Mercurial > repos > nate > nate_test
comparison defuse.xml @ 2:999746fc92ba default tip
Uploaded
author | nate |
---|---|
date | Thu, 10 Nov 2011 09:56:05 -0500 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
1:ad220f659249 | 2:999746fc92ba |
---|---|
1 <tool id="defuse" name="DeFuse" version="1.1"> | |
2 <description>identify fusion transcripts</description> | |
3 <requirements> | |
4 <requirement type="binary"></requirement> | |
5 </requirements> | |
6 <command interpreter="perl"> | |
7 ## Find the defuse.pl in the galaxy tool path | |
8 #import Cheetah.FileUtils | |
9 #set $toolpath = '/'.join([$__root_dir__,'tools','defuse']) | |
10 #set $defuse = $Cheetah.FileUtils.findFiles($toolpath,['defuse.pl'],[],['tools','external','include','em','data'])[0] | |
11 $defuse | |
12 -c `cp $defuse_config $config_txt; echo $defuse_config` | |
13 -d `mkdir -p data_dir; ln -s $left_pairendreads data_dir/reads_1.fastq; ln -s $right_pairendreads data_dir/reads_2.fastq; echo data_dir` | |
14 -o output_dir -p 8 | |
15 </command> | |
16 <inputs> | |
17 <param name="left_pairendreads" type="data" format="fastq" label="left part of read pairs" help="The left and right reads pairs must be in the same order, and not have any unpaired reads. (FASTQ interlacer will pair reads and remove the unpaired. FASTQ de-interlacer will separate the result into left and right reads.)"/> | |
18 <param name="right_pairendreads" type="data" format="fastq" label="right part of read pairs" help="In the same order as the left reads"/> | |
19 <conditional name="refGenomeSource"> | |
20 <param name="genomeSource" type="select" label="Will you select a built-in DeFuse Reference Dataset, or supply a configuration from your history" help=""> | |
21 <option value="indexed">Use a built-in DeFuse Reference Dataset</option> | |
22 <option value="history">Use a configuration from your history that specifies the DeFuse Reference Dataset</option> | |
23 </param> | |
24 <when value="indexed"> | |
25 <param name="index" type="select" label="Select a Reference Dataset" help="if your genome of interest is not listed - contact Galaxy team"> | |
26 <options from_file="defuse.loc"> | |
27 <column name="name" index="1"/> | |
28 <column name="value" index="2"/> | |
29 <filter type="sort_by" column="0" /> | |
30 <validator type="no_options" message="No indexes are available" /> | |
31 </options> | |
32 </param> | |
33 <conditional name="defuse_param"> | |
34 <param name="settings" type="select" label="Defuse parameter settings" help=""> | |
35 <option value="preSet">Default settings</option> | |
36 <option value="full">Full parameter list</option> | |
37 </param> | |
38 <when value="preSet" /> | |
39 <when value="full"> | |
40 <param name="max_insert_size" type="integer" value="500" optional="true" label="Bowtie max_insert_size" /> | |
41 <param name="dna_concordant_length" type="integer" value="2000" optional="true" label="Minimum gene fusion range dna_concordant_length" /> | |
42 <param name="discord_read_trim" type="integer" value="50" optional="true" label="Trim length for discordant reads discord_read_trim" help="(split reads are not trimmed)" /> | |
43 <param name="clustering_precision" type="float" value=".95" optional="true" label="Filter clustering_precision"> | |
44 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
45 </param> | |
46 <param name="span_count_threshold" type="integer" value="5" optional="true" label="Filter span_count_threshold" /> | |
47 <param name="split_count_threshold" type="integer" value="3" optional="true" label="Filter split_count_threshold" /> | |
48 <param name="percent_identity_threshold" type="float" value=".90" optional="true" label="Filter percent_identity_threshold"> | |
49 <validator type="in_range" message="Choose a value between .1 and 1.0" min=".1" max="1"/> | |
50 </param> | |
51 <param name="max_dist_pos" type="integer" value="600" optional="true" label="Filter max_dist_pos" /> | |
52 <param name="num_dist_genes" type="integer" value="500" optional="true" label="Filter num_dist_genes" /> | |
53 <param name="split_min_anchor" type="integer" value="4" optional="true" label="Filter split_min_anchor" /> | |
54 <param name="max_concordant_ratio" type="float" value="0.1" optional="true" label="Filter max_concordant_ratio"> | |
55 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
56 </param> | |
57 <param name="splice_bias" type="integer" value="10" optional="true" label="Filter splice_bias" /> | |
58 <param name="probability_threshold" type="float" value="0.50" optional="true" label="Filter probability_threshold"> | |
59 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
60 </param> | |
61 <param name="covariance_sampling_density" type="float" value="0.01" optional="true" label="covariance_sampling_density"> | |
62 <help>Position density when calculating covariance</help> | |
63 <validator type="in_range" message="Choose a value between 0.0 and 1.0" min="0" max="1"/> | |
64 </param> | |
65 <param name="denovo_assembly" type="select" label="denovo_assembly" help=""> | |
66 <option value="">Use Default</option> | |
67 <option value="no">no</option> | |
68 <option value="yes">yes</option> | |
69 </param> | |
70 <!-- | |
71 <param name="positive_controls" type="data" format="txt" optional=true label="Defuse positive_controls" help=""/> | |
72 --> | |
73 </when> <!-- full --> | |
74 </conditional> <!-- defuse_param --> | |
75 </when> | |
76 <when value="history"> | |
77 <param name="config" type="data" format="txt" label="Defuse Config file" help=""/> | |
78 </when> <!-- history --> | |
79 </conditional> <!-- refGenomeSource --> | |
80 </inputs> | |
81 <configfiles> | |
82 <configfile name="defuse_config"> | |
83 #import ast | |
84 #if $refGenomeSource.genomeSource == "history": | |
85 #include raw $refGenomeSource.config.__str__ | |
86 #else | |
87 #set $ref_dict = dict($ast.literal_eval($refGenomeSource.index.value)) | |
88 # | |
89 # Configuration file for defuse | |
90 # | |
91 # At a minimum, change all values enclused by [] | |
92 # | |
93 | |
94 # Directory where the defuse code was unpacked | |
95 ## Default location in the tool/defuse directory | |
96 # source_directory = ${__root_dir__}/tools/defuse | |
97 source_directory = #slurp | |
98 #try | |
99 $ref_dict['source_directory'] | |
100 #except | |
101 #try | |
102 ## Try to find the defuse source dir in the galaxy tool path | |
103 #import Cheetah.FileUtils | |
104 #set $toolpath = '/'.join([$__root_dir__,'tools','defuse']) | |
105 #set $defuse = $Cheetah.FileUtils.findFiles($toolpath,['defuse.pl'],[],['tools','external','include','em','data'])[0] | |
106 $defuse.replace('/scripts/defuse.pl','') | |
107 #except | |
108 ${__root_dir__}/tools/defuse/defuse | |
109 #end try | |
110 #end try | |
111 | |
112 # Directory where you want your dataset | |
113 dataset_directory = #slurp | |
114 #try | |
115 $ref_dict['dataset_directory'] | |
116 #except | |
117 /project/db/genomes/Hsapiens/hg19/defuse | |
118 #end try | |
119 | |
120 # Input genome and gene models | |
121 gene_models = #slurp | |
122 #try | |
123 $ref_dict['gene_models'] | |
124 #except | |
125 \$(dataset_directory)/Homo_sapiens.GRCh37.62.gtf | |
126 #end try | |
127 genome_fasta = #slurp | |
128 #try | |
129 $ref_dict['genome_fasta'] | |
130 #except | |
131 \$(dataset_directory)/Homo_sapiens.GRCh37.62.dna.chromosome.fa | |
132 #end try | |
133 | |
134 # Repeat table from ucsc genome browser | |
135 repeats_filename = #slurp | |
136 #try | |
137 $ref_dict['repeats_filename'] | |
138 #except | |
139 \$(dataset_directory)/rmsk.txt | |
140 #end try | |
141 | |
142 # EST info downloaded from ucsc genome browser | |
143 est_fasta = #slurp | |
144 #try | |
145 $ref_dict['est_fasta'] | |
146 #except | |
147 \$(dataset_directory)/est.fa | |
148 #end try | |
149 est_alignments = #slurp | |
150 #try | |
151 $ref_dict['est_alignments'] | |
152 #except | |
153 \$(dataset_directory)/intronEst.txt | |
154 #end try | |
155 | |
156 # Unigene clusters downloaded from ncbi | |
157 unigene_fasta = #slurp | |
158 #try | |
159 $ref_dict['unigene_fasta'] | |
160 #except | |
161 \$(dataset_directory)/Hs.seq.uniq | |
162 #end try | |
163 | |
164 # Paths to external tools | |
165 bowtie_bin = #slurp | |
166 #try | |
167 $ref_dict['bowtie_bin'] | |
168 #except | |
169 /soft/bowtie/0.12.7/bowtie | |
170 #end try | |
171 bowtie_build_bin = #slurp | |
172 #try | |
173 $ref_dict['bowtie_build_bin'] | |
174 #except | |
175 /soft/bowtie/0.12.7/bowtie-build | |
176 #end try | |
177 blat_bin = #slurp | |
178 #try | |
179 $ref_dict['blat_bin'] | |
180 #except | |
181 /soft/blat/34/bin/blat | |
182 #end try | |
183 fatotwobit_bin = #slurp | |
184 #try | |
185 $ref_dict['fatotwobit_bin'] | |
186 #except | |
187 /soft/blat/34/bin/faToTwoBit | |
188 #end try | |
189 r_bin = #slurp | |
190 #try | |
191 $ref_dict['r_bin'] | |
192 #except | |
193 /project/sdml-sles11-weblocal/R-2.12.1/bin/R | |
194 #end try | |
195 rscript_bin = #slurp | |
196 #try | |
197 $ref_dict['rscript_bin'] | |
198 #except | |
199 /project/sdml-sles11-weblocal/R-2.12.1/bin/Rscript | |
200 #end try | |
201 | |
202 #raw | |
203 # Dataset files | |
204 dataset_prefix = $(dataset_directory)/defuse | |
205 chromosome_prefix = $(dataset_prefix).dna.chromosomes | |
206 exons_fasta = $(dataset_prefix).exons.fa | |
207 cds_fasta = $(dataset_prefix).cds.fa | |
208 cdna_regions = $(dataset_prefix).cdna.regions | |
209 cdna_fasta = $(dataset_prefix).cdna.fa | |
210 reference_fasta = $(dataset_prefix).reference.fa | |
211 rrna_fasta = $(dataset_prefix).rrna.fa | |
212 ig_gene_list = $(dataset_prefix).ig.gene.list | |
213 repeats_regions = $(dataset_directory)/repeats.regions | |
214 est_split_fasta1 = $(dataset_directory)/est.1.fa | |
215 est_split_fasta2 = $(dataset_directory)/est.2.fa | |
216 est_split_fasta3 = $(dataset_directory)/est.3.fa | |
217 est_split_fasta4 = $(dataset_directory)/est.4.fa | |
218 est_split_fasta5 = $(dataset_directory)/est.5.fa | |
219 est_split_fasta6 = $(dataset_directory)/est.6.fa | |
220 est_split_fasta7 = $(dataset_directory)/est.7.fa | |
221 est_split_fasta8 = $(dataset_directory)/est.8.fa | |
222 est_split_fasta9 = $(dataset_directory)/est.9.fa | |
223 | |
224 # Fasta files with bowtie indices for prefiltering reads for concordantly mapping pairs | |
225 prefilter1 = $(unigene_fasta) | |
226 | |
227 # deFuse scripts and tools | |
228 scripts_directory = $(source_directory)/scripts | |
229 tools_directory = $(source_directory)/tools | |
230 data_directory = $(source_directory)/data | |
231 #end raw | |
232 | |
233 # Path to samtools, 0.1.8 is compiled for you, use other versions at your own risk | |
234 samtools_bin = #slurp | |
235 #try | |
236 $ref_dict['samtools_bin'] | |
237 #except | |
238 \$(source_directory)/external/samtools-0.1.8/samtools | |
239 #end try | |
240 | |
241 # Bowtie parameters | |
242 bowtie_threads = #slurp | |
243 #try | |
244 $ref_dict['bowtie_threads'] | |
245 #except | |
246 1 | |
247 #end try | |
248 bowtie_quals = #slurp | |
249 #try | |
250 $ref_dict['bowtie_quals'] | |
251 #except | |
252 --phred33-quals | |
253 #end try | |
254 max_insert_size = #slurp | |
255 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_insert_size.__str__ != "": | |
256 $refGenomeSource.defuse_param.max_insert_size | |
257 #else | |
258 #try | |
259 $ref_dict['max_insert_size'] | |
260 #except | |
261 500 | |
262 #end try | |
263 #end if | |
264 | |
265 # Parameters for building the dataset | |
266 chromosomes = #slurp | |
267 #try | |
268 $ref_dict.chromosomes | |
269 #except | |
270 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,X,Y,MT | |
271 #end try | |
272 mt_chromosome = #slurp | |
273 #try | |
274 $ref_dict['mt_chromosome'] | |
275 #except | |
276 MT | |
277 #end try | |
278 gene_sources = #slurp | |
279 #try | |
280 $ref_dict['gene_sources'] | |
281 #except | |
282 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,processed_transcript,protein_coding | |
283 #end try | |
284 ig_gene_sources = #slurp | |
285 #try | |
286 $ref_dict['ig_gene_sources'] | |
287 #except | |
288 IG_C_gene,IG_D_gene,IG_J_gene,IG_V_gene,IG_pseudogene | |
289 #end try | |
290 rrna_gene_sources = #slurp | |
291 #try | |
292 $ref_dict['rrna_gene_sources'] | |
293 #except | |
294 Mt_rRNA,rRNA,rRNA_pseudogene | |
295 #end try | |
296 | |
297 # Blat sequences per job | |
298 num_blat_sequences = #slurp | |
299 #try | |
300 $ref_dict['num_blat_sequences'] | |
301 #except | |
302 10000 | |
303 #end try | |
304 | |
305 # Minimum gene fusion range | |
306 dna_concordant_length = #slurp | |
307 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.dna_concordant_length.__str__ != "": | |
308 $refGenomeSource.defuse_param.dna_concordant_length | |
309 #else | |
310 #try | |
311 $ref_dict['dna_concordant_length'] | |
312 #except | |
313 2000 | |
314 #end try | |
315 #end if | |
316 | |
317 # Trim length for discordant reads (split reads are not trimmed) | |
318 discord_read_trim = #slurp | |
319 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.discord_read_trim.__str__ != "": | |
320 $refGenomeSource.defuse_param.discord_read_trim | |
321 #else | |
322 #try | |
323 $ref_dict['discord_read_trim'] | |
324 #except | |
325 50 | |
326 #end try | |
327 #end if | |
328 | |
329 # Filtering parameters | |
330 clustering_precision = #slurp | |
331 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.clustering_precision.__str__ != "" | |
332 $refGenomeSource.defuse_param.clustering_precision | |
333 #else | |
334 #try | |
335 $ref_dict['clustering_precision'] | |
336 #except | |
337 0.95 | |
338 #end try | |
339 #end if | |
340 span_count_threshold = #slurp | |
341 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.span_count_threshold.__str__ != "" | |
342 $refGenomeSource.defuse_param.span_count_threshold | |
343 #else | |
344 #try | |
345 $ref_dict['span_count_threshold'] | |
346 #except | |
347 5 | |
348 #end try | |
349 #end if | |
350 split_count_threshold = #slurp | |
351 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_count_threshold.__str__ != "" | |
352 $refGenomeSource.defuse_param.split_count_threshold | |
353 #else | |
354 #try | |
355 $ref_dict['split_count_threshold'] | |
356 #except | |
357 3 | |
358 #end try | |
359 #end if | |
360 percent_identity_threshold = #slurp | |
361 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.percent_identity_threshold.__str__ != "" | |
362 $refGenomeSource.defuse_param.percent_identity_threshold | |
363 #else | |
364 #try | |
365 $ref_dict['percent_identity_threshold'] | |
366 #except | |
367 0.90 | |
368 #end try | |
369 #end if | |
370 max_dist_pos = #slurp | |
371 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_dist_pos.__str__ != "" | |
372 $refGenomeSource.defuse_param.max_dist_pos | |
373 #else | |
374 #try | |
375 $ref_dict['max_dist_pos'] | |
376 #except | |
377 600 | |
378 #end try | |
379 #end if | |
380 num_dist_genes = #slurp | |
381 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.num_dist_genes.__str__ != "" | |
382 $refGenomeSource.defuse_param.num_dist_genes | |
383 #else | |
384 #try | |
385 $ref_dict['num_dist_genes'] | |
386 #except | |
387 500 | |
388 #end try | |
389 #end if | |
390 split_min_anchor = #slurp | |
391 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.split_min_anchor.__str__ != "" | |
392 $refGenomeSource.defuse_param.split_min_anchor | |
393 #else | |
394 #try | |
395 $ref_dict['split_min_anchor'] | |
396 #except | |
397 4 | |
398 #end try | |
399 #end if | |
400 max_concordant_ratio = #slurp | |
401 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.max_concordant_ratio.__str__ != "" | |
402 $refGenomeSource.defuse_param.max_concordant_ratio | |
403 #else | |
404 #try | |
405 $ref_dict['max_concordant_ratio'] | |
406 #except | |
407 0.1 | |
408 #end try | |
409 #end if | |
410 splice_bias = #slurp | |
411 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.splice_bias.__str__ != "" | |
412 $refGenomeSource.defuse_param.splice_bias | |
413 #else | |
414 #try | |
415 $ref_dict['splice_bias'] | |
416 #except | |
417 10 | |
418 #end try | |
419 #end if | |
420 denovo_assembly = #slurp | |
421 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.denovo_assembly.__str__ != "" | |
422 $refGenomeSource.defuse_param.denovo_assembly | |
423 #else | |
424 #try | |
425 $ref_dict['denovo_assembly'] | |
426 #except | |
427 no | |
428 #end try | |
429 #end if | |
430 probability_threshold = #slurp | |
431 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.probability_threshold.__str__ != "" | |
432 $refGenomeSource.defuse_param.probability_threshold | |
433 #else | |
434 #try | |
435 $ref_dict['probability_threshold'] | |
436 #except | |
437 0.50 | |
438 #end try | |
439 #end if | |
440 positive_controls = \$(data_directory)/controls.txt | |
441 | |
442 # Position density when calculating covariance | |
443 covariance_sampling_density = #slurp | |
444 #if $refGenomeSource.defuse_param.settings == "full" and $refGenomeSource.defuse_param.covariance_sampling_density.__str__ != "" | |
445 $refGenomeSource.defuse_param.covariance_sampling_density | |
446 #else | |
447 #try | |
448 $ref_dict['covariance_sampling_density'] | |
449 #except | |
450 0.01 | |
451 #end try | |
452 #end if | |
453 | |
454 | |
455 # Number of reads for each job in split | |
456 reads_per_job = 1000000 | |
457 | |
458 # Number of regions for each breakpoint sequence job in split | |
459 regions_per_job = 20 | |
460 | |
461 #raw | |
462 # If you have command line 'mail' and wish to be notified | |
463 # mailto = andrew.mcpherson@gmail.com | |
464 | |
465 # Remove temp files | |
466 remove_job_files = yes | |
467 remove_job_temp_files = yes | |
468 | |
469 # Converting to fastq | |
470 # Fastq converter config format 1 for reads stored in separate files for each end | |
471 # data_lane_rexex_N is a perl regex which stores the lane id in $1 | |
472 # data_end_regex_N is a perl regex which stores the end, 1 or 2, in $1 | |
473 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
474 # data_convert_N is the associated conversion utility that takes data at stdin and outputs fastq at stdout | |
475 # Fastq converter config format 2 for reads stored in separate files for each end | |
476 # data_lane_regex_N is a perl regex which stores the lane id in $1 | |
477 # data_compress_regex_N is a perl regex which stores the compression extension in $1 | |
478 # data_end1_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 1 at stdout | |
479 # data_end2_converter_N is the associated conversion utility that takes data at stdin and outputs fastq for end 2 at stdout | |
480 | |
481 data_lane_regex_1 = ^(.+)_[12]_export\.txt.*$ | |
482 data_end_regex_1 = ^.+_([12])_export\.txt.*$ | |
483 data_compress_regex_1 = ^.+_[12]_export\.txt(.*)$ | |
484 data_converter_1 = $(scripts_directory)/fq_all2std.pl export2std | |
485 | |
486 data_lane_regex_2 = ^(.+)_[12]_concat_qseq\.txt.*$ | |
487 data_end_regex_2 = ^.+_([12])_concat_qseq\.txt.*$ | |
488 data_compress_regex_2 = ^.+_[12]_concat_qseq\.txt(.*)$ | |
489 data_converter_2 = $(scripts_directory)/qseq2fastq.pl | |
490 | |
491 data_lane_regex_3 = ^(.+)\.bam.*$ | |
492 data_compress_regex_3 = ^.+\.bam(.*)$ | |
493 data_end1_converter_3 = samtools view - | filter_sam_mate.pl 1 | sam_to_fastq.pl | |
494 data_end2_converter_3 = samtools view - | filter_sam_mate.pl 2 | sam_to_fastq.pl | |
495 | |
496 data_lane_regex_4 = ^(.+).[12].fastq.*$ | |
497 data_end_regex_4 = ^.+.([12]).fastq.*$ | |
498 data_compress_regex_4 = ^.+.[12].fastq(.*)$ | |
499 data_converter_4 = cat | |
500 #end raw | |
501 | |
502 #end if | |
503 | |
504 </configfile> | |
505 </configfiles> | |
506 <outputs> | |
507 <data format="txt" name="config_txt" label="${tool.name} on ${on_string}: config.txt"/> | |
508 <data format="txt" name="defuse_log" label="${tool.name} on ${on_string}: defuse.log" from_work_dir="output_dir/log/defuse.log"/> | |
509 <data format="tabular" name="results_tsv" label="${tool.name} on ${on_string}: results.tsv" from_work_dir="output_dir/results.tsv"/> | |
510 <data format="tabular" name="results_filtered_tsv" label="${tool.name} on ${on_string}: results.filtered.tsv" from_work_dir="output_dir/results.filtered.tsv"/> | |
511 <data format="tabular" name="results_classify_tsv" label="${tool.name} on ${on_string}: results.classify.tsv" from_work_dir="output_dir/results.classify.tsv"/> | |
512 </outputs> | |
513 <tests> | |
514 </tests> | |
515 <help> | |
516 **DeFuse** | |
517 | |
518 DeFuse_ is a software package for gene fusion discovery using RNA-Seq data. The software uses clusters of discordant paired end alignments to inform a split read alignment analysis for finding fusion boundaries. The software also employs a number of heuristic filters in an attempt to reduce the number of false positives and produces a fully annotated output for each predicted fusion. | |
519 | |
520 Journal reference: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1001138 | |
521 | |
522 .. _DeFuse: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=Main_Page | |
523 | |
524 ------ | |
525 | |
526 **Inputs** | |
527 | |
528 DeFuse requires 2 fastq files for paried reads, one with the left mate of the paired reads, and a second fastq with the the right mate of the paired reads (**with reads in the same order as in the first fastq dataset**). | |
529 | |
530 If your fastq files have reads in different orders or include unpaired reads, you can preprocess them with **FASTQ interlacer** to create a single interlaced fastq dataset with only the paired reads and input that to **FASTQ de-interlacer** to separate the reads into a left fastq and right fastq. | |
531 | |
532 DeFuse uses a Reference Dataset to search for gene fusions. The Reference Dataset is generated from the following sources in DeFuse_Version_0.4_: | |
533 - genome_fasta from Ensembl | |
534 - gene_models from Ensembl | |
535 - repeats_filename from UCSC RepeatMasker rmsk.txt | |
536 - est_fasta from UCSC | |
537 - est_alignments from UCSC intronEst.txt | |
538 - unigene_fasta from NCBI | |
539 | |
540 .. _DeFuse_Version_0.4: http://sourceforge.net/apps/mediawiki/defuse/index.php?title=DeFuse_Version_0.4.2 | |
541 | |
542 ------ | |
543 | |
544 **Outputs** | |
545 | |
546 The galaxy history will contain 5 outputs: the config.txt file that provides DeFuse with its parameters, the defuse.log which details what DeFuse has done and can be useful in determining any errors, and the 3 results files that defuse generates. | |
547 | |
548 DeFuse generates 3 results files: results.txt, results.filtered.txt, and results.classify.txt. All three files have the same format, though results.classify.txt has a probability column from the application of the classifier to results.txt, and results.filtered.txt has been filtered according to the threshold probability as set in config.txt. | |
549 | |
550 The file format is tab delimited with one prediction per line, and the following fields per prediction (not necessarily in this order): | |
551 | |
552 - **Identification** | |
553 - cluster_id : random identifier assigned to each prediction | |
554 - library_name : library name given on the command line of defuse | |
555 - gene1 : ensembl id of gene 1 | |
556 - gene2 : ensembl id of gene 2 | |
557 - gene_name1 : name of gene 1 | |
558 - gene_name2 : name of gene 2 | |
559 - **Evidence** | |
560 - break_predict : breakpoint prediction method, denovo or splitr, that is considered most reliable | |
561 - concordant_ratio : proportion of spanning reads considered concordant by blat | |
562 - denovo_min_count : minimum kmer count across denovo assembled sequence | |
563 - denovo_sequence : fusion sequence predicted by debruijn based denovo sequence assembly | |
564 - denovo_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
565 - gene_align_strand1 : alignment strand for spanning read alignments to gene 1 | |
566 - gene_align_strand2 : alignment strand for spanning read alignments to gene 2 | |
567 - min_map_count : minimum of the number of genomic mappings for each spanning read | |
568 - max_map_count : maximum of the number of genomic mappings for each spanning read | |
569 - mean_map_count : average of the number of genomic mappings for each spanning read | |
570 - num_multi_map : number of spanning reads that map to more than one genomic location | |
571 - span_count : number of spanning reads supporting the fusion | |
572 - span_coverage1 : coverage of spanning reads aligned to gene 1 as a proportion of expected coverage | |
573 - span_coverage2 : coverage of spanning reads aligned to gene 2 as a proportion of expected coverage | |
574 - span_coverage_min : minimum of span_coverage1 and span_coverage2 | |
575 - span_coverage_max : maximum of span_coverage1 and span_coverage2 | |
576 - splitr_count : number of split reads supporting the prediction | |
577 - splitr_min_pvalue : p-value, lower values are evidence the prediction is a false positive | |
578 - splitr_pos_pvalue : p-value, lower values are evidence the prediction is a false positive | |
579 - splitr_sequence : fusion sequence predicted by split reads | |
580 - splitr_span_pvalue : p-value, lower values are evidence the prediction is a false positive | |
581 - **Annotation** | |
582 - adjacent : fusion between adjacent genes | |
583 - altsplice : fusion likely the product of alternative splicing between adjacent genes | |
584 - break_adj_entropy1 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 1 | |
585 - break_adj_entropy2 : di-nucleotide entropy of the 40 nucleotides adjacent to the fusion splice in gene 2 | |
586 - break_adj_entropy_min : minimum of break_adj_entropy1 and break_adj_entropy2 | |
587 - breakpoint_homology : number of nucleotides at the fusion splice that align equally well to gene 1 or gene 2 | |
588 - breakseqs_estislands_percident : maximum percent identity of fusion sequence alignments to est islands | |
589 - cdna_breakseqs_percident : maximum percent identity of fusion sequence alignments to cdna | |
590 - deletion : fusion produced by a genomic deletion | |
591 - est_breakseqs_percident : maximum percent identity of fusion sequence alignments to est | |
592 - eversion : fusion produced by a genomic eversion | |
593 - exonboundaries : fusion splice at exon boundaries | |
594 - expression1 : expression of gene 1 as number of concordant pairs aligned to exons | |
595 - expression2 : expression of gene 2 as number of concordant pairs aligned to exons | |
596 - gene_chromosome1 : chromosome of gene 1 | |
597 - gene_chromosome2 : chromosome of gene 2 | |
598 - gene_end1 : end position for gene 1 | |
599 - gene_end2 : end position for gene 2 | |
600 - gene_location1 : location of breakpoint in gene 1 | |
601 - gene_location2 : location of breakpoint in gene 2 | |
602 - gene_start1 : start of gene 1 | |
603 - gene_start2 : start of gene 2 | |
604 - gene_strand1 : strand of gene 1 | |
605 - gene_strand2 : strand of gene 2 | |
606 - genome_breakseqs_percident : maximum percent identity of fusion sequence alignments to genome | |
607 - genomic_break_pos1 : genomic position in gene 1 of fusion splice / breakpoint | |
608 - genomic_break_pos2 : genomic position in gene 2 of fusion splice / breakpoint | |
609 - genomic_strand1 : genomic strand in gene 1 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
610 - genomic_strand2 : genomic strand in gene 2 of fusion splice / breakpoint, retained sequence upstream on this strand, breakpoint is downstream | |
611 - interchromosomal : fusion produced by an interchromosomal translocation | |
612 - interrupted_index1 : ratio of coverage before and after the fusion splice / breakpoint in gene 1 | |
613 - interrupted_index2 : ratio of coverage before and after the fusion splice / breakpoint in gene 2 | |
614 - inversion : fusion produced by genomic inversion | |
615 - orf : fusion combines genes in a way that preserves a reading frame | |
616 - probability : probability produced by classification using adaboost and example positives/negatives (only given in results.classified.txt) | |
617 - read_through : fusion involving adjacent potentially resulting from co-transcription rather than genome rearrangement | |
618 - repeat_proportion1 : proportion of the spanning reads in gene 1 that span a repeat region | |
619 - repeat_proportion2 : proportion of the spanning reads in gene 2 that span a repeat region | |
620 - max_repeat_proportion : max of repeat_proportion1 and repeat_proportion2 | |
621 - splice_score : number of nucleotides similar to GTAG at fusion splice | |
622 - num_splice_variants : number of potential splice variants for this gene pair | |
623 - splicing_index1 : number of concordant pairs in gene 1 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 2 | |
624 - splicing_index2 : number of concordant pairs in gene 2 spanning the fusion splice / breakpoint, divided by number of spanning reads supporting the fusion with gene 1 | |
625 | |
626 | |
627 **Example** | |
628 | |
629 results.tsv:: | |
630 | |
631 cluster_id splitr_sequence splitr_count splitr_span_pvalue splitr_pos_pvalue splitr_min_pvalue adjacent altsplice break_adj_entropy1 break_adj_entropy2 break_adj_entropy_min break_predict breakpoint_homology breakseqs_estislands_percident cdna_breakseqs_percident concordant_ratio deletion est_breakseqs_percident eversion exonboundaries expression1 expression2 gene1 gene2 gene_align_strand1 gene_align_strand2 gene_chromosome1 gene_chromosome2 gene_end1 gene_end2 gene_location1 gene_location2 gene_name1 gene_name2 gene_start1 gene_start2 gene_strand1 gene_strand2 genome_breakseqs_percident genomic_break_pos1 genomic_break_pos2 genomic_strand1 genomic_strand2 interchromosomal interrupted_index1 interrupted_index2 inversion library_name max_map_count max_repeat_proportion mean_map_count min_map_count num_multi_map num_splice_variants orf read_through repeat_proportion1 repeat_proportion2 span_count span_coverage1 span_coverage2 span_coverage_max span_coverage_min splice_score splicing_index1 splicing_index2 | |
632 1169 GCTTACTGTATGCCAGGCCCCAGAGGGGCAACCACCCTCTAAAGAGAGCGGCTCCTGCCTCCCAGAAAGCTCACAGACTGTGGGAGGGAAACAGGCAGCAGGTGAAGATGCCAAATGCCAGGATATCTGCCCTGTCCTTGCTTGATGCAGCTGCTGGCTCCCACGTTCTCCCCAGAATCCCCTCACACTCCTGCTGTTTTCTCTGCAGGTTGGCAGAGCCCCATGAGGGCAGGGCAGCCACTTTGTTCTTGGGCGGCAAACCTCCCTGGGCGGCACGGAAACCACGGTGAGAAGGGGGCAGGTCGGGCACGTGCAGGGACCACGCTGCAGG|TGTACCCAACAGCTCCGAAGAGACAGCGACCATCGAGAACGGGCCATGATGACGATGGCGGTTTTGTCGAAAAGAAAAGGGGGAAATGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTGTGTCTGTGTAGAAAGAAGTAGACATGGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGATTCGGTGACCCCACCCCCAACCCCGTGCTCTCTGAAACATGTGCTGTGTCCACTCAGGGTTGAATGGATTAAGGGCGGTGCGAGACGTGCTTT 2 0.000436307890680442 0.110748295953850 0.0880671602973091 N Y 3.19872427442695 3.48337348351473 3.19872427442695 splitr 0 0 0 0 Y 0 N N 0 0 ENSG00000105549 ENSG00000213753 + - 19 19 376013 59111168 intron upstream THEG AC016629.2 361750 59084870 - + 0 375099 386594 + - N 8.34107429512245 - N output_dir 82 0.677852348993289 40.6666666666667 1 11 1 N N 0.361271676300578 0.677852348993289 12 0.758602776578432 0.569678713445872 0.758602776578432 0.569678713445872 2 0.416666666666667 - | |
633 3596 TGGGGGTTGAGGCTTCTGTTCCCAGGTTCCATGACCTCAGAGGTGGCTGGTGAGGTTATGACCTTTGCCCTCCAGCCCTGGCTTAAAACCTCAGCCCTAGGACCTGGTTAAAGGAAGGGGAGATGGAGCTTTGCCCCGACCCCCCCCCGTTCCCCTCACCTGTCAGCCCGAGCTGGGCCAGGGCCCCTAGGTGGGGAACTGGGCCGGGGGGCGGGCACAAGCGGAGGTGGTGCCCCCAAAAGGGCTCCCGGTGGGGTCTTGCTGAGAAGGTGAGGGGTTCCCGGGGCCGCAGCAGGTGGTGGTGGAGGAGCCAAGCGGCTGTAGAGCAAGGGGTGAGCAGGTTCCAGACCGTAGAGGCGGGCAGCGGCCACGGCCCCGGGTCCAGTTAGCTCCTCACCCGCCTCATAGAAGCGGGGTGGCCTTGCCAGGCGTGGGGGTGCTGCC|TTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTGATTCCCCGTCACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAGGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCAGCCCGAGGTTATCTAGAGTCACCAAAGCCGCCGGCGCCCGCCCCCCGGCCGGGGCCGGAGAGGGGCTGACCGGGTTGGTTTTGATCTGATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAGGAGCGAGCGACCAAAGGAACCATAACTGATTTAATGAGCCATTCGCAGTTTCACTGTACCGGCCGTGCGTACTTAGACATGCATGGCTTAATCTTTGAGACAAGCATATGCTACTGGCAGG 250 7.00711162298275e-72 0.00912124762512338 0.00684237452309549 N N 3.31745197152461 3.47233119514066 3.31745197152461 splitr 7 0.0157657657657656 0 0 N 0.0135135135135136 N N 0 0 ENSG00000156860 ENSG00000212932 - + 16 21 30682131 48111157 coding upstream FBRS RPL23AP4 30670289 48110676 + + 0.0157657657657656 30680678 9827473 - + Y - - N output_dir 2 1 1.11111111111111 1 1 1 N N 0 1 9 0.325530693397641 0.296465452915709 0.325530693397641 0.296465452915709 2 - - | |
634 | |
635 </help> | |
636 </tool> |