view read2mut.py @ 19:858ca8b7ad43 draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Mon, 22 Feb 2021 15:02:21 +0000
parents d910b6dfd826
children ac07ff15dcfd
line wrap: on
line source

#!/usr/bin/env python

"""read2mut.py

Author -- Gundula Povysil
Contact -- povysil@bioinf.jku.at

Looks for reads with mutation at known
positions and calculates frequencies and stats.

=======  ==========  =================  ================================
Version  Date        Author             Description
2.0.0    2020-10-30  Gundula Povysil    -
=======  ==========  =================  ================================


USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam
                          --inputJson tag_count_dict.json --sscsJson SSCS_counts.json
                          --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim5 10 --trim3 10 --chimera_correction

"""

from __future__ import division

import argparse
import csv
import json
import operator
import os
import re
import sys


import numpy as np
import pysam
import xlsxwriter
from cyvcf2 import VCF


def make_argparser():
    parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.')
    parser.add_argument('--mutFile',
                        help='VCF file with DCS mutations.')
    parser.add_argument('--bamFile',
                        help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).')
    parser.add_argument('--inputJson',
                        help='JSON file with data collected by mut2read.py.')
    parser.add_argument('--sscsJson',
                        help='JSON file with SSCS counts collected by mut2sscs.py.')
    parser.add_argument('--outputFile',
                        help='Output xlsx file with summary of mutations.')
    parser.add_argument('--outputFile_csv',
                        help='Output csv file with summary of mutations.')
    parser.add_argument('--outputFile2',
                        help='Output xlsx file with allele frequencies of mutations.')
    parser.add_argument('--outputFile3',
                        help='Output xlsx file with examples of the tier classification.')
    parser.add_argument('--thresh', type=int, default=0,
                        help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.')
    parser.add_argument('--phred', type=int, default=20,
                        help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.')
    parser.add_argument('--trim5', type=int, default=10,
                        help='Integer threshold for assigning mutations at start of reads to lower tier. Default 10.')
    parser.add_argument('--trim3', type=int, default=10,
                        help='Integer threshold for assigning mutations at end of reads to lower tier. Default 10.')
    parser.add_argument('--chimera_correction', action="store_true",
                        help='Count chimeric variants and correct the variant frequencies')
    return parser


def safe_div(x, y):
    if y == 0:
        return None
    return x / y


def read2mut(argv):
    parser = make_argparser()
    args = parser.parse_args(argv[1:])
    file1 = args.mutFile
    file2 = args.bamFile
    json_file = args.inputJson
    sscs_json = args.sscsJson
    outfile = args.outputFile
    outfile2 = args.outputFile2
    outfile3 = args.outputFile3
    outputFile_csv = args.outputFile_csv
    thresh = args.thresh
    phred_score = args.phred
    trim5 = args.trim5
    trim3 = args.trim3
    chimera_correction = args.chimera_correction

    if os.path.isfile(file1) is False:
        sys.exit("Error: Could not find '{}'".format(file1))
    if os.path.isfile(file2) is False:
        sys.exit("Error: Could not find '{}'".format(file2))
    if os.path.isfile(json_file) is False:
        sys.exit("Error: Could not find '{}'".format(json_file))
    if thresh < 0:
        sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh))
    if phred_score < 0:
        sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score))
    if trim < 0:
        sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh))

    # load dicts
    with open(json_file, "r") as f:
        (tag_dict, cvrg_dict) = json.load(f)

    with open(sscs_json, "r") as f:
        (mut_pos_dict, ref_pos_dict) = json.load(f)

    # read bam file
    bam = pysam.AlignmentFile(file2, "rb")

    # create mut_dict
    mut_dict = {}
    mut_read_pos_dict = {}
    mut_read_dict = {}
    reads_dict = {}
    i = 0
    mut_array = []

    for variant in VCF(file1):
        chrom = variant.CHROM
        stop_pos = variant.start
        #chrom_stop_pos = str(chrom) + "#" + str(stop_pos)
        ref = variant.REF
        alt = variant.ALT[0]
        chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt

        if len(ref) == len(alt):
            mut_array.append([chrom, stop_pos, ref, alt])
            i += 1
            mut_dict[chrom_stop_pos] = {}
            mut_read_pos_dict[chrom_stop_pos] = {}
            reads_dict[chrom_stop_pos] = {}

            for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000):
                if pileupcolumn.reference_pos == stop_pos:
                    count_alt = 0
                    count_ref = 0
                    count_indel = 0
                    count_n = 0
                    count_other = 0
                    count_lowq = 0
                    n = 0
                    print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups),
                          "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n)
                    for pileupread in pileupcolumn.pileups:
                        n += 1
                        if not pileupread.is_del and not pileupread.is_refskip:
                            tag = pileupread.alignment.query_name
                            nuc = pileupread.alignment.query_sequence[pileupread.query_position]
                            phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33
                            if phred < phred_score:
                                nuc = "lowQ"
                            if tag not in mut_dict[chrom_stop_pos]:
                                mut_dict[chrom_stop_pos][tag] = {}
                            if nuc in mut_dict[chrom_stop_pos][tag]:
                                mut_dict[chrom_stop_pos][tag][nuc] += 1
                            else:
                                mut_dict[chrom_stop_pos][tag][nuc] = 1
                            if tag not in mut_read_pos_dict[chrom_stop_pos]:
                                mut_read_pos_dict[chrom_stop_pos][tag] = np.array(pileupread.query_position) + 1
                                reads_dict[chrom_stop_pos][tag] = len(pileupread.alignment.query_sequence)
                            else:
                                mut_read_pos_dict[chrom_stop_pos][tag] = np.append(
                                    mut_read_pos_dict[chrom_stop_pos][tag], pileupread.query_position + 1)
                                reads_dict[chrom_stop_pos][tag] = np.append(
                                    reads_dict[chrom_stop_pos][tag], len(pileupread.alignment.query_sequence))

                            if nuc == alt:
                                count_alt += 1
                                if tag not in mut_read_dict:
                                    mut_read_dict[tag] = {}
                                    mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
                                else:
                                    mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
                            elif nuc == ref:
                                count_ref += 1
                            elif nuc == "N":
                                count_n += 1
                            elif nuc == "lowQ":
                                count_lowq += 1
                            else:
                                count_other += 1
                        else:
                            count_indel += 1

                    print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq))
        else:
            print("indels are currently not evaluated")

    mut_array = np.array(mut_array)
    for read in bam.fetch(until_eof=True):
        if read.is_unmapped:
            pure_tag = read.query_name[:-5]
            nuc = "na"
            for key in tag_dict[pure_tag].keys():
                if key not in mut_dict:
                    mut_dict[key] = {}
                if read.query_name not in mut_dict[key]:
                    mut_dict[key][read.query_name] = {}
                if nuc in mut_dict[key][read.query_name]:
                    mut_dict[key][read.query_name][nuc] += 1
                else:
                    mut_dict[key][read.query_name][nuc] = 1
    bam.close()

    # create pure_tags_dict
    pure_tags_dict = {}
    for key1, value1 in sorted(mut_dict.items()):
        i = np.where(np.array(['#'.join(str(i) for i in z)
                               for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
        ref = mut_array[i, 2]
        alt = mut_array[i, 3]
        pure_tags_dict[key1] = {}
        for key2, value2 in sorted(value1.items()):
            for key3, value3 in value2.items():
                pure_tag = key2[:-5]
                if key3 == alt:
                    if pure_tag in pure_tags_dict[key1]:
                        pure_tags_dict[key1][pure_tag] += 1
                    else:
                        pure_tags_dict[key1][pure_tag] = 1

    # create pure_tags_dict_short with thresh
    if thresh > 0:
        pure_tags_dict_short = {}
        for key, value in sorted(pure_tags_dict.items()):
            if len(value) < thresh:
                pure_tags_dict_short[key] = value
    else:
        pure_tags_dict_short = pure_tags_dict

    csv_data = open(outputFile_csv, "w")
    csv_writer = csv.writer(csv_data, delimiter=",")

    # output summary with threshold
    workbook = xlsxwriter.Workbook(outfile)
    workbook2 = xlsxwriter.Workbook(outfile2)
    workbook3 = xlsxwriter.Workbook(outfile3)
    ws1 = workbook.add_worksheet("Results")
    ws2 = workbook2.add_worksheet("Allele frequencies")
    ws3 = workbook3.add_worksheet("Tiers")

    format1 = workbook.add_format({'bg_color': '#BCF5A9'})  # green
    format2 = workbook.add_format({'bg_color': '#FFC7CE'})  # red
    format3 = workbook.add_format({'bg_color': '#FACC2E'})  # yellow

    format12 = workbook2.add_format({'bg_color': '#BCF5A9'})  # green
    format22 = workbook2.add_format({'bg_color': '#FFC7CE'})  # red
    format32 = workbook2.add_format({'bg_color': '#FACC2E'})  # yellow

    format13 = workbook3.add_format({'bg_color': '#BCF5A9'})  # green
    format23 = workbook3.add_format({'bg_color': '#FFC7CE'})  # red
    format33 = workbook3.add_format({'bg_color': '#FACC2E'})  # yellow

    header_line = ('variant ID', 'tier', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab',
                   'read median length.ba', 'DCS median length',
                   'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba',
                   'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba',
                   'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba',
                   'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba',
                   'in phase', 'chimeric tag')
    ws1.write_row(0, 0, header_line)
    csv_writer.writerow(header_line)
    counter_tier11 = 0
    counter_tier12 = 0
    counter_tier21 = 0
    counter_tier22 = 0
    counter_tier23 = 0
    counter_tier24 = 0
    counter_tier31 = 0
    counter_tier32 = 0
    counter_tier41 = 0
    counter_tier42 = 0
    counter_tier5 = 0
    counter_tier6 = 0
    row = 1
    tier_dict = {}
    chimera_dict = {}
    for key1, value1 in sorted(mut_dict.items()):
        counts_mut = 0
        chimeric_tag = {}
        if key1 in pure_tags_dict_short.keys():
            i = np.where(np.array(['#'.join(str(i) for i in z)
                                   for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
            ref = mut_array[i, 2]
            alt = mut_array[i, 3]
            dcs_median = cvrg_dict[key1][2]
            whole_array = list(pure_tags_dict_short[key1].keys())

            tier_dict[key1] = {}
            values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4.1", 0), ("tier 4.2", 0), ("tier 5", 0), ("tier 6", 0)]
            for k, v in values_tier_dict:
                tier_dict[key1][k] = v

            used_keys = []
            if 'ab' in mut_pos_dict[key1].keys():
                sscs_mut_ab = mut_pos_dict[key1]['ab']
            else:
                sscs_mut_ab = 0
            if 'ba' in mut_pos_dict[key1].keys():
                sscs_mut_ba = mut_pos_dict[key1]['ba']
            else:
                sscs_mut_ba = 0
            if 'ab' in ref_pos_dict[key1].keys():
                sscs_ref_ab = ref_pos_dict[key1]['ab']
            else:
                sscs_ref_ab = 0
            if 'ba' in ref_pos_dict[key1].keys():
                sscs_ref_ba = ref_pos_dict[key1]['ba']
            else:
                sscs_ref_ba = 0
            for key2, value2 in sorted(value1.items()):
                add_mut14 = ""
                add_mut23 = ""
                if (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key2[:-5] not in used_keys) and (key1 in tag_dict[key2[:-5]].keys()):
                    if key2[:-5] + '.ab.1' in mut_dict[key1].keys():
                        total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
                        if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                            na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
                        else:
                            na1 = 0
                        if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                            lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ']
                        else:
                            lowq1 = 0
                        if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                            ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref]
                            ref1f = ref1 / (total1 - na1 - lowq1)
                        else:
                            ref1 = ref1f = 0
                        if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
                            alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt]
                            alt1f = alt1 / (total1 - na1 - lowq1)
                        else:
                            alt1 = alt1f = 0
                        total1new = total1 - na1 - lowq1
                        if (key2[:-5] + '.ab.1') in mut_read_dict.keys():
                            k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys()
                            add_mut1 = len(k1)
                            if add_mut1 > 1:
                                for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items():
                                    if k != key1:
                                        new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
                                        if len(add_mut14) == 0:
                                            add_mut14 = new_mut
                                        else:
                                            add_mut14 = add_mut14 + ", " + new_mut
                        else:
                            k1 = []
                    else:
                        total1 = total1new = na1 = lowq1 = 0
                        ref1 = alt1 = ref1f = alt1f = 0
                        k1 = []

                    if key2[:-5] + '.ab.2' in mut_dict[key1].keys():
                        total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values())
                        if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                            na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na']
                        else:
                            na2 = 0
                        if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                            lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ']
                        else:
                            lowq2 = 0
                        if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                            ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref]
                            ref2f = ref2 / (total2 - na2 - lowq2)
                        else:
                            ref2 = ref2f = 0
                        if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
                            alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt]
                            alt2f = alt2 / (total2 - na2 - lowq2)
                        else:
                            alt2 = alt2f = 0
                        total2new = total2 - na2 - lowq2
                        if (key2[:-5] + '.ab.2') in mut_read_dict.keys():
                            k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys()
                            add_mut2 = len(k2)
                            if add_mut2 > 1:
                                for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items():
                                    if k != key1:
                                        new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
                                        if len(add_mut23) == 0:
                                            add_mut23 = new_mut
                                        else:
                                            add_mut23 = add_mut23 + ", " + new_mut
                        else:
                            k2 = []
                    else:
                        total2 = total2new = na2 = lowq2 = 0
                        ref2 = alt2 = ref2f = alt2f = 0
                        k2 = []

                    if key2[:-5] + '.ba.1' in mut_dict[key1].keys():
                        total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values())
                        if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                            na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na']
                        else:
                            na3 = 0
                        if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                            lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ']
                        else:
                            lowq3 = 0
                        if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                            ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref]
                            ref3f = ref3 / (total3 - na3 - lowq3)
                        else:
                            ref3 = ref3f = 0
                        if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
                            alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt]
                            alt3f = alt3 / (total3 - na3 - lowq3)
                        else:
                            alt3 = alt3f = 0
                        total3new = total3 - na3 - lowq3
                        if (key2[:-5] + '.ba.1') in mut_read_dict.keys():
                            add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys())
                            if add_mut3 > 1:
                                for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items():
                                    if k != key1 and k not in k2:
                                        new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
                                        if len(add_mut23) == 0:
                                            add_mut23 = new_mut
                                        else:
                                            add_mut23 = add_mut23 + ", " + new_mut
                    else:
                        total3 = total3new = na3 = lowq3 = 0
                        ref3 = alt3 = ref3f = alt3f = 0

                    if key2[:-5] + '.ba.2' in mut_dict[key1].keys():
                        total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values())
                        if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                            na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na']
                        else:
                            na4 = 0
                        if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                            lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ']
                        else:
                            lowq4 = 0
                        if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                            ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref]
                            ref4f = ref4 / (total4 - na4 - lowq4)
                        else:
                            ref4 = ref4f = 0
                        if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
                            alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt]
                            alt4f = alt4 / (total4 - na4 - lowq4)
                        else:
                            alt4 = alt4f = 0
                        total4new = total4 - na4 - lowq4
                        if (key2[:-5] + '.ba.2') in mut_read_dict.keys():
                            add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys())
                            if add_mut4 > 1:
                                for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items():
                                    if k != key1 and k not in k1:
                                        new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
                                        if len(add_mut14) == 0:
                                            add_mut14 = new_mut
                                        else:
                                            add_mut14 = add_mut14 + ", " + new_mut
                    else:
                        total4 = total4new = na4 = lowq4 = 0
                        ref4 = alt4 = ref4f = alt4f = 0

                    read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1
                    read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0

                    if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys():
                        read_pos1 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.1'])
                        read_len_median1 = np.median(reads_dict[key1][key2[:-5] + '.ab.1'])
                    if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys():
                        read_pos2 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ab.2'])
                        read_len_median2 = np.median(reads_dict[key1][key2[:-5] + '.ab.2'])
                    if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys():
                        read_pos3 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.1'])
                        read_len_median3 = np.median(reads_dict[key1][key2[:-5] + '.ba.1'])
                    if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys():
                        read_pos4 = np.median(mut_read_pos_dict[key1][key2[:-5] + '.ba.2'])
                        read_len_median4 = np.median(reads_dict[key1][key2[:-5] + '.ba.2'])

                    used_keys.append(key2[:-5])
                    counts_mut += 1
                    if (alt1f + alt2f + alt3f + alt4f) > 0.5:
                        if total1new == 0:
                            ref1f = alt1f = None
                            alt1ff = -1
                        else:
                            alt1ff = alt1f
                        if total2new == 0:
                            ref2f = alt2f = None
                            alt2ff = -1
                        else:
                            alt2ff = alt2f
                        if total3new == 0:
                            ref3f = alt3f = None
                            alt3ff = -1
                        else:
                            alt3ff = alt3f
                        if total4new == 0:
                            ref4f = alt4f = None
                            alt4ff = -1
                        else:
                            alt4ff = alt4f

                        beg1 = beg4 = beg2 = beg3 = 0

                        details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
                        details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)

                        trimmed_five = False
                        trimmed_three = False
                        contradictory = False

                        if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & all(float(ij) == 0. for ij in [alt2ff, alt3ff])) | (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) & all(float(ij) == 0. for ij in [alt1ff, alt4ff]))):
                            alt1ff = 0
                            alt4ff = 0
                            alt2ff = 0
                            alt3ff = 0
                            trimmed_five = False
                            trimmed_three = False
                            contradictory = True
                        else:
                            if ((read_pos1 >= 0) and (read_pos1 <= trim5)):
                                beg1 = total1new
                                total1new = 0
                                alt1ff = 0
                                alt1f = 0
                                trimmed_five = True
                            if ((read_pos1 >= 0) and (abs(read_len_median1 - read_pos1) <= trim3)):
                                beg1 = total1new
                                total1new = 0
                                alt1ff = 0
                                alt1f = 0
                                trimmed_three = True

                            if ((read_pos4 >= 0) and (read_pos4 <= trim5)):
                                beg4 = total4new
                                total4new = 0
                                alt4ff = 0
                                alt4f = 0
                                trimmed_five = True

                            if ((read_pos4 >= 0) and (abs(read_len_median4 - read_pos4) <= trim3)):
                                beg4 = total4new
                                total4new = 0
                                alt4ff = 0
                                alt4f = 0
                                trimmed_three = True

                            if ((read_pos2 >= 0) and (read_pos2 <= trim5)):
                                beg2 = total2new
                                total2new = 0
                                alt2ff = 0
                                alt2f = 0
                                trimmed_five = True

                            if ((read_pos2 >= 0) and (abs(read_len_median2 - read_pos2) <= trim3)):
                                beg2 = total2new
                                total2new = 0
                                alt2ff = 0
                                alt2f = 0
                                trimmed_three = True

                            if ((read_pos3 >= 0) and (read_pos3 <= trim5)):
                                beg3 = total3new
                                total3new = 0
                                alt3ff = 0
                                alt3f = 0
                                trimmed_five = True

                            if ((read_pos3 >= 0) and (abs(read_len_median3 - read_pos3) <= trim3)):
                                beg3 = total3new
                                total3new = 0
                                alt3ff = 0
                                alt3f = 0
                                trimmed_three = True

                            details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
                            details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)

                        # assign tiers
                        if ((all(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) | (all(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                            tier = "1.1"
                            counter_tier11 += 1
                            tier_dict[key1]["tier 1.1"] += 1

                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new])
                              & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
                            tier = "1.2"
                            counter_tier12 += 1
                            tier_dict[key1]["tier 1.2"] += 1

                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))
                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                            tier = "2.1"
                            counter_tier21 += 1
                            tier_dict[key1]["tier 2.1"] += 1

                        elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
                            tier = "2.2"
                            counter_tier22 += 1
                            tier_dict[key1]["tier 2.2"] += 1

                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & any(int(ij) >= 3 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) & any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))
                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & any(int(ij) >= 3 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) & any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))):
                            tier = "2.3"
                            counter_tier23 += 1
                            tier_dict[key1]["tier 2.3"] += 1

                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))
                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
                            tier = "2.4"
                            counter_tier24 += 1
                            tier_dict[key1]["tier 2.4"] += 1

                        elif ((len(pure_tags_dict_short[key1]) > 1) & (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) | all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
                            tier = "3.1"
                            counter_tier31 += 1
                            tier_dict[key1]["tier 3.1"] += 1

                        elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) & all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]))
                              | (all(int(ij) >= 1 for ij in [total2new, total3new]) & all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
                            tier = "3.2"
                            counter_tier32 += 1
                            tier_dict[key1]["tier 3.2"] += 1

                        elif trimmed_five:
                            tier = "4.1"
                            counter_tier41 += 1
                            tier_dict[key1]["tier 4.1"] += 1

                        elif trimmed_three:
                            tier = "4.2"
                            counter_tier42 += 1
                            tier_dict[key1]["tier 4.2"] += 1

                        elif contradictory:
                            tier = "5"
                            counter_tier5 += 1
                            tier_dict[key1]["tier 5"] += 1
                        else:
                            tier = "6"
                            counter_tier6 += 1
                            tier_dict[key1]["tier 6"] += 1

                        chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
                        var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt])
                        sample_tag = key2[:-5]
                        array2 = np.unique(whole_array)  # remove duplicate sequences to decrease running time
                        # exclude identical tag from array2, to prevent comparison to itself
                        same_tag = np.where(array2 == sample_tag)
                        index_array2 = np.arange(0, len(array2), 1)
                        index_withoutSame = np.delete(index_array2, same_tag)  # delete identical tag from the data
                        array2 = array2[index_withoutSame]
                        if len(array2) != 0:  # only perform chimera analysis if there is more than 1 variant
                            array1_half = sample_tag[0:int(len(sample_tag) / 2)]  # mate1 part1
                            array1_half2 = sample_tag[int(len(sample_tag) / 2):int(len(sample_tag))]  # mate1 part 2
                            array2_half = np.array([ii[0:int(len(ii) / 2)] for ii in array2])  # mate2 part1
                            array2_half2 = np.array([ii[int(len(ii) / 2):int(len(ii))] for ii in array2])  # mate2 part2

                            min_tags_list_zeros = []
                            chimera_tags = []
                            for mate_b in [False, True]:
                                i = 0  # counter, only used to see how many HDs of tags were already calculated
                                if mate_b is False:  # HD calculation for all a's
                                    half1_mate1 = array1_half
                                    half2_mate1 = array1_half2
                                    half1_mate2 = array2_half
                                    half2_mate2 = array2_half2
                                elif mate_b is True:  # HD calculation for all b's
                                    half1_mate1 = array1_half2
                                    half2_mate1 = array1_half
                                    half1_mate2 = array2_half2
                                    half2_mate2 = array2_half
                                # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's"
                                dist = np.array([sum(map(operator.ne, half1_mate1, c)) for c in half1_mate2])
                                min_index = np.where(dist == dist.min())  # get index of min HD
                                # get all "b's" of the tag or all "a's" of the tag with minimum HD
                                min_tag_half2 = half2_mate2[min_index]
                                min_tag_array2 = array2[min_index]  # get whole tag with min HD
                                min_value = dist.min()
                                # calculate HD of "b" to all "b's" or "a" to all "a's"
                                dist_second_half = np.array([sum(map(operator.ne, half2_mate1, e))
                                                             for e in min_tag_half2])

                                dist2 = dist_second_half.max()
                                max_index = np.where(dist_second_half == dist_second_half.max())[0]  # get index of max HD
                                max_tag = min_tag_array2[max_index]

                                # tags which have identical parts:
                                if min_value == 0 or dist2 == 0:
                                    min_tags_list_zeros.append(tag)
                                    chimera_tags.append(max_tag)

                                i += 1
                            chimera_tags = [x for x in chimera_tags if x != []]
                            chimera_tags_new = []
                            for i in chimera_tags:
                                if len(i) > 1:
                                    for t in i:
                                        chimera_tags_new.append(t)
                                else:
                                    chimera_tags_new.extend(i)
                            chimera = ", ".join(chimera_tags_new)
                        else:
                            chimera_tags_new = []
                            chimera = ""

                        if len(chimera_tags_new) > 0:
                            chimera_tags_new.append(sample_tag)
                            key_chimera = ",".join(sorted(chimera_tags_new))
                            if key_chimera in chimeric_tag.keys():
                                chimeric_tag[key_chimera].append(float(tier))
                            else:
                                chimeric_tag[key_chimera] = [float(tier)]

                        if (read_pos1 == -1):
                            read_pos1 = read_len_median1 = None
                        if (read_pos4 == -1):
                            read_pos4 = read_len_median4 = None
                        if (read_pos2 == -1):
                            read_pos2 = read_len_median2 = None
                        if (read_pos3 == -1):
                            read_pos3 = read_len_median3 = None
                        line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera)
                        ws1.write_row(row, 0, line)
                        csv_writer.writerow(line)
                        line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera)
                        ws1.write_row(row + 1, 0, line)
                        csv_writer.writerow(line)

                        ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
                                               {'type': 'formula',
                                                'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1),
                                                'format': format1,
                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
                        ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
                                               {'type': 'formula',
                                                'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(row + 1, row + 1, row + 1, row + 1),
                                                'format': format3,
                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
                        ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
                                               {'type': 'formula',
                                                'criteria': '=$B${}>="3"'.format(row + 1),
                                                'format': format2,
                                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1)})
                        row += 3

            if chimera_correction:
                chimeric_dcs_high_tiers = 0
                chimeric_dcs = 0
                for keys_chimera in chimeric_tag.keys():
                    tiers = chimeric_tag[keys_chimera]
                    chimeric_dcs += len(tiers) - 1
                    high_tiers = sum(1 for t in tiers if t < 3.)
                    if high_tiers == len(tiers):
                        chimeric_dcs_high_tiers += high_tiers - 1
                    else:
                        chimeric_dcs_high_tiers += high_tiers
                chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers)

    # sheet 2
    if chimera_correction:
        header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
                        'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4',
                        'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
                        'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6')
    else:
        header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
                        'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4',
                        'tier 3.1', 'tier 3.2', 'tier 4.1', 'tier 4.2', 'tier 5', 'tier 6', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
                        'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5', 'AF 1.1-6')

    ws2.write_row(0, 0, header_line2)
    row = 0

    for key1, value1 in sorted(tier_dict.items()):
        if key1 in pure_tags_dict_short.keys():
            i = np.where(np.array(['#'.join(str(i) for i in z)
                                   for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
            ref = mut_array[i, 2]
            alt = mut_array[i, 3]
            chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
            ref_count = cvrg_dict[key1][0]
            alt_count = cvrg_dict[key1][1]
            cvrg = ref_count + alt_count

            var_id = '-'.join([chrom, str(int(pos) + 1), ref, alt])
            lst = [var_id, cvrg]
            used_tiers = []
            cum_af = []
            for key2, value2 in sorted(value1.items()):
                # calculate cummulative AF
                used_tiers.append(value2)
                if len(used_tiers) > 1:
                    cum = safe_div(sum(used_tiers), cvrg)
                    cum_af.append(cum)
            lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)])
            if chimera_correction:
                chimeras_all = chimera_dict[key1][0]
                new_alt = sum(used_tiers) - chimeras_all
                fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers)))
                if fraction_chimeras is None:
                    fraction_chimeras = 0.
                new_cvrg = cvrg * (1. - fraction_chimeras)
                lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
            lst.extend([(cvrg - sum(used_tiers[-5:])), sum(used_tiers[0:6]), safe_div(sum(used_tiers[0:6]), (cvrg - sum(used_tiers[-5:])))])
            if chimera_correction:
                chimeras_all = chimera_dict[key1][1]
                new_alt = sum(used_tiers[0:6]) - chimeras_all
                fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:6])))
                if fraction_chimeras is None:
                    fraction_chimeras = 0.
                new_cvrg = (cvrg - sum(used_tiers[-5:])) * (1. - fraction_chimeras)
                lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
            lst.extend([alt_count, safe_div(alt_count, cvrg)])
            lst.extend(used_tiers)
            lst.extend(cum_af)
            lst = tuple(lst)
            ws2.write_row(row + 1, 0, lst)
            if chimera_correction:
                ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format1, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
                ws2.conditional_format('R{}:U{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format3, 'multi_range': 'R{}:U{} R1:U1'.format(row + 2, row + 2)})
                ws2.conditional_format('V{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$V$1="tier 3.1"', 'format': format2, 'multi_range': 'V{}:Z{} V1:Z1'.format(row + 2, row + 2)})
            else:
                ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format1, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
                ws2.conditional_format('L{}:O{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format3, 'multi_range': 'L{}:O{} L1:O1'.format(row + 2, row + 2)})
                ws2.conditional_format('P{}:T{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format2, 'multi_range': 'P{}:T{} P1:T1'.format(row + 2, row + 2)})
            row += 1

    # sheet 3
    sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21),
              ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24),
              ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4.1", counter_tier41),
              ("tier 4.2", counter_tier42), ("tier 5", counter_tier5), ("tier 6", counter_tier6)]

    header = ("tier", "count")
    ws3.write_row(0, 0, header)

    for i in range(len(sheet3)):
        ws3.write_row(i + 1, 0, sheet3[i])
        ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
                               {'type': 'formula',
                                'criteria': '=OR($A${}="tier 1.1", $A${}="tier 1.2")'.format(i + 2, i + 2),
                                'format': format1})
        ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
                               {'type': 'formula',
                                'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4")'.format(i + 2, i + 2, i + 2, i + 2),
                                'format': format3})
        ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
                               {'type': 'formula',
                                'criteria': '=$A${}>="3"'.format(i + 2),
                                'format': format2})

    description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""), 
                         ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"), 
                         ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"), 
                         ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"), 
                         ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"), 
                         ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"), 
                         ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), 
                         ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), 
                         ("Tier 4.1", "variants at the start of the reads"),
                         ("Tier 4.2", "variants at the end of the reads"), 
                         ("Tier 5", "mates with contradictory information"), 
                         ("Tier 6", "remaining variants")]
    examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
                        "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                        "4081", "4098", "5", "10", "", ""),
                       ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None,
                        "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None,
                        "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
                        "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0",
                        "0", "4081", "4098", "5", "10", "", ""),
                       ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289",
                        "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1",
                        "7", "0", "0", "4081", "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
                        "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
                        "0", "0", "1", "6", "47170", "41149", "", ""),
                       ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290",
                        "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
                        "0", "0", "1", "6", "47170", "41149", "", "")],
                      [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289",
                        "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                        "4081", "4098", "5", "10", "", ""),
                       ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None,
                        "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0",
                        "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289",
                        "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                        "4081", "4098", "5", "10", "", ""),
                       ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289",
                        "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
                        "4081", "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None,
                        "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0",
                        "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""),
                       ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289",
                        "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0",
                        "0", "0", "4081", "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289",
                        "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081",
                        "4098", "5", "10", "", ""),
                       ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289",
                        "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081",
                        "4098", "5", "10", "", "")],
                      [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290",
                        "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1",
                        "0", "0", "3", "3", "47170", "41149", "", ""),
                       ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None,
                        "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5",
                        "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")],
                      [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271",
                        "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
                        "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""),
                       ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271",
                        "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
                        "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")],
                      [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "1", "5", "255", "276", "269",
                        "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
                       ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                        "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                        "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
                      [("Chr5:5-20000-13983-G-C", "4.2", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "250", "270", "255", "276", "269",
                        "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
                       ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                        "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                        "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
                      [("Chr5:5-20000-13963-T-C", "5", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263",
                        "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0",
                        "0", "0", "0", "1", "1", "5348", "5350", "", ""),
                       ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263",
                        "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0",
                        "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
                      [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
                        "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0",
                        "0", "1", "1", "5348", "5350", "", ""),
                       ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None,
                        "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
                        "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]

    start_row = 15
    ws3.write(start_row, 0, "Description of tiers with examples")
    ws3.write_row(start_row + 1, 0, header_line)
    row = 0
    for i in range(len(description_tiers)):
        ws3.write_row(start_row + 2 + row + i + 1, 0, description_tiers[i])
        ex = examples_tiers[i]
        for k in range(len(ex)):
            ws3.write_row(start_row + 2 + row + i + k + 2, 0, ex[k])
        ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3), {'type': 'formula', 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2), 'format': format1, 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
        ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
                               {'type': 'formula', 'criteria': '=OR($B${}="2.1",$B${}="2.2", $B${}="2.3", $B${}="2.4")'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 2),
                                'format': format3,
                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
        ws3.conditional_format('L{}:M{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3),
                               {'type': 'formula',
                                'criteria': '=$B${}>="3"'.format(start_row + 2 + row + i + k + 2),
                                'format': format2,
                                'multi_range': 'L{}:M{} T{}:U{} B{}'.format(start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2, start_row + 2 + row + i + k + 3, start_row + 2 + row + i + k + 2)})
        row += 3
    workbook.close()
    workbook2.close()
    workbook3.close()
    csv_data.close()


if __name__ == '__main__':
    sys.exit(read2mut(sys.argv))