Mercurial > repos > miller-lab > genome_diversity
annotate extract_primers.xml @ 10:9b92372de9f6
rename snp to gsSnp, sap to gdSap
| author | Richard Burhans <burhans@bx.psu.edu> |
|---|---|
| date | Tue, 04 Sep 2012 12:49:53 -0400 |
| parents | e29f4d801bb0 |
| children |
| rev | line source |
|---|---|
| 0 | 1 <tool id="gd_extract_primers" name="Extract primers" version="1.0.0"> |
| 2 <description>for selected SNPs</description> | |
| 3 | |
| 4 <command interpreter="python"> | |
| 5 extract_primers.py "--input=$input" "--output=$output" "--primers_loc=${GALAXY_DATA_INDEX_DIR}/gd.primers.loc" | |
| 6 #if $override_metadata.choice == "0": | |
| 7 "--scaffold_col=${input.metadata.scaffold}" "--pos_col=${input.metadata.pos}" "--species=${input.metadata.species}" | |
| 8 #else | |
| 9 "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species" | |
| 10 #end if | |
| 11 </command> | |
| 12 | |
| 13 <inputs> | |
| 14 <param format="tabular" name="input" type="data" label="Selected SNPS dataset"/> | |
| 15 <conditional name="override_metadata"> | |
| 16 <param name="choice" type="select" format="integer" label="choose columns"> | |
| 17 <option value="0" selected="true">No, get columns from metadata</option> | |
| 18 <option value="1" >Yes, choose columns</option> | |
| 19 </param> | |
| 20 <when value="0" /> | |
| 21 <when value="1"> | |
| 22 <param name="scaf_col" type="data_column" data_ref="input" numerical="false" label="Column with scaffold"/> | |
| 23 <param name="pos_col" type="data_column" data_ref="input" numerical="true" label="Column with position"/> | |
| 24 <param name="species" type="select" label="Choose species"> | |
| 25 <options from_file="gd.species.txt"> | |
| 26 <column name="name" index="1"/> | |
| 27 <column name="value" index="0"/> | |
| 28 </options> | |
| 29 </param> | |
| 30 </when> | |
| 31 </conditional> | |
| 32 </inputs> | |
| 33 | |
| 34 <outputs> | |
| 35 <data format="txt" name="output"/> | |
| 36 </outputs> | |
| 37 | |
| 38 <tests> | |
| 39 <test> | |
|
10
9b92372de9f6
rename snp to gsSnp, sap to gdSap
Richard Burhans <burhans@bx.psu.edu>
parents:
7
diff
changeset
|
40 <param name="input" value="test_out/select_snps/select_snps.gdSnp" ftype="gdSnp" /> |
| 0 | 41 <param name="choice" value="0"/> |
| 42 <output name="output" file="test_out/extract_primers/extract_primers.txt" /> | |
| 43 </test> | |
| 44 </tests> | |
| 45 | |
| 46 | |
| 47 <help> | |
| 48 **What it does** | |
| 49 | |
| 50 This tool extracts primers for SNPs in the dataset using the Primer3 program. | |
| 51 The first line of output for a given SNP reports the name of the assembled | |
| 52 contig, the SNP's position in the contig, the two variant nucleotides, and | |
| 53 Primer3's "pair penalty". The next line, if not blank, names restriction | |
| 54 enzymes (from the user-adjustable list) that differentially cut at that | |
| 55 site, but do not cut at any other position between and including the | |
| 56 primer positions. The next lines show the SNP's flanking regions, with | |
| 57 the SNP position indicated by "n", including the primer positions and an | |
| 58 additional 3 nucleotides. | |
| 59 | |
| 60 ----- | |
| 61 | |
| 62 **Example** | |
| 63 | |
| 64 - input file:: | |
| 65 | |
| 66 chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 | |
| 67 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 | |
| 68 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 | |
| 69 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 | |
| 70 | |
| 71 - output file:: | |
| 72 | |
| 73 chr5_30800874_30802049 734 G A 0.352964 | |
| 74 BglII,MboI,Sau3AI,Tru9I,XhoII | |
| 75 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA | |
| 76 >>>>>>>>>>>>>>>>>>>> | |
| 77 | |
| 78 61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT | |
| 79 | |
| 80 | |
| 81 21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT | |
| 82 <<<<<<< | |
| 83 | |
| 84 181 TGAACCTTGGCTCTGA | |
| 85 <<<<<<<<<<<<< | |
| 86 etc. | |
| 87 </help> | |
| 88 </tool> |