Mercurial > repos > mheinzl > variant_analyzer2
changeset 59:0b3df6ea1434 draft
planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
| author | mheinzl |
|---|---|
| date | Fri, 12 Mar 2021 18:45:03 +0000 |
| parents | 04741369fc07 |
| children | 9ce53bf0931c |
| files | read2mut.py |
| diffstat | 1 files changed, 13 insertions(+), 4 deletions(-) [+] |
line wrap: on
line diff
--- a/read2mut.py Fri Mar 12 14:34:21 2021 +0000 +++ b/read2mut.py Fri Mar 12 18:45:03 2021 +0000 @@ -593,6 +593,7 @@ softclipped_mutation_allMates = False softclipped_mutation_oneOfTwoMates = False softclipped_mutation_oneOfTwoSSCS = False + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = False softclipped_mutation_oneMateOneSSCS = False print() @@ -718,6 +719,7 @@ softclipped_mutation_allMates = True softclipped_mutation_oneOfTwoMates = False softclipped_mutation_oneOfTwoSSCS = False + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = False softclipped_mutation_oneMateOneSSCS = False alt1ff = 0 @@ -735,6 +737,7 @@ softclipped_mutation_allMates = False softclipped_mutation_oneOfTwoMates = True softclipped_mutation_oneOfTwoSSCS = False + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = False softclipped_mutation_oneMateOneSSCS = False alt1ff = 0 @@ -752,6 +755,7 @@ softclipped_mutation_allMates = False softclipped_mutation_oneOfTwoMates = False softclipped_mutation_oneOfTwoSSCS = True + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = False softclipped_mutation_oneMateOneSSCS = False alt1ff = 0 @@ -761,6 +765,7 @@ trimmed = False contradictory = False print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff]) + # information of one mate available --> all reads of one mate are softclipped elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) | @@ -774,6 +779,7 @@ softclipped_mutation_allMates = False softclipped_mutation_oneOfTwoMates = False softclipped_mutation_oneOfTwoSSCS = False + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = True softclipped_mutation_oneMateOneSSCS = False alt1ff = 0 @@ -796,6 +802,7 @@ softclipped_mutation_allMates = False softclipped_mutation_oneOfTwoMates = False softclipped_mutation_oneOfTwoSSCS = False + softclipped_mutation_oneOfTwoSSCS_diffMates = False softclipped_mutation_oneMate = False softclipped_mutation_oneMateOneSSCS = True alt1ff = 0 @@ -1104,6 +1111,8 @@ line1 = list(line1) line1[1] = "2.5" line1 = tuple(line1) + counter_tier25 += 1 + counter_tier4 -= 1 ws1.write_row(row_number, 0, line1) csv_writer.writerow(line1) ws1.write_row(row_number + 1, 0, line2) @@ -1231,11 +1240,11 @@ ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"), ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"), ("Tier 4", "variants at the start or end of the reads"), - ("Tier 5.1", "variant is close to softclipping in both mates"), - ("Tier 5.2", "variant is close to softclipping in one of the mates"), + ("Tier 5.1", "variant is close to softclipping in both mates and SSCS"), + ("Tier 5.2", "variant is close to softclipping in one of the mates but both SSCS"), ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"), - ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"), - ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"), + ("Tier 5.4", "variant is close to softclipping in one mate and both SSCS (no information of second mate)"), + ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate)"), ("Tier 6", "mates with contradictory information"), ("Tier 7", "remaining variants")] examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",