cvrg - sum(used_tiers[-6:])) * (1. - fraction_chimeras) | 770 new_cvrg = (cvrg - sum(used_tiers[-5:])) * (1. - fraction_chimeras) | 
| 825 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) | 771 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)]) | 
| 826 lst.extend([alt_count, safe_div(alt_count, cvrg)]) | 772 lst.extend([alt_count, safe_div(alt_count, cvrg)]) | 
| 827 lst.extend(used_tiers) | 773 lst.extend(used_tiers) | 
| 828 lst.extend(cum_af) | 774 lst.extend(cum_af) | 
| 829 lst = tuple(lst) | 775 lst = tuple(lst) | 
| 830 ws2.write_row(row + 1, 0, lst) | 776 ws2.write_row(row + 1, 0, lst) | 
| 831 if chimera_correction: | 777 if chimera_correction: | 
| 832 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) | 778 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)}) | 
| 833 ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) | 779 ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)}) | 
| 834 ws2.conditional_format('V{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:AA{} V1:AA1'.format(row + 2, row + 2)}) | 780 ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)}) | 
| 835 else: | 781 else: | 
| 836 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) | 782 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)}) | 
| 837 ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) | 783 ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)}) | 
| 838 ws2.conditional_format('P{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:U{} P1:U1'.format(row + 2, row + 2)}) | 784 ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)}) | 
| 839 row += 1 | 785 row += 1 | 
| 840 | 786 | 
| 841 # sheet 3 | 787 # sheet 3 | 
| 842 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), | 788 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), | 
| 843 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), | 789 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), | 
| 844 ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), | 790 ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41), | 
| 845 ("tier 4.2", counter_tier42), ("tier 5", counter_tier5), ("tier 6", counter_tier6)] | 791 ("tier 4.2", counter_tier42), ("tier 5", counter_tier5)] | 
| 846 | 792 | 
| 847 header = ("tier", "count") | 793 header = ("tier", "count") | 
| 848 ws3.write_row(0, 0, header) | 794 ws3.write_row(0, 0, header) | 
| 849 | 795 | 
| 850 for i in range(len(sheet3)): | 796 for i in range(len(sheet3)): | 
| 857 {'type': 'formula', | 803 {'type': 'formula', | 
| 858 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2), | 804 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2), | 
| 859 'format': format3}) | 805 'format': format3}) | 
| 860 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), | 806 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2), | 
| 861 {'type': 'formula', | 807 {'type': 'formula', | 
| 862 'criteria': '=OR($A${}="tier 3.1", $A${}="tier 3.2", $A${}="tier 4.1", $A${}="tier 4.2", $A${}="tier 5", $A${}="tier 6")'.format(i + 2, i + 2, i + 2, i + 2, i + 2, i + 2), | 808 'criteria': '=$A${}>="3"'.format(i + 2), | 
| 863 'format': format2}) | 809 'format': format2}) | 
| 864 | 810 | 
| 865 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), | 811 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"), ("Tier 5", "remaining variants")] | 
| 866 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), | 812 examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", | 
| 867 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), | |
| 868 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), | |
| 869 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), | |
| 870 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), | |
| 871 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), | |
| 872 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), | |
| 873 ("Tier 4.1", "variants at the beginning of the reads"), | |
| 874 ("Tier 4.2", "variants at the end of the reads"), | |
| 875 ("Tier 5", "mates with contradictory information"), | |
| 876 ("Tier 6", "remaining variants")] | |
| 877 examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289", | |
| 878 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 813 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 
| 879 "4081", "4098", "5", "10", "", ""), | 814 "4081", "4098", "5", "10", "", ""), | 
| 880 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, | 815 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None, | 
| 881 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, | 816 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, | 
| 882 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], | 817 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], | 
| 883 [("chr5-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", | 818 [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289", | 
| 884 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", | 819 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0", | 
| 885 "0", "4081", "4098", "5", "10", "", ""), | 820 "0", "4081", "4098", "5", "10", "", ""), | 
| 886 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", | 821 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289", | 
| 887 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", | 822 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1", | 
| 888 "7", "0", "0", "4081", "4098", "5", "10", "", "")], | 823 "7", "0", "0", "4081", "4098", "5", "10", "", "")], | 
| 889 [("chr5-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", | 824 [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290", | 
| 890 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", | 825 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", | 
| 891 "0", "0", "1", "6", "47170", "41149", "", ""), | 826 "0", "0", "1", "6", "47170", "41149", "", ""), | 
| 892 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", | 827 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290", | 
| 893 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", | 828 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0", | 
| 894 "0", "0", "1", "6", "47170", "41149", "", "")], | 829 "0", "0", "1", "6", "47170", "41149", "", "")], | 
| 895 [("chr5-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", | 830 [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289", | 
| 896 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 831 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 
| 897 "4081", "4098", "5", "10", "", ""), | 832 "4081", "4098", "5", "10", "", ""), | 
| 898 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, | 833 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None, | 
| 899 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", | 834 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0", | 
| 900 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], | 835 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")], | 
| 901 [("chr5-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", | 836 [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289", | 
| 902 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 837 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 
| 903 "4081", "4098", "5", "10", "", ""), | 838 "4081", "4098", "5", "10", "", ""), | 
| 904 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", | 839 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289", | 
| 905 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 840 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", | 
| 906 "4081", "4098", "5", "10", "", "")], | 841 "4081", "4098", "5", "10", "", "")], | 
| 907 [("chr5-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, | 842 [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None, | 
| 908 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", | 843 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0", | 
| 909 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), | 844 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""), | 
| 910 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", | 845 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289", | 
| 911 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", | 846 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0", | 
| 912 "0", "0", "4081", "4098", "5", "10", "", "")], | 847 "0", "0", "4081", "4098", "5", "10", "", "")], | 
| 913 [("chr5-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", | 848 [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289", | 
| 914 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", | 849 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081", | 
| 915 "4098", "5", "10", "", ""), | 850 "4098", "5", "10", "", ""), | 
| 916 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", | 851 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289", | 
| 917 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", | 852 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081", | 
| 918 "4098", "5", "10", "", "")], | 853 "4098", "5", "10", "", "")], | 
| 919 [("chr5-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", | 854 [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290", | 
| 920 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", | 855 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1", | 
| 921 "0", "0", "3", "3", "47170", "41149", "", ""), | 856 "0", "0", "3", "3", "47170", "41149", "", ""), | 
| 922 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, | 857 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None, | 
| 923 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", | 858 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5", | 
| 924 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], | 859 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")], | 
| 925 [("chr5-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", | 860 [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271", | 
| 926 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", | 861 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", | 
| 927 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), | 862 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""), | 
| 928 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", | 863 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271", | 
| 929 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", | 864 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1", | 
| 930 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], | 865 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")], | 
| 931 [("chr5-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269", | 866 [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "0", "100", "255", "276", "269", | 
| 932 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), | 867 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), | 
| 933 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, | 868 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, | 
| 934 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", | 869 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", | 
| 935 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], | 870 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], | 
| 936 [("chr5-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269", | 871 [("Chr5:5-20000-13963-T-C", "4.2", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", | 
| 937 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""), | |
| 938 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None, | |
| 939 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", | |
| 940 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], | |
| 941 [("chr5-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263", | |
| 942 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", | 872 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0", | 
| 943 "0", "0", "0", "1", "1", "5348", "5350", "", ""), | 873 "0", "0", "0", "1", "1", "5348", "5350", "", ""), | 
| 944 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", | 874 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263", | 
| 945 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", | 875 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0", | 
| 946 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], | 876 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")], | 
| 947 [("chr5-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", | 877 [("Chr5:5-20000-13983-G-C", "5", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269", | 
| 948 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", | 878 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0", | 
| 949 "0", "1", "1", "5348", "5350", "", ""), | 879 "0", "1", "1", "5348", "5350", "", ""), | 
| 950 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, | 880 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None, | 
| 951 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", | 881 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", | 
| 952 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] | 882 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]] | 
| 972 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) | 902 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)}) | 
| 973 row += 3 | 903 row += 3 | 
| 974 workbook.close() | 904 workbook.close() | 
| 975 workbook2.close() | 905 workbook2.close() | 
| 976 workbook3.close() | 906 workbook3.close() | 
| 977 | |
| 978 | 907 | 
| 979 | 908 | 
| 980 if __name__ == '__main__': | 909 if __name__ == '__main__': | 
| 981 sys.exit(read2mut(sys.argv)) | 910 sys.exit(read2mut(sys.argv)) | 
