Mercurial > repos > nml > gnali
changeset 0:9ca12bc2be43 draft
"planemo upload for repository https://github.com/phac-nml/gnali/ commit 1bb63f9b717c62189682e43098042852fceb4d43"
| author | nml |
|---|---|
| date | Mon, 30 Mar 2020 11:48:21 -0400 |
| parents | |
| children | 3bfa1089a2c4 |
| files | gnali.xml test-data/results/Nonessential_Host_Genes_(Basic).txt test-data/results/Nonessential_Host_Genes_(Detailed).txt test-data/test_genes.txt |
| diffstat | 4 files changed, 85 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gnali.xml Mon Mar 30 11:48:21 2020 -0400 @@ -0,0 +1,77 @@ +<tool id="gnali" name="gNALI" version="0.1.0" python_template_version="3.6"> + <description>Get nonessential, LoF variants</description> + <requirements> + <requirement type="package" version="0.1">gnali</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + gnali -i '$test_genes' -o output + ]]></command> + <inputs> + <param type="data" name="test_genes" label="Test genes" format="txt" help="Specify a list of genes as HGNC symbols, separated by newline characters" /> + <param type="select" name="database" label="Database" format="txt" help="Database to query" > + <option value="gnomad2.1.1" selected="true">gnomAD2.1.1 (GRCh37/hg19)</option> + </param> + </inputs> + <outputs> + <data name="basic_output" label="gNALI basic output" format="txt" from_work_dir="output/Nonessential_Host_Genes_\(Basic\).txt" /> + <data name="detailed_output" label="gNALI detailed output" format="txt" from_work_dir="output/Nonessential_Host_Genes_\(Detailed\).txt" /> + </outputs> + <tests> + <test> + <param name="test_genes" value="test_genes.txt"/> + <output name="basic_output"> + <assert_contents> + <has_text text="CCR5" /> + </assert_contents> + </output> + <output name="detailed_output"> + <assert_contents> + <has_text_matching expression="Chromosome\tPosition_Start\tRSID\tReference_Allele\tAlternate_Allele\tScore\tQuality\tLoF_Variant\tLoF_Annotation\tHGNC_Symbol\tEnsembl Code" /> + <has_text_matching expression="3\t46414935\trs938517991\tAT\tA\t9974.16\tPASS\t-\tframeshift_variant\tCCR5\tENSG00000160791" /> + <has_text_matching expression="3\t46414943\trs775750898\tTACAGTCAGTATCAATTCTGGAAGAATTTCCAG\tT\t74264261.52\tPASS\t-\tframeshift_variant\tCCR5\tENSG00000160791" /> + <has_text_matching expression="3\t46415066\trs146972949\tC\tT\t120238.89\tPASS\tT\tstop_gained\tCCR5\tENSG00000160791" /> + <has_text_matching expression="3\t46414943\trs775750898\tTACAGTCAGTATCAATTCTGGAAGAATTTCCAG\tT\t1947603.90\tPASS\t-\tframeshift_variant\tCCR5\tENSG00000160791" /> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + +gNALI - Gene Nonessentiality and Loss-of-function Identifier +============================================================ + +gNALI is a tool to find (high confidence) potential loss-of-function variants of genes. + + +Authors +------- + +gNALI was developed by Xia Liu. + + +Usage +----- + +Accepted input formats: csv, txt, tsv + +Your input file should contain a list of genes (as HGNC symbols) to test, separated by newline characters. +It should not contain any blank lines until the end of the list. + +There will be two output files: + + 1. A basic output file, containing genes (as HGNC symbols) with nonessential, loss-of-function variants. + 2. A detailed output file, with more information on the variants. + + ]]></help> + <citations> + <citation type="bibtex"> + @misc{GitHubgnali, + author = {Xia, Liu}, + year = {2020}, + title = {gnali}, + publisher = {phac-nml}, + journal = {GitHub repository}, + url = {https://github.com/phac-nml/gnali/}, + }</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/results/Nonessential_Host_Genes_(Basic).txt Mon Mar 30 11:48:21 2020 -0400 @@ -0,0 +1,1 @@ +CCR5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/results/Nonessential_Host_Genes_(Detailed).txt Mon Mar 30 11:48:21 2020 -0400 @@ -0,0 +1,5 @@ +Chromosome Position_Start RSID Reference_Allele Alternate_Allele Score Quality LoF_Variant LoF_Annotation HGNC_Symbol Ensembl Code +3 46414935 rs938517991 AT A 9974.16 PASS - frameshift_variant CCR5 ENSG00000160791 +3 46414943 rs775750898 TACAGTCAGTATCAATTCTGGAAGAATTTCCAG T 74264261.52 PASS - frameshift_variant CCR5 ENSG00000160791 +3 46415066 rs146972949 C T 120238.89 PASS T stop_gained CCR5 ENSG00000160791 +3 46414943 rs775750898 TACAGTCAGTATCAATTCTGGAAGAATTTCCAG T 1947603.90 PASS - frameshift_variant CCR5 ENSG00000160791