Mercurial > repos > mheinzl > variant_analyzer2

comparison read2mut.py @ 84:e46d5e377760 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
author mheinzl
date Fri, 19 Aug 2022 11:23:37 +0000
parents 8cec772c0bf1
children d1cd4cd9f18d
comparison
equal deleted inserted replaced
83:8cec772c0bf1 84:e46d5e377760
65 help='Count chimeric variants and correct the variant frequencies') 65 help='Count chimeric variants and correct the variant frequencies')
66 parser.add_argument('--softclipping_dist', type=int, default=15, 66 parser.add_argument('--softclipping_dist', type=int, default=15,
67 help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.') 67 help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.')
68 parser.add_argument('--reads_threshold', type=float, default=1.0, 68 parser.add_argument('--reads_threshold', type=float, default=1.0,
69 help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.') 69 help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.')
70 parser.add_argument('--refalttiers', action="store_true",
71 help='Store also information about the reference allele.')
72
70 return parser 73 return parser
71 74
72 75
73 def safe_div(x, y): 76 def safe_div(x, y):
74 if y == 0: 77 if y == 0:
85 sscs_json = args.sscsJson 88 sscs_json = args.sscsJson
86 outfile = args.outputFile 89 outfile = args.outputFile
87 outfile2 = args.outputFile2 90 outfile2 = args.outputFile2
88 outfile3 = args.outputFile3 91 outfile3 = args.outputFile3
89 outputFile_csv = args.outputFile_csv 92 outputFile_csv = args.outputFile_csv
93 refalttiers = args.refalttiers
90 94
91 thresh = args.thresh 95 thresh = args.thresh
92 phred_score = args.phred 96 phred_score = args.phred
93 trim = args.trim 97 trim = args.trim
94 chimera_correction = args.chimera_correction 98 chimera_correction = args.chimera_correction
423 chimera_dict = {} 427 chimera_dict = {}
424 for key1, value1 in sorted(mut_dict.items()): 428 for key1, value1 in sorted(mut_dict.items()):
425 counts_mut = 0 429 counts_mut = 0
426 chimeric_tag_list = [] 430 chimeric_tag_list = []
427 chimeric_tag = {} 431 chimeric_tag = {}
432
428 if (key1 in pure_tags_dict_short.keys()) or (key1 in pure_tags_dict_ref.keys()): # ref or alt 433 if (key1 in pure_tags_dict_short.keys()) or (key1 in pure_tags_dict_ref.keys()): # ref or alt
429
430 # if key1 not in np.array(['#'.join(str(i) for i in z) 434 # if key1 not in np.array(['#'.join(str(i) for i in z)
431 # for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]): 435 # for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]):
432 # continue 436 # continue
433 437
434 change_tier_after_print = [] 438 change_tier_after_print = []
475 if (((key2[:-5] in tag_dict.keys()) and (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key1 in tag_dict[key2[:-5]].keys()) and (key2[:-5] not in used_keys)) or ((key2[:-5] in tag_dict_ref.keys()) and (key2[:-5] in pure_tags_dict_ref[key1].keys()) and (key1 in tag_dict_ref[key2[:-5]].keys()) and (key2[:-5] not in used_keys))): 479 if (((key2[:-5] in tag_dict.keys()) and (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key1 in tag_dict[key2[:-5]].keys()) and (key2[:-5] not in used_keys)) or ((key2[:-5] in tag_dict_ref.keys()) and (key2[:-5] in pure_tags_dict_ref[key1].keys()) and (key1 in tag_dict_ref[key2[:-5]].keys()) and (key2[:-5] not in used_keys))):
476 if key2[:-5] in tag_dict.keys(): 480 if key2[:-5] in tag_dict.keys():
477 variant_type = "alt" 481 variant_type = "alt"
478 elif key2[:-5] in tag_dict_ref.keys(): 482 elif key2[:-5] in tag_dict_ref.keys():
479 variant_type = "ref" 483 variant_type = "ref"
484
485 if refalttiers is False and variant_type == "ref": # if we only want information about alt tiers, skip all refs
486 continue
480 487
481 if key2[:-5] + '.ab.1' in mut_dict[key1].keys(): 488 if key2[:-5] + '.ab.1' in mut_dict[key1].keys():
482 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values()) 489 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
483 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys(): 490 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
484 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na'] 491 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
680 used_keys.append(key2[:-5]) 687 used_keys.append(key2[:-5])
681 # elif variant_type == "ref": 688 # elif variant_type == "ref":
682 # used_keys_ref.append(key2[:-5]) 689 # used_keys_ref.append(key2[:-5])
683 counts_mut += 1 690 counts_mut += 1
684 691
685 if key2[:-5] == "CTTGAACACGTCAGCATGCATGGAGA":
686 print(key1, variant_type, (alt1f + alt2f + alt3f + alt4f) > 0.5, (ref1f + ref2f + ref3f + ref4f) > 0.5)
687 if (variant_type == "alt" and ((alt1f + alt2f + alt3f + alt4f) > 0.5)) or (variant_type == "ref" and ((ref1f + ref2f + ref3f + ref4f) > 0.5)): 692 if (variant_type == "alt" and ((alt1f + alt2f + alt3f + alt4f) > 0.5)) or (variant_type == "ref" and ((ref1f + ref2f + ref3f + ref4f) > 0.5)):
688 if variant_type == "alt": 693 if variant_type == "alt":
689 tier1ff, tier2ff, tier3ff, tier4ff = alt1f, alt2f, alt3f, alt4f 694 tier1ff, tier2ff, tier3ff, tier4ff = alt1f, alt2f, alt3f, alt4f
690 tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim = alt1f, alt2f, alt3f, alt4f 695 tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim = alt1f, alt2f, alt3f, alt4f
691 elif variant_type == "ref": 696 elif variant_type == "ref":
1343 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1348 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1344 elif variant_type == "ref": 1349 elif variant_type == "ref":
1345 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), 'format': format1, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1350 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1), 'format': format1, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1346 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1), 'format': format3, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1351 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1), 'format': format3, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1347 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1352 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1348 else: 1353 row += 3
1349 change_tier_after_print.append((line, line2, trimmed_actual_high_tier)) 1354 else:
1350 1355 change_tier_after_print.append((line, line2, trimmed_actual_high_tier))
1351 row += 3
1352 1356
1353 if chimera_correction: 1357 if chimera_correction:
1354 chimeric_dcs_high_tiers = 0 1358 chimeric_dcs_high_tiers = 0
1355 chimeric_dcs = 0 1359 chimeric_dcs = 0
1356 for keys_chimera in chimeric_tag.keys(): 1360 for keys_chimera in chimeric_tag.keys():
1414 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1), 'format': format3, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1418 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1), 'format': format3, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1415 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)}) 1419 ws1.conditional_format('M{}:N{}'.format(row + 1, row + 2), {'type': 'formula', 'criteria': '=$B${}>="3"'.format(row + 1), 'format': format2, 'multi_range': 'M{}:N{} S{}:T{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
1416 row += 3 1420 row += 3
1417 1421
1418 # sheet 2 1422 # sheet 2
1419 if chimera_correction: 1423 if refalttiers:
1420 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC ref (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'chimera-corrected cvrg (tiers 1.1-2.5)', 'chimeras in AC alt (tiers 1.1-2.5)', 'chimera-corrected AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)', 1424 if chimera_correction:
1421 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)', 1425 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC ref (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'chimera-corrected cvrg (tiers 1.1-2.5)', 'chimeras in AC alt (tiers 1.1-2.5)', 'chimera-corrected AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
1422 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)', 1426 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)',
1423 'tier 1.1 (ref)', 'tier 1.2 (ref)', 'tier 2.1 (ref)', 'tier 2.2 (ref)', 'tier 2.3 (ref)', 'tier 2.4 (ref)', 'tier 2.5 (ref)', 1427 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)',
1424 'tier 3.1 (ref)', 'tier 3.2 (ref)', 'tier 4 (ref)', 'tier 5.1 (ref)', 'tier 5.2 (ref)', 'tier 5.3 (ref)', 'tier 5.4 (ref)', 'tier 5.5 (ref)', 'tier 6 (ref)', 'tier 7 (ref)' 1428 'tier 1.1 (ref)', 'tier 1.2 (ref)', 'tier 2.1 (ref)', 'tier 2.2 (ref)', 'tier 2.3 (ref)', 'tier 2.4 (ref)', 'tier 2.5 (ref)',
1425 ) 1429 'tier 3.1 (ref)', 'tier 3.2 (ref)', 'tier 4 (ref)', 'tier 5.1 (ref)', 'tier 5.2 (ref)', 'tier 5.3 (ref)', 'tier 5.4 (ref)', 'tier 5.5 (ref)', 'tier 6 (ref)', 'tier 7 (ref)'
1430 )
1431 else:
1432 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC ref (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
1433 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)',
1434 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)',
1435 'tier 1.1 (ref)', 'tier 1.2 (ref)', 'tier 2.1 (ref)', 'tier 2.2 (ref)', 'tier 2.3 (ref)', 'tier 2.4 (ref)', 'tier 2.5 (ref)',
1436 'tier 3.1 (ref)', 'tier 3.2 (ref)', 'tier 4 (ref)', 'tier 5.1 (ref)', 'tier 5.2 (ref)', 'tier 5.3 (ref)', 'tier 5.4 (ref)', 'tier 5.5 (ref)', 'tier 6 (ref)', 'tier 7 (ref)'
1437 )
1426 else: 1438 else:
1427 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC ref (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)', 1439 if chimera_correction:
1428 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)', 1440 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'chimera-corrected cvrg (tiers 1.1-2.5)', 'chimeras in AC alt (tiers 1.1-2.5)', 'chimera-corrected AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
1429 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)', 1441 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)',
1430 'tier 1.1 (ref)', 'tier 1.2 (ref)', 'tier 2.1 (ref)', 'tier 2.2 (ref)', 'tier 2.3 (ref)', 'tier 2.4 (ref)', 'tier 2.5 (ref)', 1442 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)'
1431 'tier 3.1 (ref)', 'tier 3.2 (ref)', 'tier 4 (ref)', 'tier 5.1 (ref)', 'tier 5.2 (ref)', 'tier 5.3 (ref)', 'tier 5.4 (ref)', 'tier 5.5 (ref)', 'tier 6 (ref)', 'tier 7 (ref)' 1443 )
1432 ) 1444 else:
1445 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
1446 'tier 1.1 (alt)', 'tier 1.2 (alt)', 'tier 2.1 (alt)', 'tier 2.2 (alt)', 'tier 2.3 (alt)', 'tier 2.4 (alt)', 'tier 2.5 (alt)',
1447 'tier 3.1 (alt)', 'tier 3.2 (alt)', 'tier 4 (alt)', 'tier 5.1 (alt)', 'tier 5.2 (alt)', 'tier 5.3 (alt)', 'tier 5.4 (alt)', 'tier 5.5 (alt)', 'tier 6 (alt)', 'tier 7 (alt)'
1448 )
1433 ws2.write_row(0, 0, header_line2) 1449 ws2.write_row(0, 0, header_line2)
1434 row = 0 1450 row = 0
1435 1451
1436 for key1, value1 in sorted(tier_dict.items()): 1452 for key1, value1 in sorted(tier_dict.items()):
1437 if key1 in pure_tags_dict_short.keys(): 1453 if key1 in pure_tags_dict_short.keys():
1456 cum = safe_div(sum(used_tiers), cvrg) 1472 cum = safe_div(sum(used_tiers), cvrg)
1457 cum_af.append(cum) 1473 cum_af.append(cum)
1458 if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place 1474 if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place
1459 continue 1475 continue
1460 lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)]) 1476 lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)])
1461 lst.extend([(sum(used_tiers_ref[0:7]) + sum(used_tiers[0:7])), sum(used_tiers_ref[0:7]), sum(used_tiers[0:7]), safe_div(sum(used_tiers[0:7]), (sum(used_tiers_ref[0:7]) + sum(used_tiers[0:7])))]) 1477 if refalttiers:
1478 lst.extend([(sum(used_tiers_ref[0:7]) + sum(used_tiers[0:7])), sum(used_tiers_ref[0:7]), sum(used_tiers[0:7]), safe_div(sum(used_tiers[0:7]), (sum(used_tiers_ref[0:7]) + sum(used_tiers[0:7])))])
1479 else:
1480 lst.extend([(cvrg - sum(used_tiers[-10:])), sum(used_tiers[0:7]), safe_div(sum(used_tiers[0:7]), (cvrg - sum(used_tiers[-10:])))])
1462 if chimera_correction: 1481 if chimera_correction:
1463 chimeras_all = chimera_dict[key1][1] 1482 chimeras_all = chimera_dict[key1][1]
1464 new_alt = sum(used_tiers[0:7]) - chimeras_all 1483 new_alt = sum(used_tiers[0:7]) - chimeras_all
1465 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:7]))) 1484 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:7])))
1466 if fraction_chimeras is None: 1485 if fraction_chimeras is None:
1467 fraction_chimeras = 0. 1486 fraction_chimeras = 0.
1468 new_cvrg = (cvrg - sum(used_tiers[-10:])) * (1. - fraction_chimeras) 1487 new_cvrg = (cvrg - sum(used_tiers[-10:])) * (1. - fraction_chimeras)
1469 lst.extend([new_cvrg, chimeras_all, safe_div(new_alt, new_cvrg)]) 1488 lst.extend([new_cvrg, chimeras_all, safe_div(new_alt, new_cvrg)])
1470 lst.extend([alt_count, safe_div(alt_count, cvrg)]) 1489 lst.extend([alt_count, safe_div(alt_count, cvrg)])
1471 lst.extend(used_tiers) 1490 lst.extend(used_tiers)
1472 lst.extend(used_tiers_ref) 1491 if refalttiers:
1492 lst.extend(used_tiers_ref)
1473 # lst.extend(cum_af) 1493 # lst.extend(cum_af)
1474 lst = tuple(lst) 1494 lst = tuple(lst)
1475 ws2.write_row(row + 1, 0, lst) 1495 ws2.write_row(row + 1, 0, lst)
1476 if chimera_correction: 1496 if refalttiers:
1477 ws2.conditional_format('N{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$N$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'N{}:O{} N1:O1 AE{}:AF{} AE1:AF1'.format(row + 2, row + 2, row + 2, row + 2)}) 1497 if chimera_correction:
1478 ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'P{}:T{} P1:T1 AG{}:AK{} AG1:AK1'.format(row + 2, row + 2, row + 2, row + 2)}) 1498 ws2.conditional_format('N{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$N$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'N{}:O{} N1:O1 AE{}:AF{} AE1:AF1'.format(row + 2, row + 2, row + 2, row + 2)})
1479 ws2.conditional_format('U{}:AD{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$U$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'U{}:AD{} U1:AD1 AL{}:AU{} AL1:AU1'.format(row + 2, row + 2, row + 2, row + 2)}) 1499 ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'P{}:T{} P1:T1 AG{}:AK{} AG1:AK1'.format(row + 2, row + 2, row + 2, row + 2)})
1500 ws2.conditional_format('U{}:AD{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$U$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'U{}:AD{} U1:AD1 AL{}:AU{} AL1:AU1'.format(row + 2, row + 2, row + 2, row + 2)})
1501 else:
1502 ws2.conditional_format('K{}:L{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$K$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'K{}:L{} K1:L1 AB{}:AC{} AB1:AC1'.format(row + 2, row + 2, row + 2, row + 2)})
1503 ws2.conditional_format('M{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$M$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'M{}:Q{} M1:Q1 AD{}:AH{} AD1:AH1'.format(row + 2, row + 2, row + 2, row + 2)})
1504 ws2.conditional_format('R{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'R{}:AA{} R1:AA1 AI{}:AR{} AI1:AR1'.format(row + 2, row + 2, row + 2, row + 2)})
1480 else: 1505 else:
1481 ws2.conditional_format('K{}:L{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$K$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'K{}:L{} K1:L1 AB{}:AC{} AB1:AC1'.format(row + 2, row + 2, row + 2, row + 2)}) 1506 if chimera_correction:
1482 ws2.conditional_format('M{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$M$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'M{}:Q{} M1:Q1 AD{}:AH{} AD1:AH1'.format(row + 2, row + 2, row + 2, row + 2)}) 1507 ws2.conditional_format('M{}:N{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$M$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'M{}:N{} M1:N1'.format(row + 2, row + 2)})
1483 ws2.conditional_format('R{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'R{}:AA{} R1:AA1 AI{}:AR{} AI1:AR1'.format(row + 2, row + 2, row + 2, row + 2)}) 1508 ws2.conditional_format('O{}:S{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$O$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'O{}:S{} O1:S1'.format(row + 2, row + 2)})
1509 ws2.conditional_format('T{}:AC{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$T$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'T{}:AC{} T1:AC1'.format(row + 2, row + 2)})
1510 else:
1511 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1 (alt)"', 'format': format12, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
1512 ws2.conditional_format('L{}:P{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1 (alt)"', 'format': format32, 'multi_range': 'L{}:P{} L1:P1'.format(row + 2, row + 2)})
1513 ws2.conditional_format('Q{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$Q$1="tier 3.1 (alt)"', 'format': format22, 'multi_range': 'Q{}:Z{} Q1:Z1'.format(row + 2, row + 2)})
1484 row += 1 1514 row += 1
1485 1515
1486 # sheet 3 1516 # sheet 3
1487 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21), 1517 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21),
1488 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), ("tier 2.5", counter_tier25), 1518 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), ("tier 2.5", counter_tier25),
1610 for i in range(len(description_tiers)): 1640 for i in range(len(description_tiers)):
1611 ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i]) 1641 ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i])
1612 ex = examples_tiers[i] 1642 ex = examples_tiers[i]
1613 for k in range(len(ex)): 1643 for k in range(len(ex)):
1614 ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k]) 1644 ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k])
1615 ws3.conditional_format('M{}:N{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), 1645 ws3.conditional_format('M{}:N{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
1616 {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 1646 {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2),
1617 'format': format13, 1647 'format': format13,
1618 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) 1648 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)})
1619 ws3.conditional_format('M{}:N{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), 1649 ws3.conditional_format('M{}:N{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
1620 {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 1650 {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2),
1621 'format': format33, 1651 'format': format33,
1622 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)}) 1652 'multi_range': 'M{}:N{} U{}:V{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3)})