diff read2mut.py @ 23:25625221b88f draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Mon, 22 Feb 2021 16:23:48 +0000
parents 24c50e7539ef
children cf6f0fb05bad
line wrap: on
line diff
--- a/read2mut.py	Mon Feb 22 15:58:01 2021 +0000
+++ b/read2mut.py	Mon Feb 22 16:23:48 2021 +0000
@@ -813,14 +813,14 @@
                     fraction_chimeras = 0.
                 new_cvrg = cvrg * (1. - fraction_chimeras)
                 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
-            lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:])))])
+            lst.extend([(cvrg - sum(used_tiers[-6:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-6:])))])
             if chimera_correction:
                 chimeras_all = chimera_dict[key1][1]
                 new_alt = sum(used_tiers[0:6]) - chimeras_all
                 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6])))
                 if fraction_chimeras is None:
                     fraction_chimeras = 0.
-                new_cvrg = (cvrg - sum(used_tiers[-5:])) * (1. - fraction_chimeras)
+                new_cvrg = (cvrg - sum(used_tiers[-6:])) * (1. - fraction_chimeras)
                 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
             lst.extend([alt_count, safe_div(alt_count, cvrg)])
             lst.extend(used_tiers)
@@ -830,7 +830,7 @@
             if chimera_correction:
                 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
                 ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)})
-                ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)})
+                ws2.conditional_format('V{}:AA{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:AA{} V1:AA1'.format(row + 2, row + 2)})
             else:
                 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
                 ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)})
@@ -858,92 +858,92 @@
                                 'format': format3})
         ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
                                {'type': 'formula',
-                                'criteria': '=$A${}>="3"'.format(i + 2),
+                                'criteria': '=OR($A${}="tier 3.1", $A${}="tier 3.2", $A${}="tier 4.1", $A${}="tier 4.2", $A${}="tier 5", $A${}="tier 6")'.format(i + 2, i + 2, i + 2, i + 2, i + 2, i + 2),
                                 'format': format2})
 
-    description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), 
-                         ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), 
-                         ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), 
-                         ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), 
-                         ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), 
-                         ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), 
-                         ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), 
-                         ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), 
-                         ("Tier 4.1", "variants at the start of the reads"),
-                         ("Tier 4.2", "variants at the end of the reads"), 
-                         ("Tier 5", "mates with contradictory information"), 
+    description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""),
+                         ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"),
+                         ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"),
+                         ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"),
+                         ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"),
+                         ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"),
+                         ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
+                         ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
+                         ("Tier 4.1", "variants at the beginning of the reads"),
+                         ("Tier 4.2", "variants at the end of the reads"),
+                         ("Tier 5", "mates with contradictory information"),
                          ("Tier 6", "remaining variants")]
-    examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
+    examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
                         "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                         "4081", "4098", "5", "10", "", ""),
                        ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None,
                         "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None,
                         "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
+                      [("chr5-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
                         "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0",
                         "0", "4081", "4098", "5", "10", "", ""),
                        ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289",
                         "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1",
                         "7", "0", "0", "4081", "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
+                      [("chr5-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
                         "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
                         "0", "0", "1", "6", "47170", "41149", "", ""),
                        ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290",
                         "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
                         "0", "0", "1", "6", "47170", "41149", "", "")],
-                      [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289",
+                      [("chr5-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289",
                         "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                         "4081", "4098", "5", "10", "", ""),
                        ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None,
                         "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0",
                         "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289",
+                      [("chr5-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289",
                         "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                         "4081", "4098", "5", "10", "", ""),
                        ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289",
                         "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                         "4081", "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None,
+                      [("chr5-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None,
                         "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0",
                         "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""),
                        ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289",
                         "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0",
                         "0", "0", "4081", "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289",
+                      [("chr5-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289",
                         "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081",
                         "4098", "5", "10", "", ""),
                        ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289",
                         "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081",
                         "4098", "5", "10", "", "")],
-                      [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290",
+                      [("chr5-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290",
                         "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1",
                         "0", "0", "3", "3", "47170", "41149", "", ""),
                        ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None,
                         "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5",
                         "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")],
-                      [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271",
+                      [("chr5-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271",
                         "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
                         "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""),
                        ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271",
                         "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
                         "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")],
-                      [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269",
+                      [("chr5-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269",
                         "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
                        ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                         "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                         "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
-                      [("Chr5:5-20000-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269",
+                      [("chr5-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269",
                         "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
                        ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                         "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                         "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
-                      [("Chr5:5-20000-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263",
+                      [("chr5-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263",
                         "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0",
                         "0", "0", "0", "1", "1", "5348", "5350", "", ""),
                        ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263",
                         "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0",
                         "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
-                      [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
+                      [("chr5-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
                         "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0",
                         "0", "1", "1", "5348", "5350", "", ""),
                        ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None,