Mercurial > repos > miller-lab > genome_diversity
view extract_primers.xml @ 22:95a05c1ef5d5
update to devshed revision aaece207bd01
author | Richard Burhans <burhans@bx.psu.edu> |
---|---|
date | Mon, 11 Mar 2013 11:28:06 -0400 |
parents | d6b961721037 |
children |
line wrap: on
line source
<tool id="gd_extract_primers" name="Pick Primers" version="1.0.0"> <description>: Find suitable PCR primers for SNPs</description> <command interpreter="python"> extract_primers.py "--input=$input" "--output=$output" "--primers_loc=${GALAXY_DATA_INDEX_DIR}/gd.primers.loc" #if $override_metadata.choice == "0": "--scaffold_col=${input.metadata.scaffold}" "--pos_col=${input.metadata.pos}" "--species=${input.metadata.species}" #else "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species" #end if </command> <inputs> <param format="tabular" name="input" type="data" label="SNP dataset"/> <conditional name="override_metadata"> <param name="choice" type="select" format="integer" label="Choose columns" help="Datasets in gd_snp format have the columns in the metadata, all others need the columns chosen." > <option value="0" selected="true">No, get columns from metadata</option> <option value="1" >Yes, choose columns</option> </param> <when value="0" /> <when value="1"> <param name="scaf_col" type="data_column" data_ref="input" numerical="false" label="Column with scaffold"/> <param name="pos_col" type="data_column" data_ref="input" numerical="true" label="Column with position"/> <param name="species" type="select" label="Choose species"> <options from_file="gd.species.txt"> <column name="name" index="1"/> <column name="value" index="0"/> </options> </param> </when> </conditional> </inputs> <outputs> <data format="txt" name="output"/> </outputs> <tests> <test> <param name="input" value="test_out/select_snps/select_snps.gd_snp" ftype="gd_snp" /> <param name="choice" value="0"/> <output name="output" file="test_out/extract_primers/extract_primers.txt" /> </test> </tests> <help> **Dataset formats** The input dataset is in tabular_ format and must contain a scaffold or chromosome column and a position column. The output dataset is in text_ format as described below. (`Dataset missing?`_) .. _tabular: ./static/formatHelp.html#tab .. _text: ./static/formatHelp.html#text .. _Dataset missing?: ./static/formatHelp.html ----- **What it does** This tool extracts primers for SNPs in the dataset using the Primer3 program (Steve Rozen and Helen J. Skaletsky, 2000). The first line of output for a given SNP reports the name of the assembled contig, the SNP's position in the contig, the two variant nucleotides, and Primer3's "pair penalty". The next line, if not blank, names restriction enzymes (from the user-adjustable list) that differentially cut at that site, but do not cut at any other position between and including the primer positions. The next lines show the SNP's flanking regions, with the SNP position indicated by "n", including the primer positions and an additional 3 nucleotides. <!-- is this precomputed?? how, where is the user-adjustable list? --> ----- **Example** - input (gd_snp format):: chr5_30800874_30802049 734 G A chr5 30801606 A 24 0 99 4 11 97 Y 496 0.502 0.033 0.215 6 chr8_55117827_55119487 994 A G chr8 55118815 G 25 0 102 4 11 96 Y 22 0.502 0.025 2.365 1 chr9_100484836_100485311 355 C T chr9 100485200 T 27 0 108 6 17 100 Y 190 0.512 0.880 2.733 4 chr12_3635530_3637738 2101 T C chr12 3637630 T 25 0 102 4 13 93 Y 169 0.554 0.024 0.366 4 etc. - output:: chr5_30800874_30802049 734 G A 0.352964 BglII,MboI,Sau3AI,Tru9I,XhoII 1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA >>>>>>>>>>>>>>>>>>>> 61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT 21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT <<<<<<< 181 TGAACCTTGGCTCTGA <<<<<<<<<<<<< etc. </help> </tool>