Mercurial > repos > miller-lab > genome_diversity
comparison extract_primers.xml @ 21:d6b961721037
Miller Lab Devshed version 4c04e35b18f6
author | Richard Burhans <burhans@bx.psu.edu> |
---|---|
date | Mon, 05 Nov 2012 12:44:17 -0500 |
parents | 8ae67e9fb6ff |
children |
comparison
equal
deleted
inserted
replaced
20:8a4b8efbc82c | 21:d6b961721037 |
---|---|
9 "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species" | 9 "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species" |
10 #end if | 10 #end if |
11 </command> | 11 </command> |
12 | 12 |
13 <inputs> | 13 <inputs> |
14 <param format="tabular" name="input" type="data" label="Selected SNPS dataset"/> | 14 <param format="tabular" name="input" type="data" label="SNP dataset"/> |
15 <conditional name="override_metadata"> | 15 <conditional name="override_metadata"> |
16 <param name="choice" type="select" format="integer" label="choose columns"> | 16 <param name="choice" type="select" format="integer" label="Choose columns" help="Datasets in gd_snp format have the columns in the metadata, all others need the columns chosen." > |
17 <option value="0" selected="true">No, get columns from metadata</option> | 17 <option value="0" selected="true">No, get columns from metadata</option> |
18 <option value="1" >Yes, choose columns</option> | 18 <option value="1" >Yes, choose columns</option> |
19 </param> | 19 </param> |
20 <when value="0" /> | 20 <when value="0" /> |
21 <when value="1"> | 21 <when value="1"> |
44 </tests> | 44 </tests> |
45 | 45 |
46 | 46 |
47 <help> | 47 <help> |
48 | 48 |
49 **Dataset formats** | |
50 | |
51 The input dataset is in tabular_ format and must contain a scaffold or | |
52 chromosome column and a position column. The output dataset is in text_ | |
53 format as described below. | |
54 (`Dataset missing?`_) | |
55 | |
56 .. _tabular: ./static/formatHelp.html#tab | |
57 .. _text: ./static/formatHelp.html#text | |
58 .. _Dataset missing?: ./static/formatHelp.html | |
59 | |
60 ----- | |
61 | |
49 **What it does** | 62 **What it does** |
50 | 63 |
51 This tool extracts primers for SNPs in the dataset using the Primer3 program. | 64 This tool extracts primers for SNPs in the dataset using the Primer3 program |
52 The first line of output for a given SNP reports the name of the assembled | 65 (Steve Rozen and Helen J. Skaletsky, 2000). |
53 contig, the SNP's position in the contig, the two variant nucleotides, and | 66 The first line of output for a given SNP reports the name of the assembled |
54 Primer3's "pair penalty". The next line, if not blank, names restriction | 67 contig, the SNP's position in the contig, the two variant nucleotides, and |
55 enzymes (from the user-adjustable list) that differentially cut at that | 68 Primer3's "pair penalty". The next line, if not blank, names restriction |
56 site, but do not cut at any other position between and including the | 69 enzymes (from the user-adjustable list) that differentially cut at that |
57 primer positions. The next lines show the SNP's flanking regions, with | 70 site, but do not cut at any other position between and including the |
58 the SNP position indicated by "n", including the primer positions and an | 71 primer positions. The next lines show the SNP's flanking regions, with |
59 additional 3 nucleotides. | 72 the SNP position indicated by "n", including the primer positions and an |
73 additional 3 nucleotides. | |
74 <!-- is this precomputed?? how, where is the user-adjustable list? --> | |
60 | 75 |
61 ----- | 76 ----- |
62 | 77 |
63 **Example** | 78 **Example** |
64 | 79 |
65 - input file:: | 80 - input (gd_snp format):: |
66 | 81 |
67 chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 | 82 chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 |
68 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 | 83 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 |
69 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 | 84 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 |
70 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 | 85 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 |
86 etc. | |
71 | 87 |
72 - output file:: | 88 - output:: |
73 | 89 |
74 chr5_30800874_30802049 734 G A 0.352964 | 90 chr5_30800874_30802049 734 G A 0.352964 |
75 BglII,MboI,Sau3AI,Tru9I,XhoII | 91 BglII,MboI,Sau3AI,Tru9I,XhoII |
76 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA | 92 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA |
77 >>>>>>>>>>>>>>>>>>>> | 93 >>>>>>>>>>>>>>>>>>>> |